Co‑expression of SLC20A1 and ALDH1A3 is associated with poor prognosis, and SLC20A1 is required for the survival of ALDH1‑positive pancreatic cancer stem cells
- Authors:
- Published online on: July 5, 2024 https://doi.org/10.3892/ol.2024.14558
- Article Number: 426
-
Copyright: © Matsuoka et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
Pancreatic ductal adenocarcinoma (PDAC) is the seventh leading cause of cancer-associated mortality worldwide (1). Despite improvements in diagnostic and therapeutic methods, its 5-year survival rate remains ~10%, which is the lowest among all of the cancer types investigated in the USA (2). The reasons why patients with PDAC exhibit a poor prognosis include its rapid progression, limited medical treatments and low therapeutic effect. The majority of patients are diagnosed after invasion and distant metastasis (3–5), and are not candidates for surgical tumor resection, and it is thus difficult to cure completely. Therefore, it is important to develop a biomarker for early prognosis and targeted drugs for PDAC.
Cancer stem cells (CSCs) have stemness properties such as self-renewal, multipotency and the promotion of tumorigenesis (6,7). CSCs exhibit resistance to standard therapies, such as chemotherapy and radiotherapy, and therefore can cause relapse after treatments (6–8). In PDAC, cells with high aldehyde dehydrogenase 1 (ALDH1) activity (ALDH1high) have stemness properties, such as self-renewal, differentiation, and tumor formation (9–13). ALDH1 is a detoxification enzyme that converts aldehydes into carboxylic acids in cells, and has several subtypes, including ALDH1A1 and ALDH1A3, which are known as CSC markers in several types of cancer (9,14–16). It is known that ALDH1A1 and ALDH1A3 expression levels are higher in PDAC tumors than in normal tissues, and that high ALDH1A3 expression in PDACs is associated with poor clinical outcomes (17–19).
Solute carrier family 20 member 1 (SLC20A1) is a sodium/inorganic phosphate (Pi) symporter that is responsible for Pi uptake into cells (20,21). Previous reports have shown that high SLC20A1 expression is a prognostic factor for esophageal carcinoma, and breast, lung, pancreatic and prostate cancers (22–31). At the early tumor stage of estrogen receptor-positive (ER+) breast cancer, high SLC20A1 expression predicts a poor clinical outcome (22). Furthermore, high SLC20A1 expression is less effective for endocrine therapy and predicts late recurrence in ER+ breast cancer (22), and is also less effective for radiotherapy in basal-like, claudin-low and ER+ subtypes of breast cancer (23,24). In addition, SLC20A1 contributes to cell viability and tumor formation of ALDH1-positive breast CSCs (23). In HeLa, HepG2, MC3T3-E1 and NIH3T3 cell lines, SLC20A1 small interfering RNA (siRNA) knockdown (KD) has been shown to induce the suppression of cell proliferation and cell motility, and to induce TNFα-mediated apoptosis (32–34). However, the relationship between SLC20A1 expression and CSC markers, such as ALDH1, in PDAC, and the role of SLC20A1 in PDAC CSCs remains to be elucidated.
This study revealed that high SLC20A1 expression indicated a poor prognosis at the early tumor stage of PDAC, and high expression levels of SLC20A1 and ALDH1A3 indicated a poorer prognosis in PDAC. In addition, the current results showed that SLC20A1 was involved in cell survival and the formation of tumorspheres in ALDH1-positive PDAC CSCs.
Materials and methods
Analysis of the pancreatic adenocarcinoma [The Cancer Genome Atlas (TCGA), Pan-Cancer Atlas)] dataset
The TCGA, Pan-Cancer Atlas dataset (n=184) (35,36) was downloaded from cBioPortal (https://www.cbioportal.org/) (37,38) on December 8, 2020. Data on SLC20A1 expression in normal tissues and primary tumors that were not derived from the same patients were downloaded from UALCAN (39). Statistical analyses were carried out by BellCurve for Excel version 4.03 software (Social Survey Research Information Co., Ltd.). The clinicopathological data of the Pan-Cancer Atlas dataset are summarized in Table SI. TCGA, Pan-Cancer Atlas dataset contains data on gene alterations, mRNA expression levels of primary pancreatic cancer samples (n=177), overall survival (OS) (n=177), disease-specific survival (DSS) (n=171), disease-free interval (DFI) (n=69), progression-free interval (PFI) (n=177), gene mutation (n=172) and copy number alteration (n=176). Beeswarm plots were drawn in GraphPad Prism ver. 9.5.1 (GraphPad Software) and analyzed expression of SLC20A1 gene in patients with gene alternations. The optimal cutoff thresholds to classify the patients into high- and low-mRNA expression groups were defined using receiver operator characteristic curve (ROC) of SLC20A1 and other stem cell markers, and was determined by using the Youden's index. Survival curves of OS, DSS, DFI and PFI were depicted using the Kaplan-Meier method, and were compared by log-rank (Cochran-Mantel-Haenszel) test. Multivariate Cox regression analysis with age at diagnosis and sex as confounding factors was performed to evaluate the influence of gene expression, and to estimate adjusted hazard ratios (HRs) for OS, DSS, DFI and PFI statuses. Two-sided P<0.05 was considered to indicate a statistically significant difference.
Cell lines and culture
The human PDAC cell line PANC-1 was purchased from the American Type Culture Collection (CRL-1469; Manassas, Virginia, USA). The MIA-PaCa-2 cell line was purchased from the Japanese Cancer Research Resources Bank (JCRB0070; Tokyo, Japan). Both cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (cat. no. 175012; Nichirei Biosciences, Inc.), L-glutamine (cat. no. 073-05391; Wako, Tokyo, Japan) and 1% penicillin/streptomycin (cat. no. 168-23191; Wako) at 37°C with 5% CO2. These cell lines were evaluated by using a mycoplasma detecting kit (cat. no. 25235; Intron Biotechnology, Inc.) and were negative for mycoplasma.
siRNA transfection
RNA interference-mediated SLC20A1 KD was performed by transfection of the PDAC cell lines with Dicer-Substrate Short Interfering RNA (DsiRNA) for SLC20A1 (sense strand, 5′-CUCUAGUGGCUUCAGUAUUGAACTG-3′; antisense strand, 5′-CAGUUCAAUACUGAAGCCACUAGAGGG-3′) (Integrated DNA Technologies, Inc., Iowa, USA) (23). Control DsiRNA (sense strand, 5′-CGUUAAUCGCGUAUAAUACGCGUAT-3′; antisense strand, 5′-AUACGCGUAUUAUACGCGAUUAACGAC-3′) (Integrated DNA Technologies, Inc., Iowa, USA) was used as a negative control (NC). Transfection was performed using Lipofectamine® RNAiMAX (cat. no. 13778-150; Thermo Fisher Scientific, Inc.). Cells were transfected with 10 nM DsiRNA and incubated for 24 h, followed by re-transfection with 10 nM DsiRNA and incubation for an additional 24 h, and were then subjected to assays. KD efficiency was monitored by quantitative PCR (qPCR) as detailed in the next section. In the tumorsphere formation, WST-8 assay, trypan-blue assay, caspase-3/7 fluorometric assay, and apoptosis staining, qPCR of SLC20A1 was performed 48 h after first DsiRNA transfection. In the western blot analysis of proteins associated with p38, JNK, p44/42 and Akt signaling, 48 h after DsiRNA transfection, the subsequent tumorspheres were cultured for 72 h (PANC-1) or 24 h (MIA-PaCa-2), and then qPCR were done.
qPCR
qPCR was conducted as previously described (17,23,40). mRNA expression was examined with THUNDERBIRD probe qPCR Mix (TOYOBO) according to the manufacturer's instructions. The reaction conditions were as follows: 95°C for 1 min, followed by 45 cycles of denaturation at 95°C for 10 sec and extension at 60°C for 1 min. The following probes were used: SLC20A1 probe, 5′-/FAM/TTAGGCAACTGCACTGCACCATTCACGG/TAMRA/-3′; forward primer, 5′-GCGTGGACTTGAAAGAGGAAAC-3′; and reverse primer, 5′-CTGACGGCTTGACTGAACTGG-3′; ALDH1A1 probe, 5′-/6-FAM/TGGAAGAGA/ZEN/ACTGGGAGAGTACGGTT/3IABkFQ/-3′; forward primer, 5′-GTTCTTCTGAGAGATTTTCACTGTG-3′; and reverse primer, 5′-TGGTGGATTCAAGATGTCTGG-3′ and ALDH1A3 probe, 5′-/6-FAM/AGA TAA GCC/ZEN/CGACGTGGACAAGG/3IABkFQ/-3′; forward primer, 5′-CTCTGGAAGGCAACCTGTG-3′; and reverse primer, 5′-GGAGCAAATATGTGAAGTGGAAG-3′. Quantification was performed using the calibration curve method (17,23,40). We used the Eukaryotic 18S rRNA Endogenous Control (4319413E; Thermo Fisher Scientific, Inc.) and normalization was performed based on the internal control. The sequences were not disclosed.
Tumorsphere culture
In vitro tumorsphere formation was carried out as previously described (10,23,40–43). After SLC20A1 KD, unsorted cells and isolated ALDH1high cells were seeded in ultralow attachment 96-well plates (1×103 cells/well) (cat. no. 655970; Greiner Bio-One GmbH) and cultured for 5 days in medium containing 0.6% methylcellulose (cat. no. 22222-62; Nacalai Tesque, Inc., Kyoto, Japan). Images were captured using a microscope (DM5500B; Leica Microsystems, Inc.). The number and size of tumorspheres >314 µm2 were calibrated using ImageJ 1.51j8; Java 1.8.0_112 [64-bit] software (National Institutes of Health, Bethesda, Maryland, USA).
WST-8 assay
The WST-8 assay was performed as previously described (10,40,44,45). After SLC20A1 KD, unsorted and sorted ALDH1high cells were plated into 96-well plates (1×103 cells/well) (cat. no. 167008, Thermo Fisher Scientific, Inc.) and were incubated for 5 days. A color reaction was carried out using Cell Counting Reagent SF (cat. no. 07553-44, Nacalai Tesque, Inc.) and the formed formazan dye was measured using a Sunrise Remote microplate reader (Tecan Group, Ltd.) at 450 nm.
Trypan blue assay
The trypan blue assay was carried out as previously described (40,44). Unsorted and sorted ALDH1high cells were plated into 12-well plates (cat. no. 150628; Thermo Fisher Scientific, Inc.) at a density of 2×104 cells per well in the case of unsorted cells or 1.5×104 cells per well for sorted ALDH1high cells. After 48 h of incubation, cells were stained with 0.4% w/v trypan blue solution (cat. no. 207-17081; Wako, Tokyo, Japan) and trypan blue-positive cells were counted using a hemocytometer (cat. no. 03-202-1; Erma Inc.).
Caspase-3/7 fluorometric assay
The Apo-ONE® Homo-geneous Caspase-3/7 Assay kit (cat. no. G7790; Promega Corporation) was used as previously described (40,44). Unsorted and sorted ALDH1high cells were plated into 96-well black plates (cat. no. 3916; Corning, Inc.) at a density of 1×104 cells per well, and were incubated for 48 h (unsorted cells) or 24 h (sorted ALDH1high cells). Apo-ONE® caspase reagent was then added to the cells, and the mixture was incubated for 30 min at room temperature. Fluorescence was measured using a fluorescence plate reader (excitation, 485 nm; emission, 535 nm) (ARVO; PerkinElmer, Inc.). The background fluorescence was measured as the fluorescence from DMEM alone and was subtracted from all of the experimental values.
Western blotting
PANC-1 and MIA-PaCa-2 cells from two-dimensional monolayer culture or three-dimensional tumorspheres were lysed in RIPA buffer containing a protease inhibitor (cat. no. 03969-21, Nacalai Tesque, Inc.) and a phosphatase inhibitor (cat. no. 07575-51; Nacalai Tesque, Inc.). Western blotting was carried out as previously described (40,44,45). Extracts were then separated by SDS-PAGE on 8% gels and were transferred onto Immobilon-P membranes (cat. no. ISEQ00010; MilliporeSigma). The membranes were then blocked with 5% skim milk or BSA in TBS-Tween 20, incubated with primary antibodies at 4°C for 18 h, and then probed with horseradish peroxidase-conjugated secondary antibodies. Specific signals were detected using the chemiluminescence reagents Immunostar LD (cat. no. 290-69904; Wako) or EzWestLumiOne (cat. no. 2332632; ATTO Corporation, Tokyo, Japan) with ChemiDoc MP (Bio-Rad Laboratories, Inc.). The primary antibodies were as follows: mouse anti-p-p38 monoclonal antibody (mAb) (cat. no. 9216s; Cell Signaling Technology, Inc.; 1:3,000); rabbit anti-p38 polyclonal antibody (pAb) (cat. no. 9212s; Cell Signaling Technology, Inc. Danvers, MA, USA; 1:3,000); rabbit anti-phosphorylated (p)-c-Jun N-terminal Kinase (JNK) pAb (cat. no. 9251s; Cell Signaling Technology, Inc.; 1:3,000); rabbit anti-JNK pAb (cat. no. 9252s; Cell Signaling Technology, Inc.; 1:3,000); rabbit anti-p-p44/p42 pAb (cat. no. 9101s; Cell Signaling Technology, Inc.; 1:3,000); rabbit anti-p44/p42 pAb (cat. no. 9102s; Cell Signaling Technology, Inc.; 1:3,000); rabbit anti-p-Akt S473 mAb (cat. no. 4060s; Cell Signaling Technology, Inc.; 1:3,000); rabbit anti-Akt mAb (cat. no. 2938s; Cell Signaling Technology, Inc.; 1:3,000); rabbit anti-ALDH1A1 mAb (cat. no. ab52492; Abcam; 1:5,000); rabbit anti-ALDH1A3 pAb (cat. no. PA5-29188; Thermo Fisher Scientific, Inc.; 1:5,000); and mouse anti-β-actin mAb (cat. no. 60008-1-Ig; ProteinTech Group, Inc.; 1:10,000). Goat anti-mouse and anti-rabbit IgG (cat. no. 7076S and 7074S, respectively; Cell Signaling Technology, Inc.) were used as secondary antibodies according to the primary antibody used. β-actin as the internal control was reprobed with mouse anti-β-actin mAb after stripping targeted antibody. Stripping was performed using Stripping solution (cat. no. 193-16375, Wako) according to the manufacturer's protocol.
ALDEFLUOR assay
ALDH1high cells were isolated from the PANC-1 and MIA-PaCa-2 cell lines using the ALDEFLUOR™ assay kit (cat. no. ST-01700; Stemcell Technologies, Inc., Vancouver, BC, Canada) according to the manufacturer's protocol as previously described (10,40,44). The cell population with the highest ALDH1 activity (5–10% of total cells) was sorted as ALDH1high cells by the FACS Aria III or FACS Melody cell sorters (BD Biosciences), whereas the cell population with the lowest ALDH1 activity was sorted as ALDH1low cells.
Apoptosis staining
Apoptotic staining of ALDH1high PANC-1 and ALDH1high MIA-PaCa-2 cells was performed using the Cell Meter™ Apoptotic and Necrotic Multiplexing Detection Kit I (cat. no. 22840; AAT Bioquest, Inc.) according to the manufacturer's protocol. Living cells were stained with 0.1% Hoechst 33342 (cat. no. H3570; Invitrogen; Thermo Fisher Scientific, Inc.). Images were then captured using a microscope (DMI6000B-AFC; Leica Corporation) and the number of stained cells was counted with the counting software Katikaticounter (Vector Laboratories, Inc.).
Statistical analysis
For the gene expression analysis, to analyze SLC20A1 expression in normal tissues and primary tumors using the downloaded data from UALCAN, P-values were calculated using an unpaired Student's t-test. P-values for the comparisons of gene expression among stages were calculated using the Kruskal-Wallis test with Steel's post hoc test. Pearson's correlation coefficients (r) were calculated and P-values were calculated using the t-test for testing the population correlation coefficient is zero (null hypothesis). To analyze the association between gene expression of CSC markers such as SLC20A1, ALDH1A1 and ALDH1A3, and gene mutation or copy number alterations of KRAS, CDKN2A, TP53 and SMAD4, P-values were calculated using the Kruskal-Wallis test with Steel's test. Survival curves were plotted by the Kaplan-Meier method for univariate analysis, and P-values were calculated by the Cochran-Mantel-Haenszel generalized log-rank test. Multiplicity was adjusted using the Bonferroni test as a post hoc test. A multivariate Cox regression model with age and sex as a confounding factor was performed to evaluate the effect of gene expression and to estimate the adjusted HRs. Statistical analysis was performed using BellCurve for Excel version 4.04 software (Social Survey Research Information Co., Ltd.). Tumorsphere formation data and the relative number of apoptotic cells are shown as the mean ± standard deviation of three independent experiments, whereas data obtained from the WST-8, trypan blue and caspase-3/7 fluorometric assays are shown as the mean ± standard error (SE) of three independent experiments and were analyzed using an unpaired Student's t-test. To examine the siRNA knockdown efficiency, the statistical significance between NC KD and SLC20A1 KD cells was determined using an unpaired Student's t-test. Two-sided P<0.05 was considered to indicate a statistically significant difference. For the mRNA expression analysis in ALDH1high and ALDH1low MIA-PaCa-2 cells, data are shown as the mean ± SE of three independent experiments and were analyzed using an unpaired Student's t-test.
Results
High SLC20A1 gene expression is associated with driver gene mutation for KRAS, CDKN2A, TP53 and SMAD4 in PDAC
Our group previously reported that SLC20A1 gene expression was higher in breast cancer than in normal breast tissues (23). The present study explored SLC20A1 expression in PDAC. Unlike breast cancer, SLC20A1 gene expression was not statistically significantly different in PDAC tumors compared to normal tissues (Fig. S1A). Next, SLC20A1 expression was compared according to tumor stages. Although SLC20A1 expression was largely unchanged between normal tissues and stage I tumors, the expression of SLC20A1 gradually increased in the order of stage II, III and IV compared with stage I (Fig. S1B). A similar expression pattern of SLC20A1 was obtained from another dataset (Fig. S1C). There was no gene amplification, deletion or fusion, and only 1 patient with PDAC had a mutation in the SLC20A1 locus (0.57%, 1/175). In PDAC progression, a multistep carcinogenesis proceeds from sequential mutations in driver genes for KRAS, CDKN2A, TP53, and SMAD4 in the premalignant state (46). Therefore, we next examined whether these driver gene mutations were associated with SLC20A1 gene expression (Fig. 1). SLC20A1 gene expression in PDAC tumors with KRAS missense mutations, such as G12D, G12V, G12R and G12C, was significantly higher than that in PDAC tumors without KRAS mutations (Fig. 1A). TP53 missense and truncating mutations were also associated with high SLC20A1 expression (Fig. 1C). In addition, SLC20A1 expression in PDAC tumors with deep deletion and deletion of CDKN2A, TP53, or SMAD4 was higher than that with each diploid gene (Fig. 1F-H). KRAS missense mutations are introduced during the early steps of premalignant progression in PDAC. Therefore, these results suggested that high SLC20A1 expression may be obtained during an early step of PDAC progression.
Patients with SLC20A1high at stage I have a poorer prognosis
To examine the association between SLC20A1 gene expression and the prognosis of different tumor stages, as indicated by parameters such as OS, DSS, DFI and PFI, Kaplan-Meier and multivariate Cox regression analyses were performed. Kaplan-Meier analyses of all tumors indicated that patients with SLC20A1high showed poorer prognoses than patients with SLC20A1low (OS: P=0.0080; DSS: P=0.0050; DFI: P=0.011; and PFI: P=0.0023) (Fig. 2A-D). Kaplan-Meier analyses at tumor stage I indicated that patients with SLC20A1high showed poorer prognosis than those with SLC20A1low (DSS: P=0.017; DFI: P<0.001; and PFI: P<0.001) (Fig. 2E-H). At tumor stage II, Kaplan-Meier analyses comparing OS, DSS and DFI did not show significant differences between patients with SLC20A1high or SLC20A1low (Fig. 2I-K). However, patients with SLC20A1high showed poorer prognosis than patients with SLC20A1low regarding PFI (P=0.026) (Fig. 2L). At tumor stages III and IV, there was no significant differences between patients with SLC20A1high or SLC20A1low regarding OS, DSS or PFI (Fig. 2M-O). Notably, DFI data were not available as there were not enough patients for analysis. Multivariate Cox regression analysis of all patients with age at diagnosis and sex as confounding factors also showed that patients with SLC20A1high had poor clinical outcomes [OS: HR=2.20, 95% confidence interval (CI)=1.16–4.15, DSS: HR=2.72, 95% confidence interval (CI)=1.29–5.73; DFI: HR=4.08, 95% CI=1.52–10.98; and PFI: HR=2.33, 95% CI=1.34–4.06] (Table I). At tumor stage II, patients with SLC20A1high showed poor clinical outcome (stage II: HR=1.93, 95% CI=1.07–3.48), but DSS could not be evaluated at stage I, III or IV. In terms of PFI, patients with SLC20A1high at stage II, III and IV had poor prognosis (stage II: HR=1.81, 95% CI=1.10–2.97; stage III and IV: HR=10.10, 95% CI=1.42–71.68) (Table I). These results also suggested that SLC20A1 was involved in cancer progression at an early stage and high expression of SLC20A1 was associated with poor prognosis in PDAC.
 | Table I.Multivariate Cox regression analyses of differences in OS, DSS, DFI and PFI between SLC20A1high and SLC20A1low groups of patients with pancreatic cancer at tumor stages I, II and III/IV. |
SLC20A1 siRNA KD suppresses in vitro tumorsphere formation and cell viability, and increases cell death and caspase-3 activity
To investigate the roles of SLC20A1 in PDAC cells, the present study next examined the effects of in vitro loss of function via siRNA KD on tumor formation, cell viability and cell death using two PDAC cell lines expressing SLC20A1, namely PANC-1 and MIA-PaCa-2.
The results of the in vitro tumorsphere formation assay revealed that SLC20A1 siRNA KD in PANC-1 and MIA-PaCa-2 resulted in the suppression of tumorsphere formation in comparison with NC siRNA KD cells (Fig. 3A and B). In addition, SLC20A1 siRNA KD suppressed the viability of both PDAC cell lines (Fig. 3C and D).
A previous study has shown that SLC20A1 deficiency causes the promotion of caspase-3-dependent apoptosis in HeLa cells stimulated with TNFα (32). Therefore, the current study next examined apoptosis in these PDAC cell lines via trypan blue dye exclusion assay and caspase-3/7 activity analysis. As shown in Fig. 3E-H, SLC20A1 siRNA KD induced an increase in the number of trypan blue-positive cells (Fig. 3E and F) and enhanced caspase-3/7 activity (Fig. 3G and H). When the activity of the MAPK family and its downstream Akt protein was examined, SLC20A1 deficiency was found to result in the enhancement of the phosphorylation levels of p38 kinase and Akt, but not ERK and JNK (Fig. 4A-S). Thus, SLC20A1 may suppress p38 stress kinase-dependent cell death. Moreover, these results suggested that SLC20A1 was required for cell survival and tumorsphere formation via suppressing caspase-3-dependent apoptosis in PDAC cells.
Patients with PDAC SLC20A1high ALDH1A3high have a poor prognosis
SLC20A1 is known to be involved in cell viability and in vitro tumorsphere formation of ALDH1-positive breast CSCs (23); however, the roles of SLC20A1 in PDAC CSCs remain unclear. Therefore, the association between SLC20A1 gene expression and various stem cell markers, including ALDH1A1 and ALDH1A3, was examined. As shown in Fig. S2, SLC20A1 gene expression was positively correlated with stem cell markers, such as KLF4, MET, NOTCH3, HIF1A and CD44, and tended to positively correlate with ALDH1A3, whereas SLC20A1 gene expression was negatively correlated with ALDH1A1.
Next, the association of SLC20A1 and stem cell markers with clinical outcomes was examined by Kaplan-Meier and multivariate Cox regression analyses. It is known that ALDH1A1, ALDH1A3, CD44 and CD133 are pancreatic CSC markers due to their properties of high tumorigenesis and therapy resistance (11–13,47–49). Therefore, the present study next examined the association between SLC20A1 and CSC markers, including the four aforementioned genes. First, patients were divided into four groups according to their expression levels of SLC20A1 and CSC markers: SLC20A1highCSC markerhigh, SLC20A1highCSC markerlow, SLC20A1lowCSC markerhigh and SLC20A1lowCSC markerlow. The prognosis in each group was then compared regarding OS and DSS (Kaplan-Meier analyses: Figs. 5A-D, S3A-H and S4A-K; Cox regression analyses: Tables II and III). In Kaplan-Meier curves, patients with SLC20A1highALDH1A3high (red line) exhibited a significantly poor clinical outcome compared with the other three patient groups, SLC20A1highALDH1A3low, SLC20A1lowALDH1A3high and SLC20A1lowALDH1A3low (Figs. 5B and S3F). On the other hand, patients with SLC20A1highALDH1A1high (Figs. 5A and S3E), SLC20A1highCD44high (Figs. 5C and S3G) and SLC20A1highCD133high (Figs. 5D and S3H) did not show a poorer outcome than others. As determined by Cox regression analyses, some CSC markers, such as ALDH1A3, CD44, HIF1A, KLF4, MET, MYC, STAT3 and NOTCH3, were associated with a significantly worse prognosis in the SLC20A1highCSC markerhigh group compared with the SLC20A1lowCSC markerlow group (Table II). Thus, the current study subsequently focused on ALDH1A3 as the CSC marker that may contribute with SLC20A1 to results in a poorer prognosis in PDAC.
| Table II.Multivariate Cox regression analyses of differences in DSS, DFI and PFI between groups based on SLC20A1 and CSC marker expression. |
| Table III.Cox regression analyses of OS in CSC markerhigh vs. CSC markerlow patients and multivariate Cox regression analyses of differences in OS between groups based on SLC20A1 and CSC marker expression. |
In addition to OS and DSS-associated prognosis, the DFI and PFI of the aforementioned four groups divided according to SLC20A1 and ALDH1A3 were compared. Patients with SLC20A1highALDH1A3high showed a poorer clinical outcome than the other groups in terms of DFI (Fig. 5E) and PFI (Fig. 5F). Next, multivariate Cox regression analysis was conducted with confounding factors such as age at diagnosis and sex, and the adjusted HR value was assessed. In agreement with the results of the Kaplan-Meier analysis, patients with SLC20A1highALDH1A3high had the worst prognosis (Table II). Furthermore, we next examined whether driver genes mutations were associated with ALDH1 genes expression in PDAC. As shown in Fig. S5, PDAC with TP53 truncating mutations showed high ALDH1A3 expression. By contrast, PDAC with TP53 missense and truncating mutations showed low ALDH1A1 expression.
These results suggested that SLC20A1 was involved in cancer progression and contributed to poor clinical outcome in ALDH1A3-positive PDAC.
SLC20A1 siRNA KD in ALDH1high PDAC cells suppresses tumorsphere formation and cell viability, and increases cell death and caspase-3 activity
Based on the poor prognosis of patients with SLC20A1highALDH1A3high, the current study next examined the roles of SLC20A1 in ALDH1-positive pancreatic CSCs. As shown in Fig. S6A, both PANC-1 and MIA-PaCa-2 cell lines expressed the ALDH1A3 protein; however, ALDH1A1 protein expression was lower in PANC-1 cells. ALDH1high cells derived from both PDAC cell lines exhibited CSC properties, such as self-renewal, differentiation and tumorigenesis in serial passages (PANC-1: Fig. S6B and C; MIA-PaCa-2: Fig. S6G and H), similar to our previous study on breast cancer (10). Notably, SLC20A1 mRNA expression was enriched in ALDH1low PDAC cells compared with in ALDH1high PDAC cells (PANC-1: Fig. S6D; MIA-PaCa-2: Fig. S6I). Next, in vitro tumorsphere formation and WST-8 assays were performed. SLC20A1 siRNA KD in ALDH1high cells suppressed the tumorsphere formation and viability of both PDAC cell lines (Fig. 6A-D). These results suggested that SLC20A1 may be required for the tumor formation and cell viability of ALDH1-positive PDAC CSCs.
To investigate the reason why SLC20A1-deficient ALDH1high PDAC cells exhibited suppressed tumorsphere formation and cell viability, trypan blue dye exclusion and caspase-3/7 fluorometric assays were performed. It was revealed that SLC20A1 siRNA KD in ALDH1high cells significantly increased the number of trypan blue-positive cells (Fig. 6E and F). Furthermore, SLC20A1 siRNA KD in ALDH1high cells resulted in the enhancement of caspase-3 activity (Fig. 6G and H) and SLC20A1 siRNA KD in ALDH1high cells caused an increase in cell apoptosis (Fig. 6I and J). These results suggested that SLC20A1 was involved in the survival of ALDH1-positive pancreatic CSCs via the suppression of caspase-3-dependent apoptosis.
Discussion
The present study revealed that patients with SLC20A1high in PDAC had a poorer prognosis than patients with SLC20A1low, particularly at the early tumor stages. Moreover, patients with SLC20A1highALDH1A3high PDAC had the poorest prognosis, and SLC20A1 was observed to be involved in the tumorsphere formation and cell survival of ALDH1-positive PDAC CSCs. Thus, SLC20A1 may be used as a prognostic marker and new therapeutic target of ALDH1-positive pancreatic CSCs.
Several genes, including SLC20A1, have been reported as PDAC prognostic score by the analysis of OS (25,26). The present survival analyses based on DSS, DFI and PFI in PDAC were consistent with previous reports (Fig. 1; Table I) (27,28). Notably, the present results revealed that patients with SLC20A1high showed a poorer prognosis than patients with SLC20A1low at tumor stage I. In PDAC, early recurrence after resection is a serious problem, even though the lesion may be found at resectable states (3–5). In breast cancer, patients with SLC20A1high have also been reported to exhibit a poorer prognosis than patients with SLC20A1low at stage I (22). Furthermore, patients with SLC20A1high luminal A and B breast cancer have a higher risk of recurrence >10 years later after endocrine therapy (22). In PDAC, however, SLC20A1high tumors progress in a short interval of time after medical treatment. Furthermore, high SLC20A1 gene expression may be associated with KRAS missense and truncating mutations, and deep deletion and deletion of CDKN2A, TP53 and SMAD4, which are introduced during the premalignant progression of PDAC. Thus, SLC20A1 could contribute to the aggressive progression of PDAC from an early stage.
SLC20A1 has previously been shown to be involved in cell proliferation in pre-osteoblastic MC3T3-E1 and NIH3T3 cells (33,34). SLC20A1 depletion causes an increase in TNF-dependent p38 MAPK activation, a delay in entry to the G2/M phase in HeLa cells (32,33), and TNF-induced caspase-3-dependent apoptosis via the JNK signaling pathway in HeLa cells (32). The current study also revealed that SLC20A1 depletion caused p38 phosphorylation, caspase-3 activation and increased cell death in PDAC cells. Thus, SLC20A1 may be involved in cell survival via the suppression of caspase-dependent apoptosis. The SLC20A1 protein mediates the uptake of Pi into cells (20,21). Notably, Pi uptake is not affected by SLC20A1-depletion (50) and SLC20A1 overexpression in MC3T3-E1 cells does not affect Pi uptake (34). Furthermore, the introduction of Pi-uptake defective SLC20A1 (S128A) into SLC20A1-deficient cells has been shown to restore cell viability (33). Thus, SLC20A1 may be involved in the regulation of Pi uptake-dependent and -independent cell survival. The detailed mechanism underlying the SLC20A1-dependent regulation of cell survival remains to be elucidated. ALDH1A1 is used as a CSC marker in PDAC (14,15). The present study revealed that ALDH1high cells concentrated ALDH1-positive CSCs in MIA-PaCa-2 and PANC-1 cells. As shown in Fig. S6A, although ALDH1A3 was highly expressed in both MIA-PaCa-2 and PANC-1 cells, ALDH1A1 exhibited less expression in PANC-1 cells. These results suggested that ALDH1A3 may be a major gene of the ALDH1 family contributing to ALDH1 activity in PDAC cells, as well as in breast cancer (44,51). As aforementioned, although SLC20A1 has been reported as a gene of PDAC prognostic score (25,26), ALDH1A3 is not included in the PDAC prognostic score. The present results suggested that ALDH1A3 is also an important factor in predicting the prognosis of PDAC. Notably, ALDH1A3 has been reported to be a prognostic factor for various types of cancers (10,16,17,40,44). Both SLC20A1highALDH1A1high and SLC20A1highALDH1A1low also have poor prognoses. SLC20A1 may function in cells positive for cancer stem cell markers other than ALDH1A3. In fact, as shown in Fig. S2, SLC20A1 gene expression is correlated with the expression of other stem cell-related genes, such as CD44, in addition to ALDH1A3. However, as shown in Figs. 1 and S5, SLC20A1 and ALDH1A3 gene expression levels were associated with TP53 mutation. Other than that, ALDH1A1 gene expression was inversely associated with KRAS missense mutations and TP53 mutation. In addition, as shown in Fig. S2, although the SLC20A1 gene is correlated with the ALDH1A3 gene, SLC20A1 gene is inversely correlated with the ALDH1A1 gene. Thus, the SLC20A1 gene, but not the ALDH1A1 gene, plays an important function in ALDH1A3-positive cells.
SLC20A1 siRNA KD suppressed in vitro tumorsphere formation, cell viability, p38 activation, caspase-3 activity and cell death in ALDH1high PDAC cells. Notably, although SLC20A1 is enriched in ALDH1low cells rather than ALDH1high cells, ALDH1high PDAC cells exhibited tumorsphere forming ability, whereas ALDH1low PDAC cells did not. These results suggested that SLC20A1 was involved in the survival of ALDH1-positive pancreatic CSCs by suppressing caspase-3-dependent apoptosis. SLC20A1 is required for cell proliferation, whereas the phosphate transport activity is independent of cell proliferation (33). Thus, SLC20A1 in ALDH1low cells may contribute to functions other than cell proliferation. Our previous report showed that SLC20A1 also contributes to the in vitro tumorsphere formation and cell viability of ALDH1-positive breast CSCs (23). ALDH1 is known as a CSC marker in multiple cancer types (9–16,18). Therefore, these results suggested that SLC20A1 may be involved in the stemness of ALDH1-positive CSCs, and may act as a prognostic marker and therapeutic target in various types of cancer types. In the present study, we only showed the experimental results for loss-of-function of SLC20A1. Although we examined the effect of transient and stable overexpression of SLC20A1 in response to an expression vector in pancreatic cell lines, the results were inconsistent and precise results could not be obtained. Therefore, the validation of our findings in the experiments for gain-of-function of SLC20A1 will be needed. In the present study, we revealed the role of SLC20A1 in PDAC stem cells via in vitro experiments, and by analyzing a public dataset including data on gene mutations, gene expression, and clinical information. It will be important to validate these results via immunohistochemical analysis of patient samples and analysis of PDAC model mice in the future.
In conclusion, the present study indicated that SLC20A1 is involved in the tumorsphere formation and cell survival of ALDH1-positive pancreatic CSCs, and contributes to cancer progression and poor clinical outcome in PDAC. Therefore, SLC20A1 may be used as a prognostic biomarker and new therapeutic target for ALDH1-positive pancreatic CSCs.
Supplementary Material
Supporting Data
Supporting Data
Acknowledgements
The authors would like to thank Ms. Makoto Fujii (Department of Medicinal and Life Sciences, Faculty of Pharmaceutical Sciences, Tokyo University of Science, Noda, Japan) for cell culturing technical support.
Funding
The present study was supported by Grant-in-Aid for Scientific Research (C) of JSPS (grant no. 20K07207), JST Moonshot R&D (grant no. JPMJPS2022), Tokyo University of Science Grant for President's Research Promotion, Grant-in-Aid for Research Activity Start-up (grant no. 21K20732), Grant-in-Aid for Early-Career Scientists (grant no. 23K14352), JST SPRING (grant no. JPMJSP2151), Grant-in-Aid for Special Research in Subsidies for ordinary expenses of private schools from The Promotion and Mutual Aid Corporation for Private Schools of Japan, Grant from Institute for Environmental & Gender-specific Medicine, Juntendo University, and Nagai Memorial Research Scholarship from the Pharmaceutical Society of Japan.
Availability of data and materials
The data generated in the present study may be requested from the corresponding author.
Authors' contributions
IM, TK, CO and YH performed the experiments. IM, TK, CO, ST and KA confirmed the authenticity of all the raw data. IM, TK, CO, YM, YT, HaM, ST, AO and HiM performed the bioinformatics analysis. IM, TK, CO, ST, AO, HiM, YM, YT, HaM, YX, KeS, KaS and SO contributed to interpretation of data. IM, TK, CO and KA conceived the study. IM, TK, CO, AO, HiM, YM, YT, HaM and KA drafted the manuscript. IM, TK, CO, ST, AO, HiM, YM, YT, HaM, KaS, SO and KA contributed to discussion and review of the manuscript. All authors have read and approved the final version of the manuscript.
Ethics approval and consent to participate
Not applicable.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
|
Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A and Bray F: Global cancer statistics 2020:GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 71:209–249. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Siegel RL, Miller KD, Wagle NS and Jemal A: Cancer statistics, 2023. CA Cancer J Clin. 73:17–48. 2023. View Article : Google Scholar : PubMed/NCBI | |
|
McGuigan A, Kelly P, Turkington RC, Jones C, Coleman HG and McCain RS: Pancreatic cancer: A review of clinical diagnosis, epidemiology, treatment and outcomes. World J Gastroenterol. 24:4846–4861. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Grant TJ, Hua K and Singh A: Molecular pathogenesis of pancreatic cancer. Prog Mol Biol Transl Sci. 144:241–275. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Kern SE, Hruban RH, Hidalgo M and Yeo CJ: An introduction to pancreatic adenocarcinoma genetics, pathology and therapy. Cancer Biol Ther. 1:607–613. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Reya T, Morrison SJ, Clarke MF and Weissman IL: Stem cells, cancer, and cancer stem cells. Nature. 414:105–111. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Visvader JE and Lindeman GJ: Cancer stem cells: Current status and evolving complexities. Cell Stem Cell. 10:717–728. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Diehn M, Cho RW, Lobo NA, Kalisky T, Dorie MJ, Kulp AN, Qian D, Lam JS, Ailles LE, Wong M, et al: Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458:780–783. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Ginestier C, Hur MH, Charafe-Jauffret E, Monville F, Dutcher J, Brown M, Jacquemier J, Viens P, Kleer CG, Liu S, et al: ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1:555–567. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Nozaki Y, Tamori S, Inada M, Katayama R, Nakane H, Minamishima O, Onodera Y, Abe M, Shiina S, Tamura K, et al: Correlation between c-Met and ALDH1 contributes to the survival and tumor-sphere formation of ALDH1 positive breast cancer stem cells and predicts poor clinical outcome in breast cancer. Genes Cancer. 8:628–639. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Kim MP, Fleming JB, Wang H, Abbruzzese JL, Choi W, Kopetz S, McConkey DJ, Evans DB and Gallick GE: ALDH activity selectively defines an enhanced tumor-initiating cell population relative to CD133 expression in human pancreatic adenocarcinoma. PLoS One. 6:e206362011. View Article : Google Scholar : PubMed/NCBI | |
|
Rasheed ZA, Yang J, Wang Q, Kowalski J, Freed I, Murter C, Hong SM, Koorstra JB, Rajeshkumar NV, He X, et al: Prognostic significance of tumorigenic cells with mesenchymal features in pancreatic adenocarcinoma. J Natl Cancer Inst. 102:340–351. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Kim SK, Kim H, Lee DH, Kim TS, Kim T, Chung C, Koh GY, Kim H and Lim DS: Reversing the intractable nature of pancreatic cancer by selectively targeting ALDH-high, therapy-resistant cancer cells. PLoS One. 8:e781302013. View Article : Google Scholar : PubMed/NCBI | |
|
Marcato P, Dean CA, Giacomantonio CA and Lee PWK: Aldehyde dehydrogenase: Its role as a cancer stem cell markaer comes down to the specific isoform. Cell Cycle. 10:1378–1384. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Shingh S, Arcaroli J, Thompson DC, Messersmith W and Vasiliou V: Acetaldehyde and retinaldehyde-metabolizing enzymes in colon and pancreatic cancers. Adv Exp Med Biol. 815:281–294. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
McLean ME, McLean MR, Cahill HF, Arun RP, Walker OL, Wasson MCD, Fernando W, Venkatesh J and Marcato P: The expanding role of cancer stem cell marker ALDH1A3 in cancer and beyond. Cancers (Basel). 15:4922023. View Article : Google Scholar : PubMed/NCBI | |
|
Kasai T, Tamori S, Takasaki Y, Matsuoka I, Ozaki A, Matsuda C, Harada Y, Sasaki K, Ohno S and Akimoto K: High expression of PKCλ and ALDH1A3 indicates a poor prognosis, and PKCλ is required for the asymmetric cell division of ALDH1A3-positive cancer stem cells in PDAC. Biochem Biophys Res Commun. 669:85–94. 2023. View Article : Google Scholar : PubMed/NCBI | |
|
Jia J, Parikh H, Xiao W, Hoskins JW, Pflicke H, Liu X, Collins I, Zhou W, Wang Z, Powell J, et al: An integrated transcriptome and epigenome analysis identifies a novel candidate gene for pancreatic cancer. BMC Medical Genom. 6:332013. View Article : Google Scholar : PubMed/NCBI | |
|
Nie S, Qian X, Shi M, Li H, Peng C, Ding X, Zhang S, Zhang B, Xu G, Lv Y, et al: ALDH1A3 accelerates pancreatic cancer metastasis by promoting glucose metabolism. Flont Oncol. 10:9152020. View Article : Google Scholar | |
|
Johann SV, Gibbons JJ and O'Hara B: GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus. J Virol. 66:1635–1640. 1992. View Article : Google Scholar : PubMed/NCBI | |
|
Kavanaugh MP, Miller DG, Zhang W, Law W, Kozak SL, Kabat D and Miller AD: Cell-surface receptors for gibbon ape leukemia virus and amphotropic murine retrovirus are inducible sodium-dependent phosphate symporters. Proc Natl Acad Sci USA. 91:7071–7075. 1994. View Article : Google Scholar : PubMed/NCBI | |
|
Onaga C, Tamori S, Matsuoka I, Ozaki A, Motomura H, Nagashima Y, Sato T, Sato K, Xiong Y, Sasaki K, et al: High expression of SLC20A1 is less effective for endocrine therapy and predicts late recurrence in ER-positive breast cancer. PLoS One. 17:e02687992022. View Article : Google Scholar : PubMed/NCBI | |
|
Onaga C, Tamori S, Motomura H, Ozaki A, Matsuda C, Matsuoka I, Fujita T, Nozaki Y, Hara Y, Kawano Y, et al: High SLC20A1 expression is associated with poor prognoses in claudin-low and basal-like breast cancers. Anticancer Res. 41:43–54. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Onaga C, Tamori S, Matsuoka I, Ozaki A, Motomura H, Nagashima Y, Sato T, Sato K, Tahata K, Xiong Y, et al: High SLC20A1 expression is associated with poor prognosis for radiotherapy of estrogen receptor-positive breast cancer. Cancer Diagn Progn. 2:429–442. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Haider S, Wang J, Nagano A, Desai A, Arumugam P, Dumartin L, Fitzgibbon J, Hagemann T, Marshall JF, Kocher HM, et al: A multi-gene signature predicts outcome in patients with pancreatic ductal adenocarcinoma. Genome Med. 6:1052014. View Article : Google Scholar : PubMed/NCBI | |
|
Canlı SD, Dedeoğlu E, Akbar MW, Küçükkaraduman B, İşbilen M, Erdoğan ÖŞ, Erciyas SK, Yazıcı H, Vural B and Güre AO: A novel 20-gene prognostic score in pancreatic adenocarcinoma. PLoS One. 15:e02318352020. View Article : Google Scholar : PubMed/NCBI | |
|
Ouyang J, Hu Z, Tong J, Yang Y, Wang J, Chen X, Luo T, Yu S, Wang X and Huang S: Construction and evaluation of a nomogram for predicting survival in patients with lung cancer. Aging (Albany NY). 14:2775–2792. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Okamoto T, Onaga C, Matsuoka I, Ozaki A, Matsuda C, Kasai T, Xiong Y, Harada Y, Sato T, Nakano Y, et al: High SLC20A1 expression indicates poor prognosis in prostate cancer. Cancer Diagn Progn. 3:439–448. 2023. View Article : Google Scholar : PubMed/NCBI | |
|
Sato K and Akimoto K: Expression levels of KMT2C and SLC20A1 identified by information-theoretical analysis are powerful prognostic biomarkers in estrogen receptor-positive breast cancer. Clin Breast Cancer. 17:e135–e142. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Shen T, Wang M and Wang X: Identification of prognosis-related Hub RNA binding proteins function through regulating metabolic processes in tongue cancer. J Cancer. 12:2230–2242. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Dong Z, Wang J, Zhan T and Xu S: Identification of prognostic risk factors for esophageal adenocarcinoma using bioinformatics analysis. Onco Targets Ther. 11:4327–4337. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Salaün C, Leroy C, Rousseau A, Boitez V, Beck L and Friedlander G: Identification of a novel transport-independent function of PiT1/SLC20A1 in the regulation of TNF-induced apoptosis. J Biol Chem. 285:34408–34418. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Beck L, Leroy C, Salaün C, Margall-Ducos G, Desdouets C and Friedlander G: Identification of a novel function of PiT1 critical for cell proliferation and independent of its phosphate transport activity. J Biol Chem. 284:31363–31374. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Byskov K, Jensen N, Kongsfelt IB, Wielsøe M, Pedersen LE, Haldrup C and Pedersen L: Regulation of cell proliferation and cell density by the inorganic phosphate transporter PiT1. Cell Div. 7:72012. View Article : Google Scholar : PubMed/NCBI | |
|
Cancer Genome Atlas Research Network, . Weinstein JN, Collisson EA, Mills GB, Shaw KR, Ozenberger BA, Ellrott K, Shmulevich I, Sander C and Stuart JM: The cancer genome atlas pan-cancer analysis project. Nat Genet. 45:1113–1120. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Hoadley KA, Yau C, Hinoue T, Wolf DM, Lazar AJ, Drill E, Shen R, Taylor AM, Cherniack AD, Thorsson V, et al: Cell-of-origin patterns dominate the molecular classification of 10,000 tumors from 33 types of cancer. Cell. 173:291–304. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, Jacobsen A, Byrne CJ, Heuer ML, Larsson E, et al: The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2:401–404. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, Sun Y, Jacobsen A, Sinha R, Larssson E, et al: Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 6:pl12013. View Article : Google Scholar : PubMed/NCBI | |
|
Chandrashekar DS, Bashel B, Balasubramanya SAH, Creighton CJ, Ponce-Rodriguez I, Chakravarthi BVSK and Varambally S: UALCAN: A portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia. 19:649–658. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Nozaki Y, Motomura H, Tamori S, Kimura Y, Onaga C, Kanai S, Ishihara Y, Ozaki A, Hara Y, Harada Y, et al: High PKCλ expression is required for ALDH1-positive cancer stem cell function and indicates a poor clinical outcome in late-stage breast cancer patients. PLoS One. 15:e02357472020. View Article : Google Scholar : PubMed/NCBI | |
|
Motomura H, Tamori S, Yatani MK, Namiki A, Onaga C, Ozaki A, Takasawa R, Mano Y, Sato T, Hara Y, et al: GLO 1 and PKCλ regulate ALDH1-positive breast cancer stem cell survival. Anticancer Res. 41:5959–5971. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Ozaki A, Motomura H, Tamori S, Onaga C, Nagashima Y, Kotori M, Matsuda C, Matsuda A, Mochizuki N, Sato T, et al: High expression of p62 and ALDH1A3 is associated with poor prognosis in luminal b breast cancer. Anticancer Res. 42:3299–3312. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Xiong Y, Motomura H, Tamori S, Ozaki A, Onaga C, Hara Y, Sato K, Tahata K, Harada Y, Sasaki K, et al: High expression of CD58 and ALDH1A3 predicts a poor prognosis in basal-like breast cancer. Anticancer Res. 42:5223–5232. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Tamori S, Nozaki Y, Motomura H, Nakane H, Katayama R, Onaga C, Kikuchi E, Shimada N, Suzuki Y, Noike M, et al: Glyoxalase 1 gene is highly expressed in basal-like human breast cancers and contributes to survival of ALDH1-positive breast cancer stem cells. Oncotarget. 9:36515–36529. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Motomura H, Ozaki A, Tamori S, Onaga C, Nozaki Y, Waki Y, Takasawa R, Yoshizawa K, Mano Y, Sato T, et al: Glyoxalase 1 and protein kinase Cλ as potential therapeutic targets for late-stage breast cancer. Oncol Lett. 22:5472021. View Article : Google Scholar : PubMed/NCBI | |
|
Connor AA and Gallinger S: Pancreatic cancer evolution and heterogeneity: Integrating omics and clinical data. Nat Rev Cancer. 22:131–142. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Hong SP, Wen J, Bang S, Park S and Song SY: CD44-positive cells are responsible for gemcitabine resistance in pancreatic cancer cells. Int J Cancer. 125:2323–2331. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Hermann PC, Huber SL, Herrler T, Aicher A, Ellwart JW, Guba M, Bruns CJ and Heeschen C: Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell Stem Cell. 1:313–323. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Maeda S, Shinchi H, Kurahara H, Mataki Y, Maemura K, Sato M, Natsugoe S, Aikou T and Takao S: CD133 expression is correlated with lymph node metastasis and vascular endothelial growth factor-C expression in pancreatic cancer. Br J Cancer. 98:1389–1397. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Beck L, Leroy C, Cormier SB, Forand A, Salaün C, Paris N, Bernier A, Ureña-Torres P, Prié D, Ollero M, et al: The phosphate transporter PiT1 (Slc20a1) revealed as a new essential gene for mouse liver development. PLoS One. 5:e91482010. View Article : Google Scholar : PubMed/NCBI | |
|
Marcato P, Dean CA, Liu RZ, Coyle KM, Bydoun M, Wallace M, Clements D, Turner C, Mathenge EG, Gujar SA, et al: Aldehyde dehydrogenase 1A3 influences breast cancer progression via differential retinoic acid signaling. Mol Oncol. 9:17–31. 2015. View Article : Google Scholar : PubMed/NCBI |
