Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
December-2014 Volume 32 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2014 Volume 32 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells

  • Authors:
    • Xiang Li
    • Shu-Juan Zhao
    • Hai-Lian Shi
    • Shui-Ping Qiu
    • Jian-Qun Xie
    • Hui Wu
    • Bei-Bei Zhang
    • Zheng-Tao Wang
    • Jian-Ye Yuan
    • Xiao-Jun Wu
  • View Affiliations / Copyright

    Affiliations: Shanghai Key Laboratory of Complex Prescription, Institute of Chinese Materia Medica, The Ministry of Education (MOE) Key Laboratory for Standardization of Chinese Medicines, Shanghai University of Traditional Chinese Medicine, Zhangjiang Hi-tech Park, Shanghai 201203, P.R. China, Institute of Digestive Disease, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, XuHui, Shanghai 200032, P.R. China
  • Pages: 2777-2788
    |
    Published online on: September 30, 2014
       https://doi.org/10.3892/or.2014.3520
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Breast cancer, the leading cause of cancer-related mortality worldwide in females, has high metastastic and recurrence rates. The aim of the present study was to evaluate the anti-metastatic and anticancer in situ effect of berberine hydrochloride (BER) in MDA-MB-231 cells. BER dose-dependently inhibited proliferation and the IL-8 secretion of MDA-MB-231 cells. Additional experiments revealed that the inactivation of PI3K, JAK2, NF-κB and AP-1 by BER contributed to the decreased IL-8 secretion. BER abrogated cell invasion induced by IL-8 accompanied with the downregulation of the gene expression of MMP-2, EGF, E-cadherin, bFGF and fibronectin. In addition, BER reduced cell motility but induced G2/M arrest and cell apoptosis in an IL-8‑independent manner. BER modulated multiple signaling pathway molecules involved in the regulation of cell apoptosis, including activation of p38 MAPK and JNK and deactivation of JAK2, p85 PI3K, Akt and NF-κB. The enhanced cell apoptosis induced by BER was eliminated by inhibitors of p38 MAPK and JNK but was strengthened by activator of p38 MAPK. Thus, BER inhibited cell metastasis partly through the IL-8 mediated pathway while it induced G2/M arrest and promoted cell apoptosis through the IL-8 independent pathway. Apoptosis induced by BER was mediated by crosstalks of various pathways including activation of p38 MAPK and JNK pathways and inactivation of Jak2/PI3K/NF-κB/AP-1 pathways. The results suggested that BER may be an efficient and safe drug candidate for treating highly metastatic breast cancer.

Introduction

Breast cancer, the leading cause of cancer-related mortality worldwide in females, has high metastastic and recurrence rates following curative resection. Metastasis after resection, is the leading cause of mortality in patients with breast cancer (1,2). Interleukin-8 (IL-8), a cytokine of the CXC chemokine family (3), is highly expressed in many tumor tissues (4) and promotes tumor progression and cancer metastasis (5–10). Findings of recent studies have shown that the overexpression of IL-8 is associated with recurrence and poor prognosis in breast cancer (11–14). The expression of IL-8 in highly metastatic breast cancer MDA-MB-231 cells is much higher than that in the non-metastatic MCF-7 breast cancer cell line (15,16). Recent studies have demonstrated that, during or after treatment, several chemotherapeutic drugs resulted in resistance and cancer metastasis associated with upregulated IL-8 in human breast cancer (17–20). Thus, suppression of IL-8 may be beneficial for breast cancer treatment.

Chemotherapeutic agents, such as 5-fluorouracil, adriamycin, dacarbazine and paclitaxel can induce IL-8 upregulation (5,21–25). Coptis chinensis Franch (Huanglian), a medicinal herb, induces cell growth arrest and apoptosis in human breast cancer cells (26). Berberine, an active isoquino-line alkaloid in C. chinensis, shows anti-metastatic activity in breast cancer cells including MDA-MB-231 and MCF-7 cells (27). In the clinic, berberine hydrochloride (BER) with better water solubility than berberine, is used to treat gastrointestinal inflammation, bacterial diarrhea or infection as well as some gastrointestinal cancers (10,28,29). In our previous studies, BER inhibited the proliferation and IL-8 expression of AGS cells and counteracted enhanced IL-8 induced by evodiamine in AGS cells (10,30). However, the effect of berberine and BER on IL-8 expression and the relationship of IL-8 with migration and cell proliferation in MDA-MB-231 cells remains to be determined.

Induction of apoptosis of cancer cells, mainly through the mitochondrial- and death receptor-dependent pathways, is the principal strategy for chemotherapy. In addition, several other pathways involved in cell apoptosis are influenced by chemotherapeutic drugs (31–33). Berberine has been demonstrated to induce apoptosis of cancer cells including SW60 and HepG2 cells by interfering with the expression of molecules in pathways including Bcl-2, Bax and caspase-3 (34–36). However, whether these pathways play a role in BER-induced apoptosis in breast cancer cells remains to be clarified.

In the present study, the effects of BER on IL-8 expression, and the migration, invasion and cell proliferation of MDA-MB-231 cells were investigated. Furthermore, the possible molecular mechanisms involved in the anti-metastatic and pro-apoptotic effect of BER were discussed. The results suggested that BER may be an efficient and safe drug candidate for treating highly metastatic breast cancer.

Materials and methods

Materials and chemicals

Berberine hydrochloride (BER, purity: 98%, no. 8892010) was purchased from Shanghai Tauto Biotech Co., Ltd. (Shanghai, China). Dulbecco’s modified Eagle’s medium (DMEM)/high-glucose medium was obtained from Cellgro (Manassas, VA, USA). Trypsin (no. 1310929) and FBS (no. 1301838) were provided by Gibco (Grand Island, NY, USA). Propidium iodine (PI) (no. 118 K3583) and dimethyl sulfoxide (DMSO) (no. RNBC 3642) were supplied by Sigma Chemical Co. (St. Louis, MO, USA). The primers for qPCR, TRIzol (no. 66205) and Annexin V-FITC (no. 1081948) were from Invitrogen (Carlsbad, CA, USA). Cell Counting Kit-8 (no. ET758) was provided by Dojindo Laboratories (Kumamoto, Japan). SYBR Premix Ex Taq (no. AK2902) and PrimeScript RT reagent kit (no. AK2001) were from Takara (Dalian, China). IL-8 ELISA kit (no. E15164-105) was obtained from eBioscience (San Diego, CA, USA). Human IL-8 (no. 120219) was purchased from PeproTech (Rocky Hill, NJ, USA). The ECL Prime kit (no. 4618945) was purchased from GE Healthcare (Buckinghamshire, UK). Anti-GAPDH (no. 8), anti-p38 MAPK (no. 4), anti-ERK(1/2) (no. 14), anti-JNK (no. 9), anti-p85 PI3K (no. 4), anti-p65 NF-κB (no. 1), anti-Jak2 (no. 8), anti-p-p38 MAPK (no. 10), anti-p-ERK(1/2) (no. 14), anti-p-JNK (no. 9), anti-p-p85 PI3K (no. 2), anti-p-p65 NF-κB (no. 6), anti-p-Jak2 (no. 10), anti-p-Akt (T308, no. 17), and anti-p-Akt (S473, no. 13) antibodies were supplied by Cell Signaling Technology (Danvers, MA, USA). Anti-Akt (no. YE121003), and anti-cleaved caspase-3 (no. YJ010604C) antibodies were supplied by Epitomics (Burlingame, CA, USA). JAK inhibitor I (Jak inhibitor, no. D3010), LY294002 (PI3K inhibitor), and SB203580 (p38 MAPK inhibitor, no. C3110) were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Curcumin (AP-1 inhibitor) was obtained from ICN Biomedicals Inc. (Costa Mesa, CA, USA). BAY-11-7082 (NF-κB inhibitor, no. 01), SP600125 (JNK inhibitor, no. 01), PD98059 (ERK1/2 inhibitor, no. 03) were obtained from Selleck Chemicals (Houston, TX, USA). Anisomycin (activitors of p38 MAPK and JNK, no. D00140631) was from Calbiochem (San Diego, CA, USA).

Proliferation assay

MDA-MB-231 cells were cultured in DMEM with 10% fetal bovine serum (FBS). The cells were seeded in 200 μl of medium at 1.0×104 cells/ml in 96-well culture plates and grown overnight. Following treatment with BER for 24 or 48 h, respectively, the culture medium was collected for ELISA assay of IL-8. An equal volume of fresh medium was then added back to each well with an additional 20 μl of CCK-8 solution and incubated at 37°C for another 1 h. Absorbance of the dissolved solutions was detected at 450 nm by a Thermo Scientific Varioskan Flash microplate reader (Thermo Fisher Scientific). The cell viability rate was calculated as: (absorbance of drug-treated sample/absorbance of control sample) × 100.

Enzyme-linked immunosorbent assay (ELISA)

Cells were seeded in 96-well, 6-well or 35-mm plates and cultured overnight. Following treatment with BER for 24 or 48 h, the culture medium was collected, centrifuged at 3000 rpm for 5 min and subjected to IL-8 assay using an ELISA kit according to the manufacturer’s instructions. The absorbance at 450 nm was measured with a microplate reader, and the concentration of IL-8 in medium was determined by the standard curve.

Wound-healing assay

MDA-MB-231 cells were seeded in 24-well plates. After the cells reached 90–95% confluence, a scratch was drawn on the cell monolayer with a sterile 100 μl pipette tip. The detached cells were removed by washing with PBS. Treatments of BER (30, 60 and 90 μM) and IL-8 (100 ng/ml) prepared in medium were added onto the cells and the images were captured immediately under an Olympus CKX41 microscope (Olympus, Tokyo, Japan) and denoted as time T0. Following incubation for 24 and 48 h, the cells were photographed again and denoted as time T24 and T48.

Invasion assay

The invasion ability of breast cancer cells was evaluated according to the methods described by Kuo et al (27). Briefly, 200 μl of MDA-MB-231 cells (1×106 cells in serum-free medium) were seeded onto the upper part of the 24-well Transwell chambers coated with Matrigel (BD Biosciences, San Jose, CA, USA). FBS (10%) was used as the chemoattractant in the bottom chambers. After incubation with IL-8 (100 ng/ml), BER (90 μM) or their combination at 37°C for 24 h, the non-invaded cells were removed from the top of the Transwell membrane with a cotton swab. The invaded cells were fixed with 4% PFA for 10 min, followed by incubation with 2% crystal violet staining solution for 15 min, and were observed under an Olympus CKX41 microscope.

Quantitative polymerase chain reaction (qPCR)

Total RNA was extracted from the MDA-MB-231 cells using TRIzol reagent according to the manufacturer’s instructions. Reverse transcription was conducted with a PrimeScript RT reagent kit. Sense and antisense primers used for qPCR were shown in Table I. qPCR was performed with SYBR Premix Ex Taq by using following amplification conditions: 95°C for 30 sec; followed by 40 cycles (95°C for 5 sec; 60°C for 34 sec); and 95°C for 15 sec; 60°C for 1 min; and 95°C for 15 sec. The relative expression level of individual genes was normalized to that of GAPDH in the same sample.

Table I

Primer sequences used in qPCR.

Table I

Primer sequences used in qPCR.

GenesForward primerReverse primer
GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA
E-cadherin CGAGAGCTACACGTTCACGG GGGTGTCGAGGGAAAAATAGG
Fibronectin TGAGCTGCACATGTCTTG TCCTACGTGGTATGTCTTCC
bFGF GGCGTGTACATGTGGTCTCAGA TTATGGCTCACTGCAACCTTGA
EGF GACTTGGGAGCCTGAGCAGAA CATGCACAAGTGTGACTGGAGGT
MMP-2 TGGCAAGTACGGCTTCTGTC TTCTTGTCGCGGTCGTAGTC
Jak 2 TCTGGGGAGTATGTTGCAGAA AGACATGGTTGGGTGGATACC
Akt1 CCTCCACGACATCGCACTG TCACAAAGAGCCCTCCATTATCA
Cell cycle distribution analysis

Cells were seeded in 6-well plates at 6×104 cells/well in 3 ml medium and cultured overnight. After serum starvation for 24 h, the cells were incubated with BER (30, 60 and 90 μM), IL-8 (100 ng/ml) or a combination of IL-8 and BER (90 μM) for 24 h. The cells were harvested by trypsinization, washed twice with phosphate-buffered saline (PBS), and fixed with cold 70% ethanol overnight followed by staining with PI solution containing 50 μg/ml RNase A and 0.1% Triton X-100. The distribution of the cell cycle was examined using a Millipore Guava flow cytometer (Millipore, Billerica, MA, USA).

Cell apoptosis detection

Cells were seeded in 6-well plates at 7.5×104 cells/well in 3-ml medium and allowed to adhere to plates overnight. After serum starvation for 24 h, the cells were incubated with a range of concentrations of BER (30, 60 and 90 μM) with 10% FBS for another 24 h. In experiments for clarifying cell signaling pathways involved in BER-induced apoptosis, the cells were treated with BER at 90 μM for 24 h after pre-incubation of SB203580 (25 μM), LY294002 (10 μM), SP600125 (20 μM), PD98059 (20 μM), BAY-11-7082 (5 μM), JAK inhibitor I (5 μM), curcumin (8 μM) and anisomycin (10 μg/ml) for 1 h. The cells were subsequently harvested by careful trypsinization, and washed twice with 1X Annexin V binding buffer. After resuspension in 1X Annexin V binding buffer, the cells were stained with Annexin V and PI. Fluorescence of the cells was examined on a Guava flow cytometer.

Western blotting

After incubation with BER, the cells were lysed with lysis buffer and sonicated three times each for 15 sec. The cell lysate was centrifuged at 14,000 × g for 15 min at 4°C, and the supernatant was collected. Protein samples were separated by SDS-PAGE (12 or 15%) and transferred onto PVDF membrane by wet transfer. PVDF membranes were blocked with 5% non-fat milk solution and incubated with different primary antibodies overnight at 4°C. After being washed with 1X TBST, PVDF membranes were incubated with respective secondary antibodies. The protein bands were visualized with ECL Prime kit.

Statistical analysis

Each value was presented as means ± SEM. Differences between two groups were analyzed using Student’s t-test. Pairwise comparisons among groups were conducted by one-way ANOVA with Dunnett’s analysis using PrismDemo 4. P<0.05 was considered statistically significant.

Results

BER inhibits proliferation and IL-8 secretion of MDA-MB-231 cells

To examine the efficacy of BER on cell growth of breast cancer, MDA-MB-231 cells were treated with a range of concentrations of BER for 24 and 48 h, respectively. As shown in Fig. 1B, BER dose-dependently inhibited the proliferation of MDA-MB-231 cells at 24 or 48 h. When used at concentrations of >90 μM for 24 h, BER suppressed the growth of cells, and the growth inhibitory rate of was >44.18%. By contrast, when treated for 48 h, at lower concentrations, such as 60 μM, BER prevented 38.94% of cells from proliferation. Accordingly, the IC50 of BER was 78.21 μM for 24-h treatment, while that for 48 h was 71.87 μM.

Figure 1

BER inhibits cell proliferation and IL-8 secretion of MDA-MB-231 cells. (A) Chemical structure of BER. (B) MDA-MB-231 cells were treated with 0.1% DMSO or BER (30–300 μM) for 24 and 48 h, then measured by CCK-8 assay to determine the cell viability. (C) IL-8 secretion was detected by ELISA following BER treatment (1–150 μM) for 24 and 48 h, respectively. (D) MDA-MB-231 cells were pre-incubated with or without inhibitors of cell signaling pathways (BAY-11-7082, 5 μM; SB203580, 25 μM; LY294002, 10 μM; JAK I, 5 μM; Curcumin, 8 μM; PD98059, 20 μM; and SP600125, 20 μM) for 1 h, followed by B90 treatment for 24 h. IL-8 level in culture serum was measured by ELISA. Data are presented as means ± SEM; **P<0.01, ***P<0.001 vs. control. ###P<0.001 vs. B90. B, berberine hydrochloride.

Further analysis demonstrated that BER significantly decreased the IL-8 secretion of MDA-MB-231 cells in a dose-dependent manner (Fig. 1C). To determine cellular signaling molecules involved in the modulation of IL-8 secretion of MDA-MB-231 cells, multiple pathway inhibitors were used, including LY294002 (10 μM), SB203580 (25 μM), SP600125 (20 μM), PD98059 (20 μM), BAY-11-7082 (5 μM), JAK inhibitor I (5 μM) and curcumin (8 μM). As shown in Fig. 1D, these inhibitors were able to decrease the IL-8 secretion of MDA-MB-231 cells compared with the control group. Furthermore, pre-incubation with the above mentioned inhibitors, with the exception of the AP-1 inhibitor, increased the inhibitory effect of BER (90 μM) on IL-8 expression in MDA-MB-231 cells.

BER decreases cell invasion and migration of MDA-MB-231 cells

In order to clarify the relationship between BER and cell metastasis, invasion and wound-healing assays were carried out. As shown in Fig. 2A, IL-8 increased the invasion of MDA-MB-231 cells as more cells stained by crystal violet were found on the bottom chambers of the Transwell membranes when compared with those in the control groups. BER (90 μM) inhibited the invasion of MDA-MB-231 cells, and could abolish the increased cell invasion induced by IL-8.

Figure 2

BER inhibits cell invasion and migration in MDA-MB-231 cells. (A) IL-8 increased the cell invasion of MDA-MB-231 cells, and BER inhibited cell invasion and counteracted the increased cell invasion induced by IL-8, which was assessed by crystal violet staining. (B) BER inhibited the cell motility of MDA-MB-231 cells in a dose-dependent manner, as assessed by the wound-healing assay. (C) IL-8 (100 ng/ml) did not affect the cell motility of MDA-MB-231 cells, as assessed by the wound-healing assay. B, berberine hydrochloride.

In the wound-healing assays (Fig. 2B), BER (30, 60 and 90 μM) appeared to dose-dependently prevent the motility of MDA-MB-231 cells after treatment for 24 and 48 h. However, IL-8 (100 ng/ml) treatment did not affect cell motility (Fig. 2C) at 24 or 48 h and showed no interaction with BER treatment.

BER inhibits gene expression of metastasis-related molecules in MDA-MB-231 cells

To confirm the anti-metastatic effect of BER, the mRNA expression of MMP-2, EGF, E-cadherin, bFGF and fibronectin was quantified by qPCR. BER at 90 μM decreased the mRNA expression of the measured molecules significantly (P<0.05 or P<0.001) (Fig. 3). By contrast, when used <90 μM, BER only reduced the mRNA expression of MMP-2, EGF and fibronectin.

Figure 3

BER inhibits gene expression of metastasis-related proteins for 24 h. Gene expression of MMP-2, EGF, E-cadherin, bFGF and fibronectin were all significantly downregulated by BER. Data are presented as means ± SEM, *P<0.05, ***P<0.001 vs. control. B, berberine hydrochloride.

BER induces G2/M phase arrest and apoptosis in MDA-MB-231 cells

BER induced the G2/M arrest of MDA-MB-231 cells in a dose-dependent manner (Fig. 4). IL-8 (100 ng/ml) had no effect on cell cycle distribution. When combined with IL-8, BER (90 μM) induced G2/M arrest significantly, although no difference with that induced by BER alone was observed.

Figure 4

BER induces G2/M phase arrest in an IL-8 independent manner in MDA-MB-231 cells. (A) Typical images from flow cytometry with PI staining showed G2/M arrest. (B) BER induced G2/M arrest after treatment for 24 h detected by flow cytometry with PI staining. (C) BER induced G2/M phase arrest in an IL-8-independent manner. Data are presented as means ± SEM; *P<0.05, **P<0.01 vs. control. B, berberine hydrochloride.

BER appeared to dose-dependently induce the apoptosis of MDA-MB-231 cells as the ratio of early apoptotic cells increased with the elevation of BER concentrations (Fig. 5I). By contrast, as shown in Fig. 5II, IL-8 did not markedly affect cell apoptosis. To our surprise, it also did not influence cell apoptosis induced by BER (90 μM).

Figure 5

BER promotes cell apoptosis in MDA-MB-231 cells in an IL-8 independent manner. (I) BER promoted cell apoptosis in MDA-MB-231 cells through caspase-3 and the mitochondrial-dependent pathway measured by Annexin V/PI double staining. (II) IL-8 was not involved in enhancing cell apoptosis induced by berberine hydrochloride measured by Annexin V/PI double staining. Data are presented as means ± SEM; **P<0.01, ***P<0.001 vs. control. B, berberine hydrochloride.

Consistent with the results from flow cytometry, BER modulated the expression of apoptotic proteins. BER dose-dependently increased the amount of cleaved caspase-3 (Fig. 5I). By contrast, it also downregulated the protein expression of Bcl-2 in a dose-dependent manner but showed no effect on the expression of Bax.

Cellular signaling pathways are involved in BER-induced apoptosis in MDA-MB-231 cells

To determine the effect of BER on the protein expression of the cellular signaling molecules, MDA-MB-231 cells were treated with BER (30, 60 and 90 μM) for 24 h and then subjected to western blot analysis. Fig. 6A shows that BER dose-dependently increased the phosphorylation of p38 and SAPK/JNK MAPKs but did not affect that of ERK. By contrast, BER treatment decreased the phosphorylation of Jak2, p85 PI3K, Akt and p65 NF-κB in a dose-dependent manner (Fig. 6B). Additionally, BER inhibited the mRNA expression of Jak2 and Akt1 (Fig. 6C and D).

Figure 6

BER activates the p38 MAPK and JNK pathways, and inactivates the Jak2, p85 PI3K, Akt and p65 NF-κB pathways. (A) Western blotting results show that BER enhanced the phosphorylation of p38 MAPK and JNK. (B) Results from western blotting show that BER inhibited the phosphorylation of Jak2, p85 PI3K, Akt and p65 NF-κB. (C and D) qPCR results showed that the gene expression of Jak2 and Akt1 was significantly downregulated by BER. Data are presented as means ± SEM; ***P<0.001 vs. control. B, berberine hydrochloride.

To verify the involvement of p38 and JNK MAPKs in the BER-induced apoptosis, MAPK pathway inhibitors were used together with BER (90 μM). As shown in Fig. 7A–G, the elevated apoptosis induced by BER was significantly abrogated by SB203580 and SP600125. Moreover, the addition of SB203580 and SP600125 reduced the cellular cleaved caspase-3 compared with that treated with BER (Fig. 7H). To confirm the effect of p38 MAPK and JNK on BER-induced apoptosis, anisomycin, the p38 MAPK and JNK activator, was used. As shown in Fig. 8A, anisomycin (10 μg/ml) significantly increased the activation of p38 MAPK, which enhanced the cleavage of caspase-3. When co-treated with anisomycin, BER (90 μM) induced the increased phosphorylation of p38 MAPK compared with BER treatment alone, leading to an increased production of cleaved caspase-3. Consistent with the western blot results, anisomycin and BER induced significant apoptosis compared with the control (P<0.001) (Fig. 8B–F). When combined together, anisomycin and BER enhanced apoptosis as compared to that induced individually.

Figure 7

Blockage of p38 MAPK and JNK decreases cell apoptosis induced by BER in MDA-MB-231 cells. (A–F) Typical images from flow cytometry with Annexin V/PI double staining. (G) Blockage of p38 MAPK and JNK decreased cell apoptosis induced by BER. (H) Western blotting results showed that blockage of p38 MAPK and JNK decreased cleaved caspase-3 expression induced by BER. Data are presented as means ± SEM; **P<0.01, ***P<0.001 vs. control; ###P<0.001 vs. B90. B, berberine hydrochloride (90 μM). A, 0; B, B90; C, SB203580, 25 μM; D, SP600125, 20 μM; E, SB203580+B90; F, SP600125+B90.

Figure 8

Activation of p38 MAPK increases cell apoptosis induced by BER in MDA-MB-231 cells. (A) Western blotting results showed that anisomycin enhanced the phosphorylation of p38 MAPK induced by BER. (B–E) Typical images from flow cytometry with Annexin V/PI double staining. (F) Activation of MAPK increased cell apoptosis induced by BER. Data are presented as means ± SEM; ***P<0.001 vs. control; ###P<0.001 vs. B90. B, berberine hydrochloride (90 μM). B, 0; C, anisomycin, 10 μg/ml; D, B90; E, B90 + anisomycin.

In the present study, the effect of NF-κB, PI3K, AP-1 and JAK2 on BER-induced apoptosis was clarified. As shown in Fig. 9, inhibitors of NF-κB and AP-1 increased the rates of cell apoptosis. Pre-incubation with the inhibitors of NF-κB, PI3K, AP-1 and JAK2 significantly increased cell apoptosis induced by BER. Moreover, the protein expression of cleaved caspase-3 was increased by the pre-incubation of inhibitors of PI3K, JAK2 and p65 NF-κB, compared with BER used alone.

Figure 9

Blockage of PI3K, Jak2, NF-κB and AP-1 elevates cell apoptosis induced by BER in MDA-MB-231 cells. (A–J) Typical images from flow cytometry with Annexin V/PI double staining. (K) Blockage of PI3K, Jak2, NF-κB and AP-1 elevated cell apoptosis induced by BER in MDA-MB-231 cells. (I) Western blotting results showed that the blockage of PI3K, Jak2 and NF-κB increased cleaved caspase-3 expression induced by BER. Data are presented as means ± SEM; ***P<0.001 vs. control; ##P<0.01, ###P<0.001 vs. B90. B90, berberine hydrochloride (90 μM). A, 0; B, JAK I, 5 μ; C, LY294002, 10 μM; D, BAY-11-7082, 5 μM; E, Curcumin, 8 μM; F, B90; G, JAKI+B90; H, LY294002+B90; I, BAY-11-7082+B90; J, Curcumin+B90.

Discussion

The results of the present study have demonstrated that BER significantly inhibited IL-8 secretion, invasion and migration of MDA-MB-231 cells and induced cell apoptosis. Additional experiments revealed that BER suppressed cell proliferation through G2/M arrest and promoted apoptosis of MDA-MB-231 cells by modulation of various signaling pathway molecules such as MAPKs, JAK2, PI3K, Akt and NF-κB.

Chemotherapeutic agents are known to induce IL-8 upregulation in tumor cells, which is closely associated with chemotherapy resistance and cancer metastasis (3,5–7,10,18,21–25,37–40). Depletion of IL-8 induces cell cycle arrest and increases the efficacy of chemotherapeutic agents in breast cancer cells (41). Therefore, chemotherapeutic agents with an inhibitory effect on IL-8 production may be more efficacious in treating breast cancer. MDA-MB-231 is one of the breast cancer cell lines constitutively expressing a high level of IL-8 (15,16). Consistent with previous studies (41), IL-8 enhanced the invasive ability of MDA-MB-231 cells in our experiments (Fig. 2A). However, IL-8 did not interfere with cell migration (Fig. 2C) or cell cycle distribution (Fig. 4). To the best of our knowledge, IL-8 mainly increases the risk of breast cancer metastasis through the enhancement of invasive ability, at least, for MDA-MB-231 cells. In the present study, BER dose-dependently inhibited the proliferation and IL-8 secretion of MDA-MB-231 cells (Fig. 1B and C). Furthermore, BER abrogated the increased invasion induced by IL-8. Thus, BER counteracted the metastasis of MDA-MB-231 cells at least partly in an IL-8 dependent manner.

A number of pathways have been found to be actively involved in the modulation of IL-8 production, including MAPKs, JAK2, and PI3K/Akt pathways (21,25,42–44). In agreement with those studies, our results showed that the activation of ERK1/2, SAPK/JNK, p38 MAPK, JAK2, p85 PI3K, AP-1 and p65 NF-κB pathways was closely associated with the constitutive IL-8 secretion in MDA-MB-231 cells (Fig. 1D). Correspondingly, BER was able to modulate the activation of those molecules. Notably, BER only deactivated JAK2, p85 PI3K and p65 NF-κB signaling but activated that of MAPK pathway molecules (Fig. 6). Therefore, the inhibition of BER on IL-8 production might occur mainly through JAK2/PI3K/NF-κB pathways.

IL-8 can activate PI3K, protein kinase B (PKB and Akt), mammalian target of rapamycin (mTOR), ERK1/2, p38 MAPK and JAK2 pathways to regulate numerous gene and protein expressions involved in cell proliferation, survival, invasion and migration (25,45). Activation of PI3K and JAK2 pathways has been reported to modulate cell invasion and angiogenesis (25). In experiments of the present study, we found that BER inactivated the PI3K/Akt, JAK2 and NF-κB pathways. The results also showed that many metastasis-related genes, including MMP-2, EGF, E-cadherin, bFGF and fibronectin, were downregulated by BER, suggesting the anti-invasive effect of BER was partly, if not all, mediated in an IL-8 dependent manner.

IL-8 was also found to be independent of cell migration, cell cycle distribution and apoptosis of MDA-MB-231 cells. By contrast, BER was actively engaged in these processes, which inhibited cell migration, and induced G2/M arrest and cell apoptosis in an IL-8 independent manner.

The mitogen-activated protein kinases (MAPK) pathways, i.e., ERK, SAPK/JNK and p38 MAPK, are actively involved in drug-induced cell apoptosis of numerous cancer cells (46). Activation of JNK and p38 MAPK pathways results in enhanced apoptosis induced by berberine in human hepatoma and colon carcinoma cells (34,35). When the MAPKs are inhibited, the apoptosis and caspase-3 cleavage in tumor cells are abrogated (46–48). Moreover, inhibitors of MAPKs slightly increase cell viability in MDA-MB-231 cells (49). In the present study, the phosphorylation of p38 MAPK and SAPK/JNK was enhanced by BER treatment. In agreement with the previous studies (31,34), the inhibitors of p38 MAPK and SAPK/JNK attenuated the apoptosis enhanced by BER treatment in a caspase-3-dependent manner, while the inhibitors of p38 MAPK and SAPK/JNK alone showed no obvious effect on cell apoptosis in MDA-MB-231 cells. Furthermore, anisomycin, an activator of p38 MAPK and JNK, induced cell apoptosis and significantly elevated cell apoptosis induced by BER in a caspase-3-dependent manner. Thus, the activation of p38 MAPK and SAPK/JNK was involved in the cell apoptosis induced by BER.

In breast cancer cells, activation of the PI3K/Akt pathway has already been found to prevent cell apoptosis (27,36). By contrast, inhibition of janus kinase 2 (JAK2) promotes cell apoptosis (51,52). However, the effect of JAK2 on apoptosis induced by BER remains to be clarified. In the present study, BER inhibited the activation of JAK2, p85 PI3K and Akt by reducing the phosphorylation of Jak2, p85 PI3K and Akt1. Moreover, the inhibitors of NF-κB, PI3K and JAK2 enhanced the cell apoptosis induced by BER, suggesting the involvement of these three pathways in the BER-induced apoptosis of MDA-MB-231 cells. The gene expression of total Jak2 and Akt1 was also decreased by BER. Therefore, the enhanced apoptosis induced by BER resulted from crosstalk among multiple cell signaling pathways including p38 MAPK, JNK, PI3K/Akt/NF-κB and JAK2.

In conclusion, BER inhibited cell metastasis partly through the downregulation of IL-8 and enhanced cell apoptosis by activating MAPKs and deactivating the JAK2/PI3K/Akt/NF-κB pathways. This was different from other chemotherapeutic drugs that induce apoptosis but simultaneously increase IL-8 expression, therefore, promote cancer metastasis. Thus, BER showed simultaneous anti-carcinoma in situ and anti-metastatic effects in MDA-MB-231 cells, suggesting the effective and safe potential of BER as a therapeutic candidate to treat highly metastatic breast cancer.

Acknowledgements

The present study was supported by the Educational Commission of Shanghai of China (2012JW19); the Key Research Innovation Project (13ZZ099); the Key Project from the Department of Education of China (20123107130002); the Shanghai Eastern Scholar Program (2013–59); and the Excellent Research Team Cultivation Program of Shanghai University of Traditional Chinese Medicine.

Abbreviations:

BER

berberine hydrochloride

DMSO

dimethyl sulfoxide

PI

propidium iodine

FBS

fetal bovine serum

CCK-8

Cell Counting Kit-8

TBST

Tris-HCl-buffered saline with Tween-20

SDS-PAGE

sodium dodecyl sulfate polyacrylamide gel electrophoresis

PBS

phosphate-buffered saline

RT

room temperature

IL-8

interleukin-8

PCR

polymerase chain reaction

ELISA

enzyme-linked immunosorbent assay

JAK

Janus-activated kinase

MAPK

mitogen-activated protein kinase

SAPK/JNK

stress-activated protein kinase/c-Jun N-terminal kinase

ERK

extracellular-regulated protein kinases

NF-κB

nuclear factor κ-light-chain-enhancer of activated B cells

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

PI3K

phosphatidylinositol 3 kinase

MMP-2

matrix metalloproteinase-2

EGF

epidermal growth factor

bFGF

basic fibroblast growth factor

Akt

serine/threonine kinase

AP-1

activator protein 1

References

1 

Siegel R, Naishadham D and Jemal A: Cancer statistics. CA Cancer J Clin. 62:10–29. 2012.

2 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar

3 

Kuai WX, Wang Q, Yang XZ, Zhao Y, Yu R and Tang XJ: Interleukin-8 associates with adhesion, migration, invasion and chemosensitivity of human gastric cancer cells. World J Gastroenterol. 18:979–985. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Bünger S, Haug U, Kelly FM, Klempt-Giessing K, Cartwright A, Posorski N, Dibbelt L, Fitzgerald SP, Bruch HP, Roblick UJ, von Eggeling F, Brenner H and Habermann JK; BMBF-Consortium ‘Colorectal Cancer Screening Chip’. Toward standardized high-throughput serum diagnostics: multiplex-protein array identifies IL-8 and VEGF as serum markers for colon cancer. J Biomol Screen. 16:1018–1026. 2011.

5 

Kitadai Y, Takahashi Y, Haruma K, Naka K, Sumii K, Yokozaki H, Yasui W, Mukaida N, Ohmoto Y and Kajiyama G: Transfection of interleukin-8 increases angiogenesis and tumorigenesis of human gastric carcinoma cells in nude mice. Br J Cancer. 81:647–653. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Matsuo Y, Ochi N, Sawai H, Yasuda A, Takahashi H, Funahashi H, Takeyama H, Tong Z and Guha S: CXCL8/IL-8 and CXCL12/SDF-1alpha co-operatively promote invasiveness and angiogenesis in pancreatic cancer. Int J Cancer. 124:853–861. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Ju D, Sun D, Xiu L, Meng X, Zhang C and Wei P: Interleukin-8 is associated with adhesion, migration and invasion in human gastric cancer SCG-7901 cells. Med Oncol. 29:91–99. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Mohamed MM: Monocytes conditioned media stimulate fibronectin expression and spreading of inflammatory breast cancer cells in three-dimensional culture: a mechanism mediated by IL-8 signaling pathway. Cell Commun Signal. 10:32012. View Article : Google Scholar

9 

Asfaha S, Dubeykovskiy AN, Tomita H, Yang X, Stokes S, Shibata W, Friedman RA, Ariyama H, Dubeykovskaya ZA, Muthupalani S, Ericksen R, Frucht H, Fox JG and Wang TC: Mice that express human interleukin-8 have increased mobilization of immature myeloid cells, which exacerbates inflammation and accelerates colon carcinogenesis. Gastroenterology. 144:155–166. 2013. View Article : Google Scholar

10 

Shi HL, Wu XJ, Liu Y and Xie JQ: Berberine counteracts enhanced IL-8 expression of AGS cells induced by evodiamine. Life Sci. 93:830–839. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Milovanovic J, Todorovic-Rakovic N and Abu Rabi Z: The prognostic role of interleukin-8 (IL-8) and matrix metalloproteinases -2 and -9 in lymph node-negative untreated breast cancer patients. J BUON. 18:866–873. 2013.PubMed/NCBI

12 

Hartman ZC, Poage GM, den Hollander P, Tsimelzon A, Hill J, Panupinthu N, Zhang Y, Mazumdar A, Hilsenbeck SG, Mills GB and Brown PH: Growth of triple-negative breast cancer cells relies upon coordinate autocrine expression of the proinflammatory cytokines IL-6 and IL-8. Cancer Res. 73:3470–3480. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Singh JK, Farnie G, Bundred NJ, Simões BM, Shergill A, Landberg G, Howell SJ and Clarke RB: Targeting CXCR1/2 significantly reduces breast cancer stem cell activity and increases the efficacy of inhibiting HER2 via HER2-dependent and -independent mechanisms. Clin Cancer Res. 19:643–656. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Todorović-Raković N and Milovanović J: Interleukin-8 in breast cancer progression. J Interferon Cytokine Res. 33:563–570. 2013.PubMed/NCBI

15 

Freund A, Chauveau C, Brouillet JP, Lucas A, Lacroix M, Licznar A, Vignon F and Lazennec G: IL-8 expression and its possible relationship with estrogen-receptor-negative status of breast cancer cells. Oncogene. 22:256–265. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Freund A, Jolivel V, Durand S, Kersual N, Chalbos D, Chavey C, Vignon F and Lazennec G: Mechanisms underlying differential expression of interleukin-8 in breast cancer cells. Oncogene. 23:6105–6114. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Neve RM, Chin K, Fridlyand J, Yeh J, Baehner FL, Fevr T, Clark L, Bayani N, Coppe JP, Tong F, Speed T, Spellman PT, DeVries S, Lapuk A, Wang NJ, Kuo WL, Stilwell JL, Pinkel D, Albertson DG, Waldman FM, McCormick F, Dickson RB, Johnson MD, Lippman M, Ethier S, Gazdar A and Gray JW: A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell. 10:515–527. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Britschgi A, Andraos R, Brinkhaus H, Klebba I, Romanet V, Mϋller U, Murakami M, Radimerski T and Bentires-Alj M: JAK2/STAT5 inhibition circumvents resistance to PI3K/Mtor blockade: a rationale for cotargeting these pathways in metastatic breast cancer. Cancer Cell. 22:796–811. 2012. View Article : Google Scholar

19 

Shi Z, Yang WM, Chen LP, Yang DH, Zhou Q, Zhu J, Chen JJ, Huang RC, Chen ZS and Huang RP: Enhanced chemosensitization in multidrug-resistant human breast cancer cells by inhibition of IL-6 and IL-8 production. Breast Cancer Res Treat. 135:737–747. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Juvekar A and Wulf GM: Closing escape routes: inhibition of IL-8 signaling enhances the anti-tumor efficacy of PI3K inhibitors. Breast Cancer Res. 15:3082013. View Article : Google Scholar : PubMed/NCBI

21 

Collins TS, Lee LF and Ting JP: Paclitaxel up-regulates interleukin-8 synthesis in human lung carcinoma through an NF-kappaB-and AP-1-dependent mechanism. Cancer Immunol Immunother. 49:78–84. 2000. View Article : Google Scholar : PubMed/NCBI

22 

De Larco JE, Wuertz BR, Manivel JC and Furcht LT: Progression and enhancement of metastatic potential after exposure of tumor cells to chemotherapeutic agents. Cancer Res. 61:2857–2861. 2001.PubMed/NCBI

23 

Lev DC, Onn A, Melinkova VO, Miller C, Stone V, Ruiz M, McGary EC, Ananthaswamy HN, Price JE and Bar-Eli M: Exposure of melanoma cells to dacarbazine results in enhanced tumor growth and metastasis in vivo. J Clin Oncol. 22:2092–2100. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Kishida O, Miyazaki Y, Murayama Y, Ogasa M, Miyazaki T, Yamamoto T, Watabe K, Tsutsui S, Kiyahara T, Shimomura I and Shinomura Y: Gefitinib (Iressa, ZD1839) inhibits SN38-triggered EGF signals and IL-8 production in gastric cancer cells. Cancer Chemother Pharmacol. 55:584–594. 2005. View Article : Google Scholar

25 

Waugh DJ and Wilson C: The interleukin-8 pathway in cancer. Clin Cancer Res. 14:6735–6741. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Kang JX, Liu J, Wang J, He C and Li FP: The extract of huanglian, a medicinal herb, induces cell growth arrest and apoptosis by upregulation of interferon-beta and TNF-alpha in human breast cancer cells. Carcinogenesis. 26:1934–1939. 2005. View Article : Google Scholar : PubMed/NCBI

27 

Kuo HP, Chuang TC, Tsai SC, Tseng HH, Hsu SC, Chen YC, Kuo CL, Kuo YH, Liu JY and Kao MC: Berberine, an isoquino-line alkaloid, inhibits the metastatic potential of breast cancer cells via Akt pathway modulation. J Agric Food Chem. 60:9649–9658. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Tan W, Li Y, Chen M and Wang Y: Berberine hydrochloride: anticancer activity and nanoparticulate delivery system. Int J Nanomed. 6:1773–1777. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Yu HM, Peng QX, Liu TS, Yang DJ and Chen XZ: Effect of retro-Zuojin pill on apoptosis and Bcl-2, Bax gene expression in SGC-7901 cells. Chin J Exp Trad Med Form (Chin). 14:28–31. 2008.

30 

Shi HL, Xie JQ and Wu DZ: Effect of berberine on cell proliferation and IL-8 expression in AGS cells. Pharmacol Clin Chin Mater Med (Chin). 28:45–48. 2012.

31 

Hsu WH, Hsieh YS, Kuo HC, Teng CY, Huang HI, Wang CJ, Yang SF, Liou YS and Kuo WH: Berberine induces apoptosis in SW620 human colonic carcinoma cells through generation of reactive oxygen species and activation of JNK/p38 MAPK and Fas L. Arch Toxicol. 81:719–728. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Hur JM, Hyun MS, Lim SY, Lee WY and Kim D: The combination of berberine and irradiation enhances anti-cancer effects via activation of p38 MAPK pathway and ROS generation in human hepatoma cells. J Cell Biochem. 107:955–964. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Kuo HP, Chuang TC, Yeh MH, Hsu SC, Way TD, Chen PY, Wang SS, Chang YH, Kao MC and Liu JY: Growth suppression of HER2-overexpressing breast cancer cells by berberine via modulation of the HER2/PI3K/Akt signaling pathway. J Agric Food Chem. 59:8216–8224. 2011. View Article : Google Scholar : PubMed/NCBI

34 

Ho YT, Lu CC, Yang JS, Chiang JH, Li TC, Ip SW, Hsia TC, Liao CL, Lin JG, Wood WG and Chung JG: Berberine induced apoptosis via promoting the expression of caspase-8, -9 and -3, apoptosis-inducing factor and endonuclease G in SCC-4 human tongue squamous carcinoma cancer cells. Anticancer Res. 29:4063–4070. 2009.PubMed/NCBI

35 

Eom KS, Kim HJ, So HS, Park R and Kim TY: Berberine-induced apoptosis in human glioblastoma T98G cells is mediated by endoplasmic reticulum stress accompanying reactive oxygen species and mitochondrial dysfunction. Biol Pharm Bull. 33:1644–1649. 2010. View Article : Google Scholar

36 

Xu LN, Lu BN, Hu MM, Xu YW, Han X, Qi Y and Peng JY: Mechanisms involved in the cytotoxic effects of berberine on human colon cancer HCT-8 cells. Biocell. 36:113–120. 2012.PubMed/NCBI

37 

Ebos JM, Lee CR, Cruz-Munoz W, Bjarnason GA, Christensen JG and Kerbel RS: Accelerated metastasis after short-term treatment with a potent inhibitor of tumor angiogenesis. Cancer Cell. 15:232–239. 2009. View Article : Google Scholar : PubMed/NCBI

38 

Paez-Ribes M, Allen E, Hudock J, Takeda T, Okuyama H, Vinals F, Inoue M, Bergers G, Hanahan D and Casanovas O: Antiangiogenic therapy elicits malignant progression of tumors to increased local invasion and distant metastasis. Cancer Cell. 15:220–231. 2009. View Article : Google Scholar : PubMed/NCBI

39 

Britschgi A, Radimerski T and Bentires-Alj M: Targeting PI3K, HER2 and the IL-8/JAK2 axis in metastatic breast cancer: which combination makes the whole greater than the sum of its parts? Drug Resist Updat. 16:68–72. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Lai Y, Shen Y, Liu XH, Zhang Y, Zeng Y and Liu YF: Interleukin-8 induces the endothelial cell migration through the activation of phosphoinositide 3-kinase-Rac1/RhoA pathway. Int J Biol Sci. 7:782–791. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Shao N, Chen LH, Ye RY, Lin Y and Wang SM: The depletion of interleukin-8 causes cell cycle arrest and increases the efficacy of docetaxel in breast cancer cells. Biochem Biophys Res Commun. 431:535–541. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Chelouche-Lev D, Miller CP, Tellez C, Ruiz M, Bar-Eli M and Price JE: Different signalling pathways regulate VEGF and IL-8 expression in breast cancer: implications for therapy. Eur J Cancer. 40:2509–2518. 2004. View Article : Google Scholar : PubMed/NCBI

43 

Bezzerri V, Borgatti M, Finotti A, Tamanini A, Gambari R and Cabrini G: Mapping the transcriptional machinery of the IL-8 gene in human bronchial epithelial cells. J Immunol. 187:6069–6081. 2011. View Article : Google Scholar : PubMed/NCBI

44 

Wang Y, Wang W, Wang L, Wang X and Xia J: Regulatory mechanisms of interleukin-8 production induced by tumour necrosis factor-α in human hepatocellular carcinoma cells. J Cell Mol Med. 16:496–506. 2012.

45 

Burger M, Hartmann T, Burger JA and Schraufstatter IU: KSHV-GPCR and CXCR2 transforming capacity and angiogenic responses are mediated through a JAK2-3-dependent pathway. Oncogene. 24:2067–2075. 2005. View Article : Google Scholar : PubMed/NCBI

46 

Uehara N, Kanematsu S, Miki H, Yoshizawa K and Tsubura A: Requirement of p38 MAPK for a cell-death pathway triggered by vorinostat in MDA-MB-231 human breast cancer cells. Cancer Lett. 315:112–121. 2012. View Article : Google Scholar : PubMed/NCBI

47 

Kim YK, Kim HJ, Kwon CH, Kim JH, Woo JS, Jung JS and Kim JM: Role of ERK activation in cisplatin-induced apoptosis in OK renal epithelial cells. J Appl Toxicol. 25:374–382. 2005. View Article : Google Scholar : PubMed/NCBI

48 

Jo SK, Cho WY, Sung SA, Kim HK and Won NH: MEK inhibitor, U0126, attenuates cisplatin-induced renal injury by decreasing inflammation and apoptosis. Kidney Int. 67:458–466. 2005. View Article : Google Scholar : PubMed/NCBI

49 

Jayasooriya RGPT, Moon DO, Park SR, Choi YH, Asami Y, Kim MO, Jang JH, Kim BY, Ahn JS and Kim GY: Combined treatment with verrucarin A and tumor necrosis factor-α sensitizes apoptosis by overexpression of nuclear factor-kappaB-mediated Fas. Envir Toxicol Pharmacol. 36:303–310. 2013.

50 

Parada E, Egea J, Romero A, del Barrio L, García AG and López MG: Poststress treatment with PNU282987 can rescue SH-SY5Y cells undergoing apoptosis via α7 nicotinic receptors linked to a Jak2/Akt/HO-1 signaling pathway. Free Radic Biol Med. 49:1815–1821. 2010.PubMed/NCBI

51 

Chen Q, Lu Z, Jin Y, Wu Y and Pan J: Triptolide inhibits Jak2 transcription and induces apoptosis in human myeloproliferative disorder cells bearing Jak2V617F through caspase-3-mediated cleavage of Mcl-1. Cancer Lett. 291:246–255. 2010. View Article : Google Scholar

52 

Will B, Siddiqi T, Jorda MA, Shimamura T, Luptakova K, Staber PB, Costa DB, Steidl U, Tenen DG and Kobayashi S: Apoptosis induced by JAK2 inhibition is mediated by Bim and enhanced by the BH3 mimetic ABT-737 in JAK2 mutant human erythroid cells. Blood. 115:2901–2909. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li X, Zhao S, Shi H, Qiu S, Xie J, Wu H, Zhang B, Wang Z, Yuan J, Wu X, Wu X, et al: Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells. Oncol Rep 32: 2777-2788, 2014.
APA
Li, X., Zhao, S., Shi, H., Qiu, S., Xie, J., Wu, H. ... Wu, X. (2014). Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells. Oncology Reports, 32, 2777-2788. https://doi.org/10.3892/or.2014.3520
MLA
Li, X., Zhao, S., Shi, H., Qiu, S., Xie, J., Wu, H., Zhang, B., Wang, Z., Yuan, J., Wu, X."Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells". Oncology Reports 32.6 (2014): 2777-2788.
Chicago
Li, X., Zhao, S., Shi, H., Qiu, S., Xie, J., Wu, H., Zhang, B., Wang, Z., Yuan, J., Wu, X."Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells". Oncology Reports 32, no. 6 (2014): 2777-2788. https://doi.org/10.3892/or.2014.3520
Copy and paste a formatted citation
x
Spandidos Publications style
Li X, Zhao S, Shi H, Qiu S, Xie J, Wu H, Zhang B, Wang Z, Yuan J, Wu X, Wu X, et al: Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells. Oncol Rep 32: 2777-2788, 2014.
APA
Li, X., Zhao, S., Shi, H., Qiu, S., Xie, J., Wu, H. ... Wu, X. (2014). Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells. Oncology Reports, 32, 2777-2788. https://doi.org/10.3892/or.2014.3520
MLA
Li, X., Zhao, S., Shi, H., Qiu, S., Xie, J., Wu, H., Zhang, B., Wang, Z., Yuan, J., Wu, X."Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells". Oncology Reports 32.6 (2014): 2777-2788.
Chicago
Li, X., Zhao, S., Shi, H., Qiu, S., Xie, J., Wu, H., Zhang, B., Wang, Z., Yuan, J., Wu, X."Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells". Oncology Reports 32, no. 6 (2014): 2777-2788. https://doi.org/10.3892/or.2014.3520
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team