Association of the p53 codon 72 polymorphism with clinicopathological characteristics of colorectal cancer through mRNA analysis

  • Authors:
    • Ligia Petrolini De Oliveira
    • Ignacio López
    • Erika Maria Monteiro Dos Santos
    • Paula Tucci
    • Mónica Marín
    • Fernando Augusto Soares
    • Benedito Mauro Rossi
    • Renata De Almeida Coudry
  • View Affiliations

  • Published online on: December 20, 2013     https://doi.org/10.3892/or.2013.2940
  • Pages: 1396-1406
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

TP53 represents a suitable candidate for a colorectal cancer susceptibility locus. The polymorphism in the p53 72nd codon involves a proline to arginine substitution, leading to changes in gene transcription activity, interaction with other proteins and modulation of apoptosis. Studies evaluating the association between this polymorphism and colorectal cancer (CRC) have shown inconsistent results, and none have evaluated the mRNA status of TP53. The aim of the present study was to evaluate the association between this SNP expression at the mRNA level in CRC samples and patient clinicopathological variables and prognosis, p53 protein expression and TP53 mutation. This is the first report to describe the mRNA expression of p53 codon 72 alleles in CRC. We evaluated 101 non-related patients with CRC treated at the A.C. Camargo Cancer Center in Brazil. RNA was isolated from frozen tumor tissues using a trizol-based protocol. The polymorphism was detected using RT-PCR followed by Sanger sequencing. Associations were analyzed using Pearson's Chi-square or Fisher's exact tests, logistic regression and Cox. This polymorphism was significantly associated with clinicopathological variables related to increased tumor aggressiveness. The expression of Arg72 (OR, 3.83; CI 1.02-14.35; P=0.046) and the TNM stage (OR, 7.15; CI 1.45-35.29; P=0.016) were found to be independent predictors for recurrence. These data suggest that the mRNA expression of the Pro72 allele is associated with less favorable tumor features. The allele frequency of the p53 Pro72 was 0.26. The analysis of mRNA is important to determine the specific contribution of the allele expressed. These results suggest that this polymorphism may play a role in CRC.

Introduction

Colorectal cancer (CRC) is the third most common cancer type in men and women worldwide. CRC is thought to result from an interaction between environmental and genetic factors (1).

Currently, functional variation of DNA repair and cell cycle control-related genes in the presence of carcinogen-mediated cell damage is believed to be a mechanism for explaining inter-individual variation in CRC susceptibility (1).

Analysis of phenotype concordance in monozygotic twin CRC cases suggest that inherited susceptibility underlies 35% of all CRCs. However, only 6% of CRCs occur in the context of a known high-penetrance cancer predisposition syndrome, such as familial adenomatous polyposis or Lynch syndrome (2,3). Therefore, most of the genetic risks for CRC remain unknown (4).

Fearon and Vogelstein (5) proposed a model for the development of CRC whereby colorectal carcinoma arises and progresses through histological stages due to an accumulation of genetic and epigenetic changes. A particular stage of progression of late adenoma to adenocarcinoma involves mutations in TP53. p53 regulates many cellular functions including cell cycle progression, DNA repair, senescence, apoptosis and cellular metabolism (6). In normal cells, the expression level of p53 is extremely low. However, p53 protein levels increase in response to various stress signals, such as DNA damaging agents, oxidative stress, amino acid depletion and temperature change (7).

In addition to the gene mutation, which represent the most common TP53 genetic alteration, multiple single nucleotide polymorphisms (SNPs) have been identified in this gene. However, the relevance of the majority of the SNPs remains unclear. The p53 codon 72 SNP (rs1042522), which is located in exon 4 within the p53 transactivation domain in a proline-rich region, results in the expression of either a proline or an arginine due to a nucleotide substitution of the second base in the codon (CCC>CGC), thus, changing from an amino acid with a non-polar aliphatic side chain to an amino acid with a positively charged basic side chain (1).

Several lines of evidence suggest that the resulting two alleles confer different properties to the p53 protein. These p53 variants are not biochemically equivalent, since they show different transcriptional regulation activities, interactions with p73 (a homologue of p53) and degradation rates mediated by the proteasome (8). The allele with proline (Pro72) is considered the wild-type one (9), and it appears less efficient than the allele with arginine (Arg72) at suppression of cell transformation and induction of apoptosis (10). Structural and functional features of p53 might be useful as a molecular prognostic marker (11).

An association between the genotyped p53 codon 72 SNP and human cancer risk has been reported in breast (12,13), gastric (14,15), thyroid (16,17), lung (18,19), vulval (20) and bladder cancers (21,22). However, this SNP does not appear to affect the risk of cervical (23,24), prostate (25,26) and endometrial cancers (27,28) and head and neck squamous cell carcinomas (29,30).

Previous studies have shown that the p53 codon 72 SNP is associated with the risk of CRC or its precursor lesion adenoma (8,3136), while others have reported discordant results (37,38). The p53 codon 72 SNP was not found to be associated with the alteration of colorectal cancer risk in a meta-analysis with 20 case-control studies (1).

Mammano et al (8) demonstrated that the genotyped p53 codon 72 SNP is associated with a higher risk of CRC and with more advanced and undifferentiated tumors, suggesting that this SNP may play a role in the progression of CRC.

Most epidemiological studies have evaluated the genotypes of polymorphic genes, searching for alterations in cancer risk. However, it is imperative to evaluate which allele is expressed in the tumor as there may be preferential expression of a specific allele in heterozygotes, which may explain the discordance data related to association of p53 codon 72 SNP with CRC. Moreover, evaluation of the association of the expression of this SNP with patient clinicopathological variables and prognosis can provide relevant data not previously identified.

In order to shed light on the role of this SNP in CRC, we conducted a p53 codon 72 SNP expression analysis searching for associations with p53 protein expression, TP53 mutations, patient clinicopathological variables and prognosis.

Materials and methods

Study population

We examined mRNA from 101 patients with sporadic origin colorectal tumors who were treated at the Hospital A.C. Camargo (São Paulo, Brazil) and who underwent surgical resection for colorectal adenocarcinoma between 1992 and 2006. Individuals fulfilling any familial syndrome clinical criteria or with inflammatory bowel diseases and those treated with preoperative chemoradiotherapy were excluded from the present study which was reviewed and approved by a duly appointed ethics committee (1042/08).

Clinicopathological data

All clinical data were collected from patient reports, and pathological data of the CRC cases were systematically evaluated by an experienced gastrointestinal pathologist (R.A.C.). The data collected include gender, age at diagnosis, smoking habit (yes or no), CRC location, histological grade, TNM stage (UICC/AJCC), dirty necrosis, desmoplasia, Crohn’s-like lymphocytes, infiltrating lymphocytes, vascular and lymphatic invasion, budding, tumor border pattern of growth (expanding or infiltrating), tumor recurrence, use of post-chemoradiotherapy (radiotherapy only for rectal tumors) and follow-up time. Tumor budding was defined as an isolated single cancer cell or a cluster composed of fewer than 5 cancer cells observed in the stroma of the actively invasive area (39).

Immunohistochemistry

The expression status of p53 was evaluated using immunohistochemistry (IHC) technique. IHC staining was performed on 3-μm formalin paraffin-embedded (FFPE) tissues. The reactions were performed using a p53 monoclonal antibody (DO7 clone, 1:100 dilution; Dako, Glostrup, Denmark) and a polymer-based detection system (Advance HRP Link Polymer amplification system; Dako). Positive staining was defined as an unequivocal nuclear staining of neoplastic cells. The percentage of positively stained neoplastic cells was quantified. A tumor was considered positive when >20% of its cells were stained.

RNA extraction

Fresh samples were matched with FFPE tissues used for IHC. Total RNA was extracted from manually microdissected frozen tissues with at least 70% of tumor cells (10–100 mg) by homogenizing each tissue sample using Precellys equipment (Bertin Technologies, Villeurbanne, France) in 1 ml of TRIzol reagent according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Foster City, CA, USA), and RNA was stored at −80°C prior to use.

RT-PCR

Total mRNA was employed to synthesize cDNA for TP53 allele expression and mutation analyses using a High Capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). The TP53 transcript was amplified as two overlapping fragments, from exon 2 to 6 and from exon 6 to 11, covering the entire coding region. PCR was performed in 25-μl reactions containing 20 ng of template DNA, 1.5 mM MgCl2, 0.2 mM dNTP, 0.3 μM of forward and reverse primers and 1.5 U of Platinum® Taq Polymerase (Invitrogen). PCR products were analyzed on an agarose gel containing SYBR Safe (Invitrogen). PCR primers are described in Table I.

Table I

Amplification and sequencing primers.

Table I

Amplification and sequencing primers.

UsePrimerSequenceAmplicon (bp)
PCR fragment 1E2ForE RNAm
E6RevE RNAm
GACGGTGACACGCTTCCCTG
CACCACCACACTATGTCG
708
PCR fragment 2E6ForE RNAm
E11RevE RNAm
CCTCAGCATCTTATCCGAG
AGGCTGTCAGTGGGGAAC
645
Sequencing fragment 1E2ForI RNAm
E6RevI RNAm
CAGCCAGACTGCCTTCCGGGTC
CTGTCATCCAAATACTCCACACG
654
Sequencing fragment 2E6ForI RNAm
E11RevI RNAm
GGAAATTTGCGTGTGGAG
CAAGAAGTGGAGAATGTC
604
Sequencing analysis

Samples were screened for mutations over the entire coding region of TP53 and for the presence of polymorphic variants at codon 72. ExoSAP-IT (1 μl, USB; Affymetrix, Cleveland, OH, USA) was used to purify 7 μl of the PCR product. Sequencing reactions were performed using the Big Dye Terminator v3.1 Cycle sequencing kit (Applied Biosystems) with specific primers that overlapped the region amplified (Table I) and an ABI PRISM 3730xl Automatic Genetic analyzer (Applied Biosystems), according to the manufacturer’s recommendations.

The TP53 polymorphic and mutation status was analyzed using CLC Main Workbench software (CLCbio version 4.6) with p53 NM_000546 reference sequence. Allele expression was determined using electropherogram data from the sequencing analysis. Double peaks of C and G nucleotides were considered to indicate heterozygosity.

Statistical analysis

To test the distribution of genotypes and the relationship between the p53 codon 72 SNP and clinical variables, data were analyzed using the 2-sided Pearson’s Chi-square or Fisher’s exact tests in the SPSS v17.0 program (SPSS, Inc., Chicago, IL, USA). A P<0.05 was considered to indicate a statistically significant result.

To identify the variables associated with recurrence, univariate analysis was performed. Variables with P<0.20 were selected for multiple logistic regression model. In this model we considered variables with P<0.05 and present the OR and the 95% CI. To determine the variables associated with survival, univariate analysis was performed using the Kaplan-Meier and log rank test. Variables with P<0.20 were selected for the Cox proportional hazards regression model and the OR and 95% CI are presented. An α error of 5% was considered.

Results

Clinicopathological characteristics

The present study was performed using samples from 101 patients consisting of 49 men and 52 women with a mean age of 62.4 years (median age 63 years; age range 27–88 years). There were 52 (51.5%) tumors with negative and 49 (48.5%) with positive p53-protein nuclear accumulation. The tumor was located in the proximal colon in 36 cases (35.6%), in the distal colon in 42 cases (41.6%) and in the rectum in 23 cases (22.8%). Regarding the histological grade, 9 (8.9%) were well differentiated, 80 (79.2%) were moderately differentiated and 12 (11.9%) were poorly differentiated. Based on TNM staging criteria, 20 (19.8%) tumors were stage I, 34 (33.7%) were stage II, 26 (25.7%) were stage III and 21 (20.8%) were stage IV; 58 (57.4%) tumors were N0, 21 (20.8%) were N1 and 22 (21.8%) were N2; and 80 (79.2%) tumors were M0 and 21 (20.8%) were M1 (Table II).

Table II

Association between p53 codon 72 polymorphism and clinicopathological variables.

Table II

Association between p53 codon 72 polymorphism and clinicopathological variables.

Allele expressionArginine allele expression


VariablesN (%)Arginine (%)Arg/Pro (%)Proline (%)P-valueExpressers (%)No expressers (%)aP-value
CRC cases101 (100)67 (66.4)16 (15.8)18 (17.8)-83 (82.2)18 (17.8)-
Gender
 Males49 (48.5)29 (43.3)7 (43.8)13 (72.2)NS36 (43.4)13 (72.2)0.037
 Females52 (51.5)38 (56.7)9 (56.3)5 (27.8)47 (56.6)5 (27.8)
Age at onset (years)
 <5019 (18.8)10 (14.9)5 (31.3)4 (22.2)NS15 (18.1)4 (22.2)NS
 ≥5082 (81.2)57 (85.1)11 (68.8)14 (77.8)68 (81.9)14 (77.8)
Smoking habit
 No82 (85.4)52 (82.5)13 (86.7)17 (94.4)NS65 (83.3)17 (94.4)NS
 Yes14 (14.6)11 (17.5)2 (13.3)1 (5.6)13 (16.7)1 (5.6)
Tumor location
 Proximal36 (35.6)26 (38.8)5 (31.3)5 (27.8)NS31 (37.3)5 (27.8)NS
 Distal42 (41.6)26 (38.8)9 (56.3)7 (38.9)35 (42.2)7 (38.9)
 Rectum23 (22.8)15 (22.4)2 (12.5)6 (33.3)17 (20.5)6 (33.3)
Histological grade
 Well differentiated9 (8.9)8 (11.9)1 (6.3)0NS9 (10.8)0NS
 Moderately differentiated80 (79.2)52 (77.6)14 (87.5)14 (77.8)66 (79.5)14 (77.8)
 Poorly differentiated12 (11.9)7 (10.4)1 (6.3)4 (22.2)8 (9.6)4 (22.2)
Tumor infiltration (T)
 T1+T224 (23.8)19 (28.4)4 (25)1 (5.6)NS23 (27.7)1 (5.6)NS
 T3+T477 (76.2)48 (71.6)12 (75)17 (94.4)60 (72.3)17 (94.4)
Nodal status (N)
 N058 (57.4)41 (61.2)9 (56.3)8 (44.4)NS50 (60.2)8 (44.4)NS
 N1+N243 (42.6)26 (38.8)7 (43.8)10 (55.6)33 (39.8)10 (55.6)
Metastasis (M)
 M080 (79.2)55 (82.1)12 (75)13 (72.2)NS67 (80.7)13 (72.2)NS
 M121 (20.8)12 (17.9)4 (25)5 (27.8)16 (19.3)5 (27.8)
TNM stage
 I–II54 (53.5)39 (58.2)9 (56.3)6 (33.3)NS48 (57.8)6 (33.3)NS
 III–IV47 (46.5)28 (41.8)7 (43.8)12 (66.7)35 (46.5)12 (66.7)
Dirty necrosis
 Not observed51 (51)36 (54.5)9 (53.6)6 (33.3)NS45 (54.9)6 (33.3)NS
 Present49 (49)30 (45.5)7 (43.8)12 (66.7)37 (45.1)12 (66.7)
Desmoplasia
 Not observed29 (28.7)20 (29.9)5 (31.3)4 (22.2)NS25 (30.1)4 (22.2)NS
 Present72 (71.3)47 (70.1)11 (68.8)14 (77.8)58 (69.9)14 (77.8)
Crohn’s-like lymphocytes
 Not observed100 (99)66 (98.5)16 (100)18 (100)NS82 (98.8)18 (100)NS
 Present1 (1)1 (1.5)001 (1.2)0
Infiltrating lymphocytes
 Not observed3 (3)3 (4.5)00NS3 (3.6)0NS
 Present98 (97)64 (95.5)16 (100)18 (100)80 (96.4)18 (100)
Vascular invasion
 Not observed91 (90.1)62 (92.5)14 (87.5)15 (83.3)NS76 (91.6)15 (83.3)NS
 Present10 (9.9)5 (7.5)2 (12.5)3 (16.7)7 (8.4)3 (16.7)
Lymphatic invasion
 Not observed88 (87.1)57 (85.1)14 (87.5)17 (94.4)NS71 (85.5)17 (94.4)NS
 Present13 (12.9)10 (14.9)2 (12.5)1 (5.6)12 (14.5)1 (5.6)
Budding
 Not observed70 (69.3)48 (71.6)11 (68.8)11 (61.1)NS59 (71.1)11 (61.1)NS
 Present31 (30.7)19 (28.4)5 (31.3)7 (38.9)24 (28.9)7 (38.9)
Tumor border
 Infiltrating69 (68.3)42 (62.7)11 (68.8)16 (88.9)NS53 (63.9)16 (88.9)0.05
 Expanding32 (31.7)25 (37.3)5 (31.3)2 (11.1)30 (36.1)2 (11.1)
Recurrence
 Negative85 (86.7)61 (93.8)12 (80)12 (66.7)0.00873 (91.3)12 (66.7)0.013
 Positive13 (13.3)4 (6.2)3 (20)6 (33.3)7 (8.8)6 (33.3)
Chemoradiotherapy
 No52 (53.1)41 (62.1)8 (53.3)3 (17.6)0.00549 (60.5)3 (17.6)0.002
 Yes46 (46.9)25 (37.9)7 (46.7)14 (82.4)32 (39.5)14 (82.4)
p53 IHC expression
 Negative52 (51.5)31 (46.3)13 (81.3)8 (44.4)0.03445 (54.2)8 (44.4)NS
 Positive49 (48.5)36 (53.7)3 (18.8)10 (55.6)38 (45.8)10 (55.6)
p53 mutation
 Not observed46 (45.5)28 (41.8)13 (81.3)5 (27.8)0.00441 (49.4)5 (27.8)NS
 Positive55 (54.5)39 (58.2)3 (18.8)13 (72.2)42 (50.6)13 (72.2)

a Proline exclusive expressers.

{ label (or @symbol) needed for fn[@id='tfn2-or-31-03-1396'] } NS, not significant. Sample size is presented for each variable when data were not available for all subjects.

Allelic expression associations

All significant associations are shown in Fig. 1. The expression allelic frequencies were 0.26 for Pro72 and 0.74 for Arg72. With regard to allele expression, 66.4% (n=67) of individuals were homozygote for Arg72, 15.8% (n=16) were heterozygote and 17.8% (n=18) were homozygote for Pro72. The analysis also considered the presence of expression of the Arg72 allele: 83 samples (82.2%) expressed Arg72 and 18 (17.8%) did not express it. When Arg72 allele expression was correlated with gender, we found that among the CRC tissues from women, 90.4% expressed Arg72 (at least one allele) and 72.2% of the CRC tissues from men expressed Pro72 exclusively (P=0.037). Of the declared smokers, 64.3% were men.

Correlations between the alleles and the IHC-derived p53 monoclonal antibody staining revealed that the presence of either the Pro72 or Agr72 allele did not affect protein expression. However, the presence of both alleles was associated with normal cellular conditions since 81.3% of the heterozygotes showed the normal absence of expression of the p53 protein (P=0.034).

The association between the SNP and tumor stage revealed that 94.4% of those patients not expressing the Arg72 allele presented tumors with T3 and T4 stages, whereas 95.8% of the tumors in T1 and T2 stages were Arg72 expressers (P=0.064).

Correlations between the polymorphism and the tumor characteristics showed that the pattern border of tumor growth varied with the allele expressed. An infiltrating border of tumor growth was present in 88.9% of those tumors not expressing the Arg72 allele, and among all expanding-border tumors, 93.8% expressed Arg72 (P=0.05).

Another finding from the present study was the relationship between tumor recurrence and this SNP since 93.8% of the Arg72-exclusive expresser tumors did not show tumor recurrence (P=0.008). Similarly, 91.3% of those tumors with Arg72 expression did not show recurrence (P=0.013). The average time for tumor recurrence was 17 months post surgery.

Further analysis showed a statistically significant relationship between the p53 codon 72 SNP and the use of postoperative adjuvant chemoradiotherapy. Of the tumors expressing Pro72 exclusively, 82.4% of individuals underwent some type of post-chemoradiotherapy (P=0.002). Of those who did not receive post-chemoradiotherapy, 78.8% of the tumors expressed Arg72 exclusively (P=0.005).

The present study did not evidence significant difference between this SNP and the relative CRC-free survival rates. In the Cox proportional survival model, the independent variables were TNM stage (TNM I–II and III–IV; OR, 4.38; CI 1.84–10.43; P=0.001) and perineural invasion (OR, 3.21; CI 1.26–8.19; P=0.014) (Table III).

Table III

Multivariate analysis.

Table III

Multivariate analysis.

VariablesORCI 95%P-value
Survival
 TNM stages
  I–II11.84–10.430.001
  III–IV4.38
 Perineural invasion
  Not observed11.26–8.190.014
  Observed3.21
Recurrence
 Arg 72
  Expressers11.02–14.350.046
  No expressers3.83
 TNM stages
  I–II11.45–35.290.016
  III–IV7.15

In the multiple logistic regression model, the variables that were independent predictors for recurrence were the expression of Arg72 allele (OR 3.83; CI 1.02–14.35; P=0.046) and the TNM stage (TNM I–II and III–IV; OR, 7.15; CI 1.45–35.29; P=0.016) (Table III). This model explained 24.5% of the variation of recurrence.

Mutation analysis

We also evaluated the mutation status of the TP53 gene in the CRC samples, published in detail (40). Relative to the alleles expressed, pathogenic mutations were detected in 72.2% (n=13) of the Pro72-exclusive expressers, in 18.8% (n=3) of the heterozygotes and in 58.2% (n=39) of the Arg72-exclusive expressers (P=0.004). Detailed analyses revealed that among the tumors showing no mutations, 89.1% were Arg72 expressers.

Discussion

mRNA analysis

Genome-wide association studies (GWAS) assaying hundreds of thousands of SNPs have successfully identified a large number of genetic variants associated with complex traits, but each of those variant often confers only a modest increase in risk. One consequence of these small effects is that even combined, these discoveries only explain a small proportion of the entire genetic contribution to risk of disease, thus, leading to the ‘missing heritability’ question (41).

Many reasons for the missing heritability have been discussed (42,43). Complex patterns of inheritance (44), epigenetic modifications of the genome, common copy-number variants (CNVs) (45), analysis of gene-environment and gene-gene interactions (epistasis) (46) and the recently proposed ‘synthetic association’ signals created by rare variants in GWAS (47) can contribute to the missing heritability. However, we propose that there may be differences in the expression of different polymorphic alleles in large heterozygote populations that may explain cancer behavior and that the real associations can be missed looking only for genomic alterations.

Studies have shown that variations exist in the relative allelic expression levels of specific genes in heterozygotes that contribute to phenotypic variation between individuals. (4853). Monoallelic expression with random choice between paternal and maternal alleles has also been shown to affect hundreds of autosomal genes and, thus, contribute to individual cell variability (54).

The results presented in the present study highlight a major limitation in comparing our results with other reports since the majority of studies looking for relationships between polymorphisms and CRC examine the genotype of the individuals rather than the allele expressed in tumors. Siddique et al (13) showed that breast tumors from heterozygous Chinese women preferentially expressed the Pro72 allele compared to health ones. Thus, the expression status of the p53 alleles in tumors, rather than the genotype, may be a determining factor to better understand the tumor process.

Pro72 vs. Arg72

The p53 codon 72 SNP occurs in the proline-rich domain of p53, which is necessary for the protein to fully induce apoptosis. The polymorphic forms of the p53 protein result in marked alterations in the protein primary structure (55). Data from Marin et al (10) suggest that the Pro72 allele displays decreased efficiency in binding p73 and consequently inhibits p73-dependent apoptosis in p53 mutants. Dumont et al (56) found that in cell lines containing inducible versions of alleles encoding the Pro72 and Arg72 variants, and in cells with endogenous p53, the Arg72 variant induced much greater levels of apoptosis than the Pro72 variant. The higher induction of apoptosis by the Arg72 allele results from the increased localization of p53 Arg72 to the mitochondria, which is accompanied by the release of cytochrome c into the cytosol (56). Although further studies are required, differences in the mitochondrial localization of the isoforms may also indicate that the p53 codon 72 SNP affects the ability of p53 to regulate mitochondrial respiration and other metabolic factors (7). Oseki et al (57) showed that these two polymorphic variants differed particularly within the N-terminal region and consequently, they differ in post-translational modifications at this portion. The Arg72 variant shows significantly enhanced phosphorylation at Ser-6 and Ser-20 compared with the Pro72 variant.

Allelic expression associations

We investigated whether the expression of the Pro/Arg alleles of p53 in CRC correlates with cancer behavior and progression. In studies evaluating genetic polymorphisms and cancer, typically only the association with cancer risk is investigated. However, the relationship between polymorphisms and clinicopathological characteristics of the tumor must be elucidated to enable understanding of the tumor pathogenesis and the tumor course.

Our data revealed that there was a high number of tumors expressing Arg72 in the CRC cohort although our results also showed that the expression of the Arg72 allele may exert a protective effect in this population. The expression of the Pro72 allele in CRC tissues may confer a poorer prognosis since expression of this allele was associated with tumor recurrence. Individuals who were Arg72 allele expressers presented a low number of cancer recurrences, lower grade tumors, expanding tumor borders in the majority of the cases and less frequent TP53 mutations.

The relationship between gender and the SNP showed an apparent advantage for women as fewer tumors expressed the Pro72 allele in women. A common environmental source of DNA damage is cigarette smoke, which contains many mutagenic compounds. If p53 protects cells from DNA damage caused by exposure to these mutagens, the degree of protection should vary with the strength and nature of the p53 response. Thus, individuals with a weaker p53 response may be less capable of responding appropriately to cigarette smoke, which in turn will affect the ability to promote an apoptotic function (58). Indeed, epidemiological evidence reveals an association between this SNP and cigarette smoking in lung and bladder cancer patients (58,59). Thus, one possible explanation for our finding is that men typically initiate smoking earlier and smoke more frequently than women (60,61). These findings were replicated in the present study (64.3% of smokers were men) although we did not find a statistically significant correlation between smoking, gender and the expression of a specific allele. Furthermore, it is important to note that data of this type of habit are derived from self-reported ‘yes or no’ questionnaires, which may underestimate the true extent of smoking (62).

Several studies have indicated that individual susceptibility factors, including DNA repair capacity, metabolic capacity and variation in genes involved in these processes, may modulate the genotoxicity of xenobiotics (63,64). Hanova et al (65) showed a possible relationship between styrene exposure, DNA damage and the transcript levels of TP53.

Tumor-host interaction at the invasive front of colorectal cancer represents a critical interface where tumor progression and tumor cell dissemination arise. The expanding tumor border, identified as presenting margins reasonably well-circumscribed, is often associated with a well-developed inflammatory infiltrate (66,67). In contrast, the infiltrative tumor border is characterized by widespread dissection of normal tissue structures with a loss in the clear boundary between tumor and host tissues. The infiltrating tumor border configuration promotes progression and dissemination of tumor cells by penetrating the vascular and lymphatic vessels (66,67). Studies have revealed that the infiltrative pattern of growth is an adverse prognostic factor and may predict local recurrence (68), whereas the expanding pattern was related with improved survival (67), which is consistent with our results.

The p53 pathway is critical in mediating the response of commonly used cancer therapies. There is evidence that the TP53 gene has functional SNPs that affect p53 signaling, thus, possibly altering cancer risk and clinical outcome (69). How the functional p53 SNPs interact with known cancer risk factors and therapeutics remains to be answered. The present study provides evidence for the protective effect of Arg72 expression on the requirement for postoperative adjuvant chemoradiotherapy.

Adjuvant therapy for colorectal cancer forms an essential component of an effective treatment strategy. Initially, adjuvant chemotherapy for colorectal cancer was delivered in the post-operative setting following ‘curative’ surgery to destroy any residual or micrometastatic disease. Today, the effects of chemotherapy for colorectal cancer include delaying and possibly preventing recurrences following ‘curative’ surgery, downsizing incurable disease in the pre-operative setting and significantly expanding the median survival in the advanced metastatic setting (70). Despite the large number of factors involved in predicting clinical outcome in patients with colorectal cancer, the histologic stage at surgical diagnosis remains the most important prognostic variable (71). Thus, the selection of appropriate patients to receive adjuvant therapy has been based on their risk of recurrence after surgery only and on disease variables known to adversely affect prognosis, and the selection of systemic agents has been typically based on antitumor activity in patients with advanced disease of similar histology (72).

In particular, 5-fluorouracil (5-FU) is widely used in the treatment of a range of cancers and has demonstrated the largest impact on CRC. TP53 can be activated by 5-FU through more than one mechanism including incorporation of fluorouridine triphosphate into RNA, fluorodeoxyuridine triphosphate into DNA and inhibition of thymidylate synthase with resultant DNA damage (73). TP53 status expectedly appears to have predictive value for the survival of CRC patients receiving 5-FU chemotherapy (74).

One study suggest that cells from individuals that carry the Pro72 allele may undergo less apoptosis in response to DNA damage-inducing therapies when compared with individuals carrying the Arg72 allele. This effect has been suggested to be caused by reduced transcriptional activation of apoptotic effectors (75). In this study, Arg72 expression in presence of chemotherapeutic treatment was shown to induce up to 8-fold more apoptosis than the Pro72 with chemotherapeutics. Studies using p53-inducible isogenic cell lines also noted the greater apoptotic potential of the Arg72 both in the presence (75) and absence (76,77) of chemotherapeutics. Patients, homozygote for the Arg72 allele, with breast or lung cancers have been shown to survive and respond more favorably to chemotherapy and radiotherapy (7880). Further studies of p53 variants could help to define patient populations by their abilities to respond to stress, suppress tumor formation and respond to DNA damaging therapies (69).

In the present study, we showed that 54.5% of individuals harbor a pathogenic TP53 mutation. The total number of mutations found in this population is consistent with the literature. Petitjean et al (81) stated that TP53 appeared to be mutated in ~50% of cases in the majority of human tumors. The simultaneous presence of Arg72 allele in the mutated form of TP53 may serve as a predictor of enhanced tumor development due to inactivation of p73. On the other hand, Arg72 allele over wild-type background may potentially increase apoptotic ability (74). A modifier effect of this SNP has been also reported in germline TP53 mutation carriers, where Arg72 was found to be associated with an earlier age at the initial cancer diagnosis (82).

In most studies, this SNP has been identified by amplifying the exon 4 followed by digestion using the AccII restriction enzyme. However, partial digestion of the Arg72 homozygote leads to the same pattern as that derived from a heterozygote, causing erroneous conclusions. In the present study, analyses were conducted using direct sequencing, considered the gold standard for mutation/SNP detection. The method used here is appropriate for determining the quantity of C or G nucleotides in RNA samples, as described by Siddique et al (13).

Although we have not used more robust techniques for quantifying allelic expression, the mRNA sequencing of a gene allows for the direct verification of which relation exists between the alleles being expressed and tumor characteristics.

The discrepancies between the present study and others are most likely due to differences in population stratification and the methods used to ascertain the polymorphism. Further studies using larger samples and a more detailed analysis of genetic variations within TP53 are required to examine the role of Pro/Arg alleles in carcinogenesis and to determine whether the proposed association is in linkage disequilibrium with other alleles.

In summary, the data presented here demonstrated that there is a strong correlation between expression of the p53 Pro allele and the aggressiveness of CRC. Thus, we propose that the expression status, rather than the conventionally analyzed genomic status, of p53 variants should be used in studies searching for associations between exonic SNPs and cancers.

Allelic variation of gene expression is of particular interest due to its potential contribution to variation in heritable traits. Therefore, understanding the degree of, structure of, and patterns of variations in gene expression is of central importance to determine its role in the pathogenesis of CRC.

Acknowledgements

The present study was supported by the ‘Fundação de Amparo à Pesquisa do Estado de São Paulo’ - FAPESP (grant no. 2008/01241-3). The investigators thank the study participants and the collaborators who contributed to this research.

References

1 

Tang NP, Wu YM, Wang B, et al: Systematic review and meta-analysis of the association between P53 codon 72 polymorphism and colorectal cancer. Eur J Surg Oncol. 36:431–438. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Valentin MD, da Silva FC, dos Santos EM, et al: Characterization of germline mutations of MLH1 and MSH2 in unrelated South American suspected Lynch syndrome individuals. Fam Cancer. 10:641–647. 2011. View Article : Google Scholar : PubMed/NCBI

3 

da Silva FC, de Oliveira LP, Santos EM, et al: Frequency of extracolonic tumors in Brazilian families with Lynch syndrome: analysis of a hereditary colorectal cancer institutional registry. Fam Cancer. 9:563–570. 2010.PubMed/NCBI

4 

Stadler ZK, Vijai J, Thom P, et al: Genome-wide association studies of cancer predisposition. Hematol Oncol Clin North Am. 24:973–996. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Fearon ER and Vogelstein B: A genetic model for colorectal tumorigenesis. Cell. 61:759–767. 1990. View Article : Google Scholar : PubMed/NCBI

6 

Hollstein M and Hainaut P: Massively regulated genes: the example of TP53. J Pathol. 220:164–173. 2010.PubMed/NCBI

7 

Shi H, Tan SJ, Zhong H, et al: Winter temperature and UV are tightly linked to genetic changes in the p53 tumor suppressor pathway in Eastern Asia. Am J Hum Genet. 84:534–541. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Mammano E, Belluco C, Bonafé M, et al: Association of p53 polymorphisms and colorectal cancer: modulation of risk and progression. Eur J Surg Oncol. 35:415–419. 2009. View Article : Google Scholar : PubMed/NCBI

9 

The International HapMap Consortium. The International HapMap Project. Nature. 426:789–796. 2003. View Article : Google Scholar

10 

Marin MC, Jost CA, Brooks LA, et al: A common polymorphism acts as an intragenic modifier of mutant p53 behaviour. Nat Genet. 25:47–54. 2000. View Article : Google Scholar : PubMed/NCBI

11 

Millau JF, Bastien N and Drouin R: P53 transcriptional activities: a general overview and some thoughts. Mutat Res. 681:118–133. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Hu Z, Li X, Yuan R, et al: Three common TP53 polymorphisms in susceptibility to breast cancer, evidence from meta-analysis. Breast Cancer Res Treat. 120:705–714. 2010.

13 

Siddique MM, Balram C, Fiszer-Maliszewska L, et al: Evidence for selective expression of the p53 codon 72 polymorphs: implications in cancer development. Cancer Epidemiol Biomarkers Prev. 14:2245–2252. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Song HR, Kweon SS, Kim HN, et al: p53 codon 72 polymorphism in patients with gastric and colorectal cancer in a Korean population. Gastric Cancer. 14:242–248. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Cañas M, Morán Y, Camargo ME, et al: TP53 codon 72 polymorphism and gastric cancer risk: a case-control study in individuals from the central-western region of Venezuela. Invest Clin. 50:153–161. 2009.(In Spanish).

16 

Rogounovitch TI, Saenko VA, Ashizawa K, et al: TP53 codon 72 polymorphism in radiation-associated human papillary thyroid cancer. Oncol Rep. 15:949–956. 2006.

17 

Granja F, Morari J, Morari EC, et al: Proline homozygosity in codon 72 of p53 is a factor of susceptibility for thyroid cancer. Cancer Lett. 210:151–157. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Piao JM, Kim HN, Song HR, et al: p53 codon 72 polymorphism and the risk of lung cancer in a Korean population. Lung Cancer. 73:264–267. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Dai S, Mao C, Jiang L, et al: P53 polymorphism and lung cancer susceptibility: a pooled analysis of 32 case-control studies. Hum Genet. 125:633–638. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Rosenthal AN, Ryan A, Hopster D, et al: p53 codon 72 polymorphism in vulval cancer and vulval intraepithelial neoplasia. Br J Cancer. 83:1287–1290. 2000. View Article : Google Scholar : PubMed/NCBI

21 

Lin HY, Huang CH, Yu TJ, et al: p53 codon 72 polymorphism as a progression index for bladder cancer. Oncol Rep. 27:1193–1199. 2012.PubMed/NCBI

22 

Li DB, Wei X, Jiang LH, et al: Meta-analysis of epidemiological studies of association of P53 codon 72 polymorphism with bladder cancer. Genet Mol Res. 9:1599–1605. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Sousa H, Santos AM, Pinto D, et al: Is there a biological plausability for p53 codon 72 polymorphism influence on cervical cancer development? Acta Med Port. 24:127–134. 2011.PubMed/NCBI

24 

Klug SJ, Ressing M, Koenig J, et al: TP53 codon 72 polymorphism and cervical cancer: a pooled analysis of individual data from 49 studies. Lancet Oncol. 10:772–784. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Li MS, Liu JL, Wu Y, et al: Meta-analysis demonstrates no association between p53 codon 72 polymorphism and prostate cancer risk. Genet Mol Res. 10:2924–2933. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Zhu Y, Wang J, He Q, et al: Association of p53 codon 72 polymorphism with prostate cancer: a meta-analysis. Mol Biol Rep. 38:1603–1607. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Tang W, He X, Chan Y, et al: Lack of association between p53 codon 72 polymorphism and endometrial cancer: a meta-analysis. Cancer Epidemiol. 36:153–157. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Zubor P, Stanclova A, Kajo K, et al: The p53 codon 72 exon 4 BstUI polymorphism and endometrial cancer in Caucasian women. Oncology. 76:173–183. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Suresh K, Chandirasekar R, Kumar BL, et al: No association between the Trp53 codon 72 polymorphism and head and neck cancer: a case-control study in a South Indian population. Asian Pac J Cancer Prev. 11:1749–1753. 2010.PubMed/NCBI

30 

Mojtahedi Z, Hashemi SB, Khademi B, et al: p53 codon 72 polymorphism association with head and neck squamous cell carcinoma. Braz J Otorhinolaryngol. 76:316–320. 2010.PubMed/NCBI

31 

Själander A, Birgander R, Athlin L, et al: P53 germ line haplotypes associated with increased risk for colorectal cancer. Carcinogenesis. 16:1461–1464. 1995.PubMed/NCBI

32 

Gemignani F, Moreno V, Landi S, et al: A TP53 polymorphism is associated with increased risk of colorectal cancer and with reduced levels of TP53 mRNA. Oncogene. 23:1954–1956. 2004.

33 

Goodman JE, Mechanic LE, Luke BT, et al: Exploring SNP-SNP interactions and colon cancer risk using polymorphism interaction analysis. Int J Cancer. 118:1790–1797. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Pérez LO, Abba MC, Dulout FN, et al: Evaluation of p53 codon 72 polymorphism in adenocarcinomas of the colon and rectum in La Plata, Argentina. World J Gastroenterol. 12:1426–1429. 2006.PubMed/NCBI

35 

Zhu ZZ, Wang AZ, Jia HR, et al: Association of the TP53 codon 72 polymorphism with colorectal cancer in a Chinese population. Jpn J Clin Oncol. 37:385–390. 2007.

36 

Dakouras A, Nikiteas N, Papadakis E, et al: p53Arg72 homozygosity and its increased incidence in left-sided sporadic colorectal adenocarcinomas, in a Greek-Caucasian population. Anticancer Res. 28:1039–1043. 2008.

37 

Koushik A, Tranah GJ, Ma J, et al: p53 Arg72Pro polymorphism and risk of colorectal adenoma and cancer. Int J Cancer. 119:1863–1868. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Tan XL, Nieters A, Hoffmeister M, et al: Genetic polymorphisms in TP53, nonsteroidal anti-inflammatory drugs and the risk of colorectal cancer: evidence for gene-environment interaction? Pharmacogenet Genomics. 17:639–645. 2007. View Article : Google Scholar : PubMed/NCBI

39 

Hase K, Shatney C, Johnson D, et al: Prognostic value of tumor ‘budding’ in patients with colorectal cancer. Dis Colon Rectum. 36:627–635. 1993.

40 

López I, Oliveira PL, Tucci P, et al: Different mutation profiles associated to P53 accumulation in colorectal cancer. Gene. 499:81–87. 2012.PubMed/NCBI

41 

Goldstein DB: The importance of synthetic associations will only be resolved empirically. PLoS Biol. 9:e10010082011. View Article : Google Scholar : PubMed/NCBI

42 

Anderson CA, Soranzo N, Zeggini E, et al: Synthetic associations are unlikely to account for many common disease genome-wide association signals. PLoS Biol. 9:e10005802011. View Article : Google Scholar : PubMed/NCBI

43 

Wray NR, Purcell SM and Visscher PM: Synthetic associations created by rare variants do not explain most GWAS results. PLoS Biol. 9:e10005792011. View Article : Google Scholar : PubMed/NCBI

44 

Orozco G, Barrett JC and Zeggini E: Synthetic associations in the context of genome-wide association scan signals. Hum Mol Genet. 19:137–144. 2010. View Article : Google Scholar : PubMed/NCBI

45 

Shields R: Common disease: are causative alleles common or rare? PLoS Biol. 9:e10010092011. View Article : Google Scholar : PubMed/NCBI

46 

Ritchie MD: Using biological knowledge to uncover the mystery in the search for epistasis in genome-wide association studies. Ann Hum Genet. 75:172–182. 2011. View Article : Google Scholar : PubMed/NCBI

47 

Dickson SP, Wang K, Krantz I, et al: Rare variants create synthetic genome-wide associations. PLoS Biol. 8:e10002942010. View Article : Google Scholar : PubMed/NCBI

48 

Yan H, Yuan W, Velculescu VE, et al: Allelic variation in human gene expression. Science. 297:11432002. View Article : Google Scholar : PubMed/NCBI

49 

Bray NJ, Buckland PR, Owen MJ, et al: Cis-acting variation in the expression of a high proportion of genes in human brain. Hum Genet. 113:149–153. 2003.

50 

Lo HS, Wang Z, Hu Y, et al: Allelic variation in gene expression is common in the human genome. Genome Res. 13:1855–1862. 2003.PubMed/NCBI

51 

Schadt EE, Monks SA, Drake TA, et al: Genetics of gene expression surveyed in maize, mouse and man. Nature. 422:297–302. 2003. View Article : Google Scholar : PubMed/NCBI

52 

Pastinen T, Sladek R, Gurd S, et al: A survey of genetic and epigenetic variation affecting human gene expression. Physiol Genomics. 16:184–193. 2004. View Article : Google Scholar : PubMed/NCBI

53 

Cheung VG, Bruzel A, Burdick JT, et al: Monozygotic twins reveal germline contribution to allelic expression differences. Am J Hum Genet. 82:1357–1360. 2008. View Article : Google Scholar : PubMed/NCBI

54 

Gimelbrant A, Hutchinson JN, Thompson BR, et al: Widespread monoallelic expression on human autosomes. Science. 318:1136–1140. 2007. View Article : Google Scholar : PubMed/NCBI

55 

Thomas M, Kalita A, Labrecque S, et al: Two polymorphic variants of wild-type p53 differ biochemically and biologically. Mol Cell Biol. 19:1092–1100. 1999.PubMed/NCBI

56 

Dumont P, Leu JI, Della Pietra AC III, et al: The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet. 33:357–365. 2003. View Article : Google Scholar : PubMed/NCBI

57 

Ozeki C, Sawai Y, Shibata T, et al: Cancer susceptibility polymorphism of p53 at codon 72 affects phosphorylation and degradation of p53 protein. J Biol Chem. 286:18251–18260. 2011. View Article : Google Scholar : PubMed/NCBI

58 

Hancox RJ, Poulton R, Welch D, et al: Accelerated decline in lung function in cigarette smokers is associated with TP53/MDM2 polymorphisms. Hum Genet. 126:559–565. 2009. View Article : Google Scholar : PubMed/NCBI

59 

Pandith AA, Shah ZA, Khan NP, et al: Role of TP53 Arg72Pro polymorphism in urinary bladder cancer predisposition and predictive impact of proline related genotype in advanced tumors in an ethnic Kashmiri population. Cancer Genet Cytogenet. 203:263–268. 2010.

60 

Tobacco Free Initiative (TFI). WHO report on the global tobacco epidemic, 2011: warning about the dangers of tobacco. World Health Organization; 2011, Available at http://www.who.int/tobacco/global_report/2011/en/.

61 

Marqueta A, Nerín I, Jiménez-Muro A, et al: Predictors of outcome of a smoking cessation treatment by gender. Gac Sanit. 27:23–31. 2012.(In Spanish).

62 

Hiscock R, Bauld L, Amos A, et al: Socioeconomic status and smoking: a review. Ann NY Acad Sci. 1248:107–123. 2012. View Article : Google Scholar : PubMed/NCBI

63 

Norppa H: Cytogenetic biomarkers and genetic polymorphisms. Toxicol Lett. 149:309–334. 2004. View Article : Google Scholar : PubMed/NCBI

64 

Vodicka P, Kumar R, Stetina R, et al: Genetic polymorphisms in DNA repair genes and possible links with DNA repair rates, chromosomal aberrations and single-strand breaks in DNA. Carcinogenesis. 25:757–763. 2004. View Article : Google Scholar : PubMed/NCBI

65 

Hanova M, Vodickova L, Vaclavikova R, et al: DNA damage, DNA repair rates and mRNA expression levels of cell cycle genes (TP53, p21CDKN1A, BCL2 and BAX) with respect to occupational exposure to styrene. Carcinogenesis. 32:74–79. 2011. View Article : Google Scholar : PubMed/NCBI

66 

Jass JR, Love SB and Northover JM: A new prognostic classification of rectal cancer. Lancet. 1:1303–1306. 1987. View Article : Google Scholar : PubMed/NCBI

67 

Zlobec I, Baker K, Minoo P, et al: Tumor border configuration added to TNM staging better stratifies stage II colorectal cancer patients into prognostic subgroups. Cancer. 115:4021–4029. 2009. View Article : Google Scholar : PubMed/NCBI

68 

Zlobec I, Terracciano LM and Lugli A: Local recurrence in mismatch repair-proficient colon cancer predicted by an infiltrative tumor border and lack of CD8+ tumor-infiltrating lymphocytes. Clin Cancer Res. 14:3792–3797. 2008. View Article : Google Scholar : PubMed/NCBI

69 

Grochola LF, Zeron-Medina J, Mériaux S, et al: Single-nucleotide polymorphisms in the p53 signaling pathway. Cold Spring Harb Perspect Biol. 2:a0010322010. View Article : Google Scholar : PubMed/NCBI

70 

Wilkinson NW: Adjuvant chemotherapy for colorectal cancer-new perspectives for effective treatment. US Gastroenterol Hepatol Rev. 1:91–93. 2007.

71 

Casillas S, Pelley RJ and Milsom JW: Adjuvant therapy for colorectal cancer: present and future perspectives. Dis Colon Rectum. 40:977–992. 1997. View Article : Google Scholar : PubMed/NCBI

72 

Fuchs CS and Mayer RJ: Adjuvant chemotherapy for colon and rectal cancer. Semin Radiat Oncol. 3:29–41. 1993. View Article : Google Scholar : PubMed/NCBI

73 

Longley DB, Harkin DP and Johnston PG: 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer. 3:330–338. 2003. View Article : Google Scholar : PubMed/NCBI

74 

Naccarati A, Polakova V, Pardini B, et al: Mutations and polymorphisms in TP53 gene: an overview on the role in colorectal cancer. Mutagenesis. 27:211–218. 2012.

75 

Sullivan A, Syed N, Gasco M, et al: Polymorphism in wild-type p53 modulates response to chemotherapy in vitro and in vivo. Oncogene. 23:3328–3337. 2004. View Article : Google Scholar : PubMed/NCBI

76 

Pim D and Banks L: p53 polymorphic variants at codon 72 exert different effects on cell cycle progression. Int J Cancer. 108:196–199. 2004. View Article : Google Scholar : PubMed/NCBI

77 

Bergamaschi D, Samuels Y, Sullivan A, et al: iASPP preferentially binds p53 proline-rich region and modulates apoptotic function of codon 72-polymorphic p53. Nat Genet. 38:1133–1141. 2006. View Article : Google Scholar : PubMed/NCBI

78 

Nelson HH, Wilkojmen M, Marsit CJ, et al: TP53 mutation, allelism and survival in non-small cell lung cancer. Carcinogenesis. 26:1770–1773. 2005. View Article : Google Scholar : PubMed/NCBI

79 

Tommiska J, Eerola H, Heinonen M, et al: Breast cancer patients with p53 Pro72 homozygous genotype have a poorer survival. Clin Cancer Res. 11:5098–5103. 2005. View Article : Google Scholar : PubMed/NCBI

80 

Xu Y, Yao L, Ouyang T, et al: p53 codon 72 polymorphism predicts the pathologic response to neoadjuvant chemotherapy in patients with breast cancer. Clin Cancer Res. 11:7328–7333. 2005. View Article : Google Scholar : PubMed/NCBI

81 

Petitjean A, Mathe E, Kato S, et al: Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons from recent developments in the IARC TP53 database. Hum Mutat. 28:622–629. 2007.PubMed/NCBI

82 

Bougeard G, Baert-Desurmont S, Tournier I, et al: Impact of the MDM2 SNP309 and p53 Arg72Pro polymorphism on age of tumour onset in Li-Fraumeni syndrome. J Med Genet. 43:531–533. 2006.

Related Articles

Journal Cover

2014-March
Volume 31 Issue 3

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
De Oliveira LP, López I, Dos Santos EM, Tucci P, Marín M, Soares FA, Rossi BM and Coudry RD: Association of the p53 codon 72 polymorphism with clinicopathological characteristics of colorectal cancer through mRNA analysis. Oncol Rep 31: 1396-1406, 2014.
APA
De Oliveira, L.P., López, I., Dos Santos, E.M., Tucci, P., Marín, M., Soares, F.A. ... Coudry, R.D. (2014). Association of the p53 codon 72 polymorphism with clinicopathological characteristics of colorectal cancer through mRNA analysis. Oncology Reports, 31, 1396-1406. https://doi.org/10.3892/or.2013.2940
MLA
De Oliveira, L. P., López, I., Dos Santos, E. M., Tucci, P., Marín, M., Soares, F. A., Rossi, B. M., Coudry, R. D."Association of the p53 codon 72 polymorphism with clinicopathological characteristics of colorectal cancer through mRNA analysis". Oncology Reports 31.3 (2014): 1396-1406.
Chicago
De Oliveira, L. P., López, I., Dos Santos, E. M., Tucci, P., Marín, M., Soares, F. A., Rossi, B. M., Coudry, R. D."Association of the p53 codon 72 polymorphism with clinicopathological characteristics of colorectal cancer through mRNA analysis". Oncology Reports 31, no. 3 (2014): 1396-1406. https://doi.org/10.3892/or.2013.2940