Aberrant methylation of dipeptidyl peptidase‑like 6 as a potential prognostic biomarker for lung adenocarcinoma
- Authors:
- Published online on: April 5, 2023 https://doi.org/10.3892/ol.2023.13792
- Article Number: 206
-
Copyright: © Munkhjargal et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
According to Global Cancer Observatory data, lung cancer is the second most common cancer worldwide (1). Although smoking is still a dominant risk factor for lung cancer, other risk factors, including environmental and occupational exposure, chronic lung disease, and lifestyle factors, contribute to the risk of developing lung cancer. Lung adenocarcinoma (LADC) is the most common type of lung cancer, accounting for approximately 50% of all cases, and its frequency is increasing. Even though the major cause of LADC is smoking, it is also the most common type of lung cancer in non-smokers (2).
In the past decade, advances have been achieved in the epidemiology and prevention of lung cancer. Nevertheless, lung cancer remains the leading cause of cancer death in both sexes and in all ages. The lack of specific symptoms in the early stages and practical biomarkers for screening and the prediction of patient outcomes partially explain the poor survival rate and mortality of these patients (3).
Oncogenesis is a highly complex, multi-step process involving genetic and epigenetic changes. Lung cancer has a higher tumor mutational burden than other cancer types, which may be related to smoking and exposure to tobacco xenobiotics (4). A previous study examined the rates of protein-altering mutations in 441 tumors. The findings obtained showed that non-small cell lung cancer (NSCLC) had one of the highest rates of protein-altering mutations, with rates in adenocarcinomas and squamous cell carcinomas of 3.5 and 3.9 per megabase, respectively (5). NSCLC treatment strategies and prognoses are markedly affected by the stage of the disease at diagnosis. Surgery is highly effective in the early stages, but ineffective in patients with metastasis, which accounts for the majority of cases at the time of diagnosis. In a previous study, up to 69% of advanced NSCLC patients were estimated to have targetable mutations in a number of genes, including epidermal growth factor receptor (EGFR), anaplastic lymphoma kinase, c-ROS oncogene 1, Kirsten rat sarcoma virus, V-RAF murine sarcoma oncogene homolog B1, mesenchymal-epithelial transition factor receptor, and human EGFR-related 2 (6).
Epigenetic alterations have been detected in all human cancers, and these changes, including DNA methylation, play an important role in the early development and progression of diseases, particularly cancer (7). The DNA methylation of intermittently distributed CpG sites down-regulates the expression of tumor suppressor genes. Furthermore, aberrant DNA methylation patterns have been identified in many cases of lung cancer, with most being located in promoter sequences (8,9). Moreover, a progressive CpG island (CGI) methylation pattern was detected in atypical adenomatous hyperplasia and adenocarcinoma in situ that was followed by further methylation and the development of LADC (10,11). These findings suggest that DNA methylation has potential in the development of biomarker candidates for the early detection of cancer and outcome predictions.
We previously performed the genome-wide screening of aberrantly methylated CGIs using the paired tumorous and non-tumorous tissues of 12 LADC samples. The top 10 significantly methylated genes were noted and the gene showing the highest methylation level was dipeptidyl peptidase-like 6 (DPP6). Furthermore, the expression of DPP6 was down-regulated in cancer cell lines (12). DPP6 is a type II transmembrane protein and a member of the prolyl oligopeptidase family of serine proteases (13,14). DPP6 is mostly studied as an auxiliary subunit of voltage-gated K+ channels of the Kv4 family. However, DPP6 hypermethylation has been identified in several cancer types (15–19).
In the present study, we examined the DNA methylation and gene expression levels of DPP6 in resected LADC tissues to assess its potential as a prognostic marker for LADC.
Materials and methods
Patients and tissue samples
Seventy-three LADC tissues, including 25 pairs of tumor-matched normal tissues, were collected from patients who underwent surgery at Tokushima University Hospital between April 1999 and November 2013. Tissue samples were snap-frozen and stored at 80°C for the later isolation of DNA and RNA. A methylation analysis and RT-PCR were performed on 73 tumor samples and 25 normal lung samples. Tumor staging was conducted based on the seventh tumor-node-metastasis classification for lung cancer (20). Tumors were classified according to the predominant histological subtype proposed by the 2015 WHO classification (21). The mean follow-up duration for 162 patients with LADC was 48 months (range, 0.6-147 months), with 45 cases of recurrence in (27.8%) and 34 of death (21.0%).
The Ethics Committee of the University of Tokushima approved the present study (Tokushima University Hospital, approval no. 4071), and procedures were conducted according to the Declaration of Helsinki. All patients provided written informed consent.
Clinical characteristics
Clinical information on 73 LADC patients, including survival data and basic characteristics, such as sex, age at diagnosis, tumor stage, histology, smoking history, and EGFR mutations, was obtained and shown in Table I.
Global methylation analysis
We previously screened 12 paired tumorous/non-tumorous LADC sample sets obtained from freshly frozen specimens using Illumina HumanMethylation450 K Bead Chip to identify aberrantly methylated CGIs in a genome-wide manner. Nineteen CGIs were identified as differentially hypermethylated in the DPP6 gene, with a false discovery rate of <0.05 and β difference (tumor-non-tumorous tissue) of >0.25. CGI in DPP6 was ranked as the most hypermethylated CGI with a high P-value. A schematic diagram of the DPP6 mRNA structure is shown in Fig. 1A. Among the 26 exons of DPP6 mRNA, the CGI was located around exon 1. Fig. 1B shows the results of the array-based methylation status of each CpG site within DPP6. We examined the DNA methylation of 4 CpG sites near cg00017489 of the DPP6 gene.
Nucleic acid isolation
DNA and RNA were extracted from frozen tissue using the QIAamp DNA Mini Kit 50 and RNeasy Mini kit (Qiagen GmbH) according to the manufacturer's instructions.
Bisulfite pyrosequencing
Genomic DNA was converted to bisulfite using the manufacturer's specified EpiTect Bisulfite Kit 48 (Qiagen). Transformed DNA was amplified by PCR with Pyromark PCR-Kit 200 (Qiagen) before pyrosequencing. Sequencing primers were developed using PyroMark Assay Design 2.0: forward, TTTGGGTGGGTTTGTATATGAATTTG; reverse, (biotin)-TACCCCTAAACCCTATTCCAT-CAATCATC. Pyrosequencing was performed according to published protocols using PSQ 96MA (Qiagen) to obtain the methylation rate at the mean of four CpG sites. The methylation rate at each CpG was calculated using PyroQ-CpG 1.0.9.
Real-time quantitative PCR
Reverse transcription was performed with iScript Reverse transcription Supermix. SsoAdvanced Universal SYBR® Green Supermix (Bio-Rad) and the DPP6 Taqman Gene expression assay were used for quantitative PCR employing the following primers: DPP6 forward 5′-ATGCAGGGGAACGTGATG-3′, DPP6 reverse 5′-GCAGTGCAATTGCTATTCCTT-3. GAPDH forward 5′-AGCCACATCGCTCAGACAC-3′, GAPDH reverse 5′-GCCCAATACGACCAAATCC-3′ GAPDH was used as the internal control gene.
Statistical analysis
The paired t-test and Wilcoxon signed-rank test were used for comparisons between paired samples when data were and were not normally distributed, respectively. The relationships between methylation and mRNA expression levels and clinical characteristics, including tumor stage, histological patterns, smoking history, blood vessel invasion, lymph vessel invasion, pleural invasion, and lymph node metastasis, were examined using the unpaired t-test for normally distributed data and the Mann-Whitney test for not normally distributed data. Multiple group comparisons were conducted using a one-way analysis of variance followed by Tukey's multiple comparison test for normally distributed data and the Kruskal-Wallis test followed by Dunn's multiple comparison test for not normally distributed data. The relationships between the methylation and mRNA expression levels of DPP6 and basic clinical characteristics were examined by the chi-square test. Survival data analyzed by the Kaplan-Meier analysis with the Log-rank test were used to compare overall survival (OS) and disease-free survival (DFS) rates across high/low methylation and high/low mRNA expression levels. The cut-off values were made from ROC curves. The multivariate survival analyses were calculated using the likelihood ratio test of the stratified Cox's proportional hazard regression analysis. All statistical analyses were performed using GraphPad Prism, version 5.00; and SPSS (version 24.0; IBM Corp.).
Results
Methylation and mRNA expression levels of DPP6 in LADC samples and paired adjacent normal tissues
The methylation and mRNA expression levels of the DPP6 gene were examined in 25 matched samples. Fig. 2A shows the methylation levels of the DPP6 gene in LADC and normal lung tissues. DNA methylation levels were significantly higher in tumor samples than in normal samples (the Wilcoxon signed-rank test, P<0.0001). Fig. 2B shows the mRNA expression levels of DPP6 in LADC and normal lung tissues. mRNA expression levels were significantly lower in tumor samples than in normal samples (the Wilcoxon signed-rank test, P<0.0001).
The relationship between the DNA methylation and mRNA expression levels of DPP6 in 98 samples /73 tumor and 25 normal/ was examined with Spearman's rank correlation (Fig. 2C). The obtained results revealed a negative relationship between methylation and mRNA expression levels (P=0.0001, ρ=−0.5231).
Relationships between methylation and mRNA expression levels of DPP6 and the malignant behavior of LADC
To examine the effects of the hypermethylation of DPP6 on the malignancy and carcinogenesis of LADC, we measured methylation and mRNA expression levels in 73 samples and compared the results obtained with histology patterns and stage grading.
DPP6 methylation levels were lower in the IA group than in the other groups. Furthermore, slightly higher mRNA expression levels were observed in the IA group (Fig. 3A and 3B). No significant differences were observed in methylation levels in samples with the lepidic and other histological patterns (Fig. 3C). However, DPP6 mRNA expression levels were higher in samples with the lepidic pattern than in those with other histological patterns (Fig. 3D) (the Mann-Whitney test P=0.0393). The relationships between the methylation and mRNA expression levels of DPP6 and basic clinical characteristics are shown in Table II. Data were analyzed by cross-tabulation with the chi-square test. Methylation levels were significantly higher in LADC with than in that without pleural invasion (Table II). mRNA levels were significantly lower in LADC with than in that without pleural invasion (Table II). LADC with vascular invasion had higher methylation and lower mRNA expression levels of DPP6. The relationships between the mRNA expression levels of DPP6 and blood and lymph vessel invasions are shown in Fig S1.
 | Table II.Characteristics of patients grouped by the median value of DNA methylation or mRNA expression. |
Prognostic value of DPP6 mRNA expression and methylation levels in LADC
We performed DFS and OS analyses of the mRNA expression and methylation levels of DPP6 (Fig. 4). Samples were divided into high/low expression and high/low methylation levels using cut-off values generated from the ROC/Receiver-Operating characteristic/curves (Fig. 5). DFS and OS rates were significantly higher in samples with high mRNA expression levels of DPP6 than in those with low levels (the Kaplan-Meier analysis, DFS P=0.0016 cut-off value 0.4 and OS P=0.0184 cut-off value 0.3).
However, no significant differences were observed in DFS or OS between samples with high and low DPP6 methylation levels (the Kaplan-Meier analysis, DFS P=0.1589 cut-off value 27 and OS P=0.233 cut-off value 34.5). The ROC curves of DFS and OS are shown in (Fig. 5).
The multivariate Cox's regression analysis revealed that the tumor staging (HR; 0.289, 95% CI; 0.094-0.885 P=0.030) was an independent prognostic factor for DFS (Table III) and the patients' age (HR; 5.377, 95% CI; 1.086-26.623 P=0.039) for OS (Table III). According to the multivariate analysis the DNA methylation and mRNA expression level of DPP6 were not significant to predict DFS and OS.
| Table III.Cox proportional hazard regression analysis of disease-free and overall survival in 73 lung adenocarcinoma samples. |
Discussion
In addition to its role in the modulation of A-type potassium channels in neurons and also in neuronal development and synaptic plasticity (13), DPP6 is involved in tumorigenesis (22,23). Furthermore, the hypermethylation of DPP6 has been identified in several cancer types and is associated with survival rates, which will be discussed in the following paragraphs.
We examined the methylation and gene expression levels of the DPP6 gene. Low methylation and high mRNA expression levels of DPP6 were observed in normal tissues. On the other hand, high methylation and low mRNA expression levels of DPP6 were detected in tumor tissues. These results indicate an inverse relationship between the methylation and mRNA expression levels of DPP6 in LADC. The relationship between the DNA methylation and mRNA expression levels of DPP6 was analyzed by Spearman's rank correlation (P=0.001).
DPP6 is primarily a tumor suppressor gene. A previous study on pancreatic ductal adenocarcinoma reported that the β-value of the DPP6 promoter was significantly higher in tumor samples than in normal samples, while the methylation levels of the DPP6 promoter negatively correlated with mRNA expression levels in 72 paired tissues (15). Another study detected the hypermethylation of DPP6 in esophageal adenocarcinoma, which showed the down-regulated mRNA expression of DPP6 in 78 paired samples (16). Furthermore, DPP6 was shown to be significantly methylated in acute myeloid leukemia, and analyses of its gene expression revealed its down-regulation (17). Collectively, these findings indicate that DPP6 is tightly regulated during oncogenic development. Moreover, the hypermethylation of DPP6 was reported in clear cell renal cell carcinoma (ccRCC) and was associated with advanced and high-grade tumors (18). DPP6 was also identified as one of the differentially methylated genes in LADC.
This study used data obtained from UCSC Xena, which included 29 paired samples. The methylation levels of DPP6 were higher in tumor samples than in normal samples (19). These findings indicate that the hypermethylation of DPP6 occurs in several cancer types and contributes to the low mRNA expression levels of DPP6.
In the present study, the methylation and expression levels of DPP6 were associated with lung cancer stages and histological patterns. Low methylation and high expression levels of DPP6 were detected in the early stage of LADC (IA). In contrast, high methylation and low expression levels of DPP6 were observed in the advanced stages of LADC (including IB, II, and III). The methylation levels of DPP6 were lower in samples with the lepidic pattern than in those with other histological patterns. Furthermore, the mRNA expression levels of DPP6 were significantly higher in the former than in the latter. LADC with a lepidic histology pattern is less malignant than that with other histological patterns.
DPP6 was identified as one of the genetically altered genes that regulate vascular invasion in human pancreatic cancer (24). In the present study, positive blood and lymph vessel invasion was associated with low mRNA expression levels of DPP6 (Fig. S1). Collectively, these findings and the present results suggest that high methylation and low expression levels of DPP6 have a negative impact on the prognosis of patients with several types of cancers, including LADC.
The survival rate of patients with lung cancer is low due to the lack of specific symptoms in the early stages and practical biomarkers for screening and outcome predictions. Therefore, we analyzed OS and DFS based on a receiver operating characteristic curve. The methylation level of DPP6 did not significantly differ between the groups examined; however, the survival rate was higher in the group with low methylation levels than in that with high methylation levels. On the other hand, the survival rate was significantly higher in the group with high mRNA expression levels than in that with low expression levels.
A previous study examined the survival rates of patients with breast cancer based on the expression of DPP6. According to Kaplan-Meier plots, high expression levels of DPP6 were associated with higher DFS rates (n=2898) (25). Furthermore, a Kaplan-Meier survival analysis of candidate biomarkers and 12 genes, including DPP6, revealed their significant effects on the prognosis of pancreatic cancer patients. The OS rate was higher in the group with high mRNA expression levels of DPP6 (n=150) (26). Therefore, high methylation and low mRNA expression levels of DPP6 may have a negative impact on the prognosis of patients with cancer.
Limited information is currently available on the oncogenic properties of the DPP6 gene. In patients with esophageal carcinoma, high expression levels of DPP6 were associated with shorter survival, and DPP6 was negatively regulated by activating enhancer-binding protein 2 (AP-2α) and positively by AP-2γ (27). Furthermore, in patients with esophageal squamous cell carcinoma, DPP6 was up-regulated by ARID3A and down-regulated by ZNF354C (28). DPP6 is also involved in the regulation of cell-specific phenotypes and its deregulation may result in carcinogenesis. Low methylation and high expression levels of the DPP6 gene have been observed in colon cancer (29). Based on these findings, DPP6 may act as a tumor suppressor gene in LADC; however, the methylation and expression levels of DPP6 may depend on the cancer type.
We performed immunohistochemistry to detect the expression of DPP6. However, we were unable to evaluate the results obtained because the protein expression of DPP6 in healthy lungs was generally low. Therefore, we need a more sensitive assay to assess tissue protein expression. Furthermore, DPP6 was stained in the interstitial tissues, but not tumor cells of tumor tissues, indicating non-specific staining. The function of DPP6 in the regulation of tumor progression currently remains unknown. Therefore, further studies are needed to obtain more detailed insights into this novel biomarker.
In conclusion, the methylation levels of DDP6 differed between lung cancer tissues and normal tissues. The low mRNA expression level of DPP6 was associated with the malignant features of lung cancer samples and poor survival rates. The present results indicate the potential of DPP6 as a biomarker for lung cancer screening and outcome predictions.
Supplementary Material
Supporting Data
Acknowledgements
Not applicable.
Funding
Funding: No funding was received.
Availability of data and materials
The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.
Authors' contributions
BM, KK, SS, and BT analyzed and interpreted patient data on DNA methylation using pyrosequencing and mRNA expression by RT-qPCR. KK, HTo, and HTa designed and conducted the present study. KK, CT and NK performed histological examinations of lung cancer and combined the clinical data of patients. BM and KK were major contributors to the writing of the manuscript. BM and KK confirm the authenticity of raw data. All authors have read and approved the final manuscript.
Ethics approval and consent to participate
The Ethics Committee of the University of Tokushima approved the present study (Tokushima University Hospital; approval no. 4071), and all procedures were conducted according to the Declaration of Helsinki. All patients provided written informed consent.
Patient consent for publication
Not applicable.
Competing interests
All authors declare that they have no competing interests.
Glossary
Abbreviations
Abbreviations:
|
CGIs |
CpG islands |
|
LADC |
lung adenocarcinomas |
|
DPP6 |
dipeptidyl peptidase-like 6 |
|
NSCLC |
non-small cell lung cancer |
|
EGFR |
epidermal growth factor receptor |
|
OS |
overall survival |
|
DFS |
disease-free survival |
References
|
Sheikh MA, Malik YS, Yu H, Lai M, Wang X and Zhu X: Epigenetic regulation of Dpp6 expression by Dnmt3b and its novel role in the inhibition of RA induced neuronal differentiation of P19 cells. PLoS One. 8:e558262013. View Article : Google Scholar : PubMed/NCBI | |
|
Succony L, Rassl DM, Barker AP, McCaughan FM and Rintoul RC: Adenocarcinoma spectrum lesions of the lung: Detection, pathology and treatment strategies. Cancer Treat Rev. 99:1022372021. View Article : Google Scholar : PubMed/NCBI | |
|
Bade BC and Dela Cruz CS: Lung cancer 2020: Epidemiology, etiology, and prevention. Clin Chest Med. 41:1–24. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
Zito Marino F, Bianco R, Accardo M, Ronchi A, Cozzolino I, Morgillo F, Rossi G and Franco R: Molecular heterogeneity in lung cancer: From mechanisms of origin to clinical implications. Int J Med Sci. 16:981–989. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Kan Z, Jaiswal BS, Stinson J, Janakiraman V, Bhatt D, Stern HM, Yue P, Haverty PM, Bourgon R, Zheng J, et al: Diverse somatic mutation patterns and pathway alterations in human cancers. Nature. 466:869–873. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Wheeler DA and Wang L: From human genome to cancer genome: the first decade. Genome Res. 23:1054–1062. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Jha G, Azhar S, Rashid U, Khalaf H, Alhalabi N, Ravindran D and Ahmad R: Epigenetics: The key to future diagnostics and therapeutics of lung cancer. Cureus. 13:e197702021.PubMed/NCBI | |
|
Rauch TA, Wang Z, Wu X, Kernstine KH, Riggs AD and Pfeifer GP: DNA methylation biomarkers for lung cancer. Tumour Biol. 33:287–296. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Chao YL and Pecot CV: Targeting epigenetics in lung cancer. Cold Spring Harb Perspect Med. 11:a0380002021. View Article : Google Scholar : PubMed/NCBI | |
|
Selamat SA, Galler JS, Joshi AD, Fyfe MN, Campan M, Siegmund KD, Kerr KM and Laird-Offringa IA: DNA methylation changes in atypical adenomatous hyperplasia, adenocarcinoma in situ, and lung adenocarcinoma. PLoS One. 6:e214432011. View Article : Google Scholar : PubMed/NCBI | |
|
Chung JH, Lee HJ, Kim BH, Cho NY and Kang GH: DNA methylation profile during multistage progression of pulmonary adenocarcinomas. Virchows Arch. 459:201–211. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Kajiura K, Masuda K, Naruto T, Kohmoto T, Watabnabe M, Tsuboi M, Takizawa H, Kondo K, Tangoku A and Imoto I: Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinoma. Oncotarget. 8:2890–2905. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Strop P, Bankovich AJ, Hansen KC, Garcia KC and Brunger AT: Structure of a human A-type potassium channel interacting protein DPPX, a member of the dipeptidyl aminopeptidase family. J Mol Biol. 343:1055–1065. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Nadal MS, Ozaita A, Amarillo Y, Vega-Saenz de Miera E, Ma Y, Mo W, Goldberg EM, Misumi Y, Ikehara Y, Neubert TA and Rudy B: The CD26-related dipeptidyl aminopeptidase-like protein DPPX is a critical component of neuronal A-type K+ channels. Neuron. 37:449–461. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Zhao X, Cao D, Ren Z, Liu Z, Lv S, Zhu J, Li L, Lang R and He Q: Dipeptidyl peptidase like 6 promoter methylation is a potential prognostic biomarker for pancreatic ductal adenocarcinoma. Biosci Rep. 40:BSR202002142020. View Article : Google Scholar : PubMed/NCBI | |
|
Xi T and Zhang G: Epigenetic regulation on the gene expression signature in esophagus adenocarcinoma. Pathol Res Pract. 213:83–88. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Saied MH, Marzec J, Khalid S, Smith P, Down TA, Rakyan VK, Molloy G, Raghavan M, Debernardi S and Young BD: Genome wide analysis of acute myeloid leukemia reveal leukemia specific methylome and subtype specific hypomethylation of repeats. PLoS One. 7:e332132012. View Article : Google Scholar : PubMed/NCBI | |
|
Kang HW, Park H, Seo SP, Byun YJ, Piao XM, Kim SM, Kim WT, Yun SJ, Jang W, Shon HS, et al: Methylation signature for prediction of progression free survival in surgically treated clear cell renal cell carcinoma. J Korean Med Sci. 34:e1442019. View Article : Google Scholar : PubMed/NCBI | |
|
Li M, Zhang C, Zhou L, Li S, Cao YJ, Wang L, Xiang R, Shi Y and Piao Y: Identification and validation of novel DNA methylation markers for early diagnosis of lung adenocarcinoma. Mol Oncol. 14:2744–2758. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
Goldstraw P, Crowley J, Chansky K, Giroux DJ, Groome PA, Rami-Porta R, Postmus PE, Rusch V and Sobin L; International Association for the Study of Lung Cancer International Staging Committee and Participating Institutions, . The IASLC lung cancer staging project: proposals for the revision of the TNM stage groupings in the forthcoming (seventh) edition of the TNM Classification of malignant tumours. J Thorac Oncol. 2:706–714. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Travis WD, Brambilla E, Burke AP, Marx A and Nicholson AG: Introduction to the 2015 world health organization classification of tumors of the lung, pleura, thymus, and heart. J Thorac Oncol. 10:1240–1242. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Sedo A and Kraml J: Dipeptidyl peptidase IV in cell proliferation and differentiation. Sb Lek. 95:285–288. 1994.PubMed/NCBI | |
|
Kotacková L, Baláziová E and Sedo A: Expression pattern of dipeptidyl peptidase IV activity and/or structure homologues in cancer. Folia Biol (Praha). 55:77–84. 2009.PubMed/NCBI | |
|
Jones S, Zhang X, Parsons DW, Lin JC, Leary RJ, Angenendt P, Mankoo P, Carter H, Kamiyama H, Jimeno A, et al: Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science. 321:1801–1806. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Choy TK, Wang CY, Phan NN, Khoa Ta HD, Anuraga G, Liu YH, Wu YF, Lee KH, Chuang JY and Kao TJ: Identification of Dipeptidyl Peptidase (DPP) family genes in clinical breast cancer patients via an integrated bioinformatics approach. Diagnostics (Basel). 11:12042021. View Article : Google Scholar : PubMed/NCBI | |
|
Jia Y, Shen M, Zhou Y and Liu H: Development of a 12-biomarkers-based prognostic model for pancreatic cancer using multi-omics integrated analysis. Acta Biochim Pol. 67:501–508. 2020.PubMed/NCBI | |
|
Kolat D, Kaluzinska Z, Bednarek AK and Pluciennik E: Prognostic significance of AP-2α/γ targets as cancer therapeutics. Sci Rep. 12:54972022. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang Y, Xu Y, Li Z, Zhu Y, Wen S, Wang M, Lv H, Zhang F and Tian Z: Identification of the key transcription factors in esophageal squamous cell carcinoma. J Thorac Dis. 10:148–161. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Irizarry RA, Ladd-Acosta C, Wen B, Wu Z, Montano C, Onyango P, Cui H, Gabo K, Rongione M, Webster M, et al: The human colon cancer methylome shows similar hypo- and hypermethylation at conserved tissue-specific CpG island shores. Nat Genet. 41:178–186. 2009. View Article : Google Scholar : PubMed/NCBI |
