Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
April-2015 Volume 33 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2015 Volume 33 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Downregulation of p53 promotes in vitro perineural invasive activity of human salivary adenoid cystic carcinoma cells through epithelial-mesenchymal transition-like changes

  • Authors:
    • Xiangming Yang
    • Da Jing
    • Lijun Liu
    • Zhiyuan Shen
    • Jun Ju
    • Chao Ma
    • Moyi Sun
  • View Affiliations / Copyright

    Affiliations: State Key Laboratory of Military Stomatology, Department of Oral and Maxillofacial Surgery, School of Stomatology, Fourth Military Medical University, Xi'an, Shaanxi, P.R. China, Department of Biomedical Engineering, Fourth Military Medical University, Xi'an, Shaanxi, P.R. China
  • Pages: 1650-1656
    |
    Published online on: January 26, 2015
       https://doi.org/10.3892/or.2015.3750
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Salivary adenoid cystic carcinoma (SACC) is a malignant tumor that is characterized by perineural invasion (PNI). p53 is an essential tumor-suppressor gene and p53 mutations play a critical role in tumor occurrence and progression (e.g., pancreatic, prostate and head and neck cancer). However, the regulatory role of the p53 gene in SACC and the PNI process remains unknown. In the present study, we employed RNA interference technique to downregulate p53 gene expression in SACC-83 cells to explore the role of p53 in the PNI process. Our results showed that the downregulation of the p53 gene induced significant ‘epithelial-mesenchymal transition (EMT)-like changes’ in SACC-83 cells, including decreased expression levels of epithelial markers (E-cadherin, EMA and CK5) and increased expression levels of mesenchymal markers (vimentin, N-cadherin and C-cadherin). The downregulation of p53 also caused a lower apoptotic index of Annexin V-FITC/PI and a lower number of SACC-83 cells in the second G0/G1 phase of the cell cycle. Furthermore, the downregulation of the p53 gene resulted in a significant increase in PNI activity in the SACC-83 cells. Thus, our findings revealed that downregulation of p53 promoted in vitro PNI activity through ‘EMT-like changes’ in SACC-83 cells. The present study suggests the essential regulatory role of p53 in the PNI activity of SACC cells, and implies that p53 may be a new target gene for the clinical treatment of SACC.

Introduction

Salivary adenoid cystic carcinoma (SACC) is a unique malignant tumor which is unpredictable in nature. The incidence rate of SACC is ~10% of all salivary gland tumors (1–3), 22% of all malignant salivary gland tumors (4), and 1% of all head and neck malignant tumors (2,3). SACC occurs most commonly in minor salivary glands and the oral cavity (1,3). Perineural invasion (PNI), a unique pathological entity that significantly differs from lymphatic and vascular invasion, is considered to be an essential feature of SACC (5). PNI may also act as a source of malignant tumor distant metastasis, and the range of PNI is much wider than local invasion (6–8). PNI has become an important pathological feature of many malignant tumors, including pancreatic and prostate cancer, cholangiocarcinoma and head and neck cancer. PNI is also proven to be a sign of poor prognosis and a decreased survival omen for these malignant tumors (9–13).

Epithelial-mesenchymal transition (EMT) refers to the rapid and reversible changes in cellular morphology and phenotype characterized by the transformation of epithelial features into mesenchymal features (14,15). Numerous lines of evidence have proven that EMT has the capacity of regulating cell fate and tissue morphology (16–19). In laboratory studies, EMT has also shown a close relationship with the process of tumor growth and metastasis (16,18). However, no direct evidence of EMT has been revealed in the clinic. Thus, some pathologists have conjectured that EMT exhibits no correlation with the development and progression of tumors (20). It is widely acknowledged that the narrowly defined EMT should be strictly distinguished from an EMT-like cell phenotype for exploring tumor occurrence and progression (21). Since EMT changes result from the poor differentiation of tumor cells, it seems more appropriate to use ‘EMT-like changes’ to describe the phenotype of tumor cells in the process of tumor genesis (21). The term ‘EMT-like changes’ emphasizes the renewal of tumor cells and adaptation to a specific microenvironment instead of a positive de-differentiation process (21).

p53 is an essential tumor-suppressor gene, and p53 mutations play a critical role in tumor occurrence and progression (e.g., pancreatic, prostate, and head and neck cancer) (22,23). Our previous study showed that SACC with PNI exhibited significantly lower p53 gene expression than SACC without PNI (24). Chang et al found that the p53 gene could regulate the EMT process of breast cancer cells (25). Thus, in the present study, we hypothesized that p53 plays a crucial role in regulating PNI activity in SACC through a potential mechanism that is related to ‘EMT-like changes’.

In the present study, the regulatory role of the p53 gene in SACC and the potential metastatic process was systematically investigated. We used the RNA interference technique to downregulate the expression of the p53 gene in SACC-83 cells (a human SACC cell line), and then examined the changes in cell phenotype markers, cell cycle, anti-apoptosis and the PNI capability of SACC-83 cells. Our data showed that downregulation of p53 gene expression promoted in vitro PNI activity of SACC-83 cells through ‘EMT-like changes’.

Materials and methods

shRNA preparation

Four p53 shRNAs were designed according to the p53 sequence in the GenBank (NM_006500) following the rules of Tuschl (26). As shown in Table I, p53 shRNAs contained a unique 19-nt double-stranded human p53 sequence that was presented as an inverted complementary repeat and separated by a loop of 9-nt spacer. DNA oligonucleotides targeting p53 were synthesized and inserted into the linearized pGPU6/GFP/Neo shRNA expression vector according to the manufacturer’s instructions (Table I). The recombinant vectors were named pGGNeo-p53-homo-1043-shRNA, pGGNeo-p53-homo-1157-shRNA, pGGNeo-p53-homo-968-shRNA and pGGNeo-p53-homo-270-shRNA. The pGGNeo-negative-shRNA contained a nonsense shRNA insert designed according to the p53-shRNA sequence and was checked by BLAST. The pGGNeo-GAPDH-shRNA was a positive control vector targeting GAPDH to test the system error.

Table I

Oligonucleotide sequences of the p53-specific shRNAs.

Table I

Oligonucleotide sequences of the p53-specific shRNAs.

GenesPrimer sequence (5′-3′)
pGGNeo-p53-homo-1043-shRNA GCGCACAGAGGAAGAGAATCT
AGATTCTCTTCCTCTGTGCGC
pGGNeo-p53-homo-1157-shRNA GAAACCACTGGATGGAGAATA
TATTCTCCATCCAGTGGTTTC
pGGNeo-p53-homo-968-shRNA GGAAGACTCCAGTGGTAATCT
AGATTACCACTGGAGTCTTCC
pGGNeo-p53-homo-270-shRNA CTACTTCCTGAAAACAACG
CGTTGTTTTCAGGAAGTAG
pGGNeo-negative-shRNA TTCTCCGAACGTGTCACGT
ACGTGACACGTTCGGAGAA
pGGNeo-GAPDH-shRNA GTATGACAACAGCCTCAAG
CTTGAGGCTGTTGTCATAC
Cell culture and shRNA transfection

SACC-83 cells are a type of human SACC cell line, which have been widely used for the investigation of the biological characteristics of SACC (27). The SACC-83 cells were cultured in 6-well plates in RPMI-1640 medium (HyClone, USA) with 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), 100 U/ml penicillin and 0.1 mg/ml streptomycin at 37°C in 5% CO2. After incubation for 24 h, cells (~70% confluency) were treated with various vectors, including pGGNeo-p53-homo-1043-shRNA, pGGNeo-p53-homo-1157-shRNA, pGGNeo-p53-homo-968-shRNA, pGGNeo-p53-homo-270-shRNA, pGGNeo-negative-shRNA and pGGNeo-GAPDH-shRNA which had been precomplexed with Lipofectamine™ 2000 (Boster, Wuhan, China). Seventy-two hours post shRNA transfection, the cells were used for real-time PCR, western blotting, flow cytometry and PNI analyses.

Real-time PCR

The forward and reverse primers corresponding to the human p53 gene were: 5′-GGTCTGGCCCCTCCTCAGCA-3′ and 5′-TGCCGCCCATGCAGGAACTG-3; total 178 bp. The mRNA of GAPDH was amplified with forward (5′-ctcatgaccacagtccatgc-3′) and reverse (5′-ttcagctc tgggatgacctt-3′) primers with a total product length of 106 bp. Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized with RevertAid™ H Minus First Strand cDNA Synthesis kit (Fermentas, Hanover, MD, USA). PCR reactions were performed in a total of 25 μl reaction mixture (1 μl of cDNA, 4 μl of forward and reverse primers, 12.5 μl of 2X SYBR-Green PCR Master Mix and 7.5 μl of ddH2O). Data were analyzed with the comparative Ct method and normalized by actin expression in each sample.

Western blot analysis

Total proteins were extracted with a protein extraction kit (ProMab, USA). The protein extracts (30 μg/sample) were subjected to electrophoretic separation by 8 and 10% Tris-glycine SDS-PAGE and were transferred onto PVDF membranes (Millipore) after being mixed with 5X loading buffer and boiled for 8 min. The PVDF membranes were blocked in Tris-buffered saline, 0.5% Tween-20 (TBST) containing 5% BSA for 2 h and incubated overnight at 4°C with primary antibodies to p53 (1:1,000; CST), vimentin (1:1,000), CK5 (1:1,000), N-cadherin (1:1,000), E-cadherin (1:1,000) (all from Abcam), C-cadherin (1:1,000; PTG) and GAPDH (1:1,000; Abcam) in TBST containing 5% BSA. Horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG was used as the secondary antibody. The membranes were then visualized by an ECL chemiluminescence system (GE ImageQuant 350; GE Healthcare). Semi-quantitative analysis was performed using the Quantity One software (Bio-Rad). The experiments were performed in triplicate.

Flow cytometric analysis

Seventy-two hours after transfection of pGGNeo-p53-homo-270-shRNA or pGGNeo-negative-shRNA, SACC-83 cells, at 2×106 for each sample, were harvested by trypsinization and fixed in 75% pre-cold ethanol at 4°C for 24 h. Cell pellets were re-suspended in 0.1 mg/ml propidium iodide (PI) solution (3.8×10−2 sodium citrate, pH=7.0) and fixed in 10 mg/ml RNase solution (both from Sigma, USA) at 37°C for 30 min in the dark. Cell cycle analyses were performed with a flow cytometer (Beckman Coulter, Inc., Fullerton, CA, USA). The experiments were performed in triplicate.

Apoptosis assay

Seventy-two hours after transfection of pGGNeo-p53-homo-270-shRNA, both transfected and untransfected SACC-83 cells, at 105–106 for each sample, were trypsinized, collected and washed twice with pre-cold 1X PBS. Each sample was re-suspended in 100 μl 5% Annexin V-FITC (ADL, USA) at 37°C for 15 min in the dark and then fixed in 10 μl PI. Annexin V-FITC and PI were measured and analyzed by flow cytometry. The experiments were performed in triplicate.

In vitro PNI assay

The promoting effects of p53 downregulation on PNI activity in SACC-83 cells were investigated in modified Boyden chambers. Each Transwell invasion chamber containing polycarbonate filters (Corning, USA) was coated on the upper surface with 60–80 μl of 3.9 μg/μl basement membrane Matrigel (BD Biosciences, USA) at 37°C for 30 min. Cells (5×104) were suspended in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) supplemented with 1% FBS and added to the upper chamber. The lower chamber contained 600 μl conditioned medium (incubating NIH3T3 cells in serum-free DMEM for 24 h) as a chemoattractant (28,29). A concentration of 25 ng/ml of nerve growth factor (R&D Systems, USA) which has been proven optimal for increasing the in vitro PNI activity by our previous study was added into the conditioned medium (29,30). Cells were incubated at 37°C with 5% CO2 for 12 h. Then, cells on the upper surface of the filter were completely removed by a cotton swab. The filter was then fixed in 95% ethanol and stained with hematoxylin. Cells that had reached the lower surface of the filter through Matrigel were counted under a light microscope at a magnification of ×400. We chose eight fields of vision and counted the number of invaded cells on the lower surface of the filter. The assays were performed in triplicate.

Statistical analysis

All data presented here are expressed as the means ± standard deviation (SD). Statistical analyses were performed using computer software, Microsoft SPSS version 13.0 for Windows (SPSS, Inc., Chicago, IL, USA). One-way analysis of variance (ANOVA) with Tukey’s post-hoc analysis was used to determine the difference between every two groups. P<0.05 was considered to indicate a statistically significant result.

Results

pGGNeo-p53-homo-270-shRNA effectively downregulates the expression level of p53 in SACC-83 cells

As shown in Fig. 1A, mRNA p53 expression in the SACC-83 cells transfected with pGGNeo-p53-homo-1043-shRNA, pGGNeo-p53-homo-1157-shRNA, pGGNeo-p53-homo-968-shRNA and pGGNeo-p53-homo-270-shRNA p53 mRNA was relatively decreased by 36, 62, 51 and 78% as compared with the untransfected SACC-83 cells. Furthermore, western blot analyses showed reduced expression of p53 proteins in SACC-83 cells transfected with pGGNeo-p53-homo-1043-shRNA, pGGNeo-p53-homo-1157-shRNA, pGGNeo-p53-homo-968-shRNA and pGGNeo-p53-homo-270-shRNA (Fig. 1B). The cells transfected with pGGNeo-p53-homo-270-shRNA showed the most significant decrease in the expression of p53 protein. These results demonstrated that p53 was downregulated most specifically and effectively by pGGNeo-p53-homo-270-shRNA. Thus, cells transfected with pGGNeo-p53-homo-270-shRNA were used in the present investigation.

Figure 1

p53-specific shRNAs resulted in the reduction of p53 mRNA and protein expression in SACC-83 cells. The p53 mRNA level and protein expression were measured by (A) real-time-PCR and (B) western blotting, respectively. Data are presented as the means ± SD (n=3). *P<0.05 vs. the control (SACC-83) group. #P<0.05 vs. the negative control group. SACC, salivary adenoid cystic carcinoma.

shRNA-mediated downregulation of p53 induces ‘EMT-like changes’ in SACC-83 cells

As shown in Fig. 2, expression levels of epithelial cell markers, including E-cadherin, EMA and CK5 were significantly decreased in the experimental group (p53-homo-270) as compared with the negative or blank control group (P<0.05). The experimental group also showed significant increases in the expression levels of mesenchymal cell markers, including vimentin, N-cadherin and C-cadherin (P<0.05). These results suggest that pGGNeo-p53-homo-270-shRNA-mediated downregulation of p53 induced ‘EMT-like changes’ in the SACC-83 cells.

Figure 2

Downregulation of p53 induces ‘EMT-like changes’ in SACC-83 cells. Markers of ‘EMT-like changes’ were detected by western blotting. (A) The protein levels of epithelial cell markers (E-cadherin, EMA and CK5) and mesenchymal cell markers (vimentin, N-cadherin and C-cadherin) were detected by western blot analyses in the control group (SACC-83), negative control and experimental group (p53-homo-270). (B) Quantitative protein expression analyses normalized by GAPDH for epithelial cell markers and mesenchymal cell markers. Data are presented as the means ± SD (n=3). *P<0.05 vs. the control (SACC-83) group. #P<0.05 vs. the negative control group. EMT, epithelial-mesenchymal transition; SACC, salivary adenoid cystic carcinoma.

Downregulation of p53 by pGGNeo-p53-homo-270-shRNA increases the survival of SACC-83 cells

Seventy-two hours after transfection with pGGNeo-p53-homo-270-shRNA, the cell cycles distribution of the SACC-83 cells was examined to evaluate cell survival. Our results showed that cells in the control and negative control group resulted in cycling of ~12 and 13% of cells in the second G0/G1 phase, respectively (Fig. 3A). The percentage of cells in the second G0/G1 phase was decreased to ~3% in the experimental group (Fig. 3A). These data suggest that downregulation of p53 promoted the anti-apoptotic ability of SACC-83 cells by modulating the second G0/G1 cell cycle regulator. As shown in Fig. 3B, the early apoptotic rates in the control and negative control group were 13.3 and 12.6%, respectively. In the experimental group, the early apoptotic rate was significantly reduced to 3.4% (Fig. 3B). These findings were consistent with the cell cycle results, indicating that downregulation of p53 promoted the anti-apoptotic ability and thus increased cell survival of SACC-83 cells.

Figure 3

Downregulation of p53 increases the survival of SACC-83 cells. (A) Results of the flow cytometric analyses for the cell number in the second G0/G1 phase in the control group (SACC-83), negative control and experimental group (p53-homo-270). (B) Analyses of the early apoptosis rates of SACC-83 cells in the control group (SACC-83), negative control and experimental group (p53-homo-270). Data are presented as the means ± SD (n=3). *P<0.05 vs. the control (SACC-83) group. #P<0.05 vs. the negative control group. SACC, salivary adenoid cystic carcinoma.

Downregulation of p53 by pGGNeo-p53-homo-270-shRNA increases in vitro PNI of SACC-83 cells

PNI activity of the SACC-83 cells transfected with pGGNeo-p53-homo-270-shRNA was assayed in vitro using modified Boyden chambers. As compared with the control group (SACC-83) and negative control group, SACC-83 cells in the experimental group (p53-homo-270) showed significantly higher PNI activity (P<0.01) (Fig. 4). These findings indicate that the downregulation of p53 promoted the PNI activity of SACC-83 cells.

Figure 4

Downregulation of p53 increases the in vitro PNI activity of SACC-83 cells via the evaluation of Boyden chambers. (A) Representative images and (B) the relevant statistical analyses for the migrated cells under a light microscope in the control group (SACC-83), negative control and experimental group (p53-homo-270). Data are presented as the means ± SD (n=3). *P<0.05 vs. the control (SACC-83) group. #P<0.05 vs. the negative control group. PNI, perineural invasion; SACC, salivary adenoid cystic carcinoma.

Discussion

p53 is a recognized tumor-suppressor gene, located on the short arm of human chromosome 17p13 which shows loss of heterozygosity (LOH) status in most tumors. The p53 gene can activate the transcription of cyclin-dependent kinase inhibitor p21, and then induce G1 phase arrest of tumor cells cycling through p21. This process has been investigated and widely recognized in previous research (31). The p53 gene can also inhibit malignant growth by promoting the apoptosis of tumor cells (32). Many studies have also confirmed that the p53 gene can inhibit the process of malignant transformation and malignant proliferation of tumor cells (33–37).

EMT is considered to be closely related to tumor development, malignant tumor local invasion and distant metastasis (15–20). Generally, tumor cells always exhibit poor differentiation, which may result in various differentiation errors (e.g., EMT) during the tumor cell differentiation process. Thus, it seems more appropriate to use ‘EMT-like changes’ to describe the tumor cell phenotype in the process of tumor genesis (22). In addition, ‘EMT-like changes’ also stimulate other properties of tumor cells during tumor progression, such as enhanced migration activity, elevated anti-apoptotic capability and increased invasive activity (21,22). The present study focused on depicting the regulatory mechanisms of ‘EMT-like changes’ and clarifying the role of ‘EMT-like changes’ in tumor development and metastasis. To our knowledge, this is the first report to investigate the relationship between ‘EMT-like changes’ and PNI. The regulatory role of the p53 gene in EMT or ‘EMT-like changes’ also remains poorly understood. Chang et al reported that p53 acted as a key factor in the regulation of the EMT process of breast cancer (25). Considering that the mutation rate of the p53 gene in head and neck cancer is high (50–70%), we hypothesized in the present study that downregulation of p53 may induce ‘EMT-like changes’ in SACC and thus enhance its PNI activity.

In the present study, we used the RNA interference technique to reduce p53 gene expression in SACC-83 cells, and subsequently detected alterations in ‘EMT-like change’ markers. We found that pGGNeo-p53-homo-270-shRNA effectively reduced the expression of p53. Our western blot analyses demonstrated that downregulation of the p53 gene in SACC-83 cells caused significantly reduced expression levels of epithelial cell markers (E-cadherin, CK5 and EMA), and significantly increased expression levels of mesenchymal cell markers (vimentin, N-cadherin and C-cadherin). These results revealed obvious ‘EMT-like changes’ and suggest that downregulation of p53 induced ‘EMT-like changes’ in the SACC-83 cells.

Seventy-two hours after transfection with pGGNeo-p53-homo-270-shRNA, we examined the cell cycle distribution of SACC-83 cells with ‘EMT-like changes’. We found that the number of SACC-83 cells in the second G0/G1 phase cell cycle was significantly reduced, indicating that downregulation of p53 promoted the anti-apoptotic activity of SACC-83 cells. Furthermore, the Annexin V-FITC and PI apoptosis experiment was performed to evaluate the anti-apoptotic activity of SACC-83 cells with ‘EMT-like changes’. Our results showed that the number of early apoptotic cells was significantly decreased. Thus, these findings suggest that ‘EMT-like changes’ induced by p53 downregulation could increase the anti-apoptotic activity of SACC-83 cells and thus promote cell survival. We also examined the in vitro PNI capacity of SACC-83 cells with ‘EMT-like changes’. Our results indicated that ‘EMT-like changes’ induced by p53 gene downregulation enhanced the in vitro PNI capability of the SACC-83 cells. Together, these findings in the present study revealed that downregulation of the p53 gene induced ‘EMT-like changes’ in SACC-83 cells which increased the in vitro PNI activity in these cells.

SACC is a common malignant salivary gland tumor characterized by PNI. PNI has an important impact on clinical treatment and prognosis. Therefore, it is imperative to study the mechanism of PNI of SACC, thus providing a potentially new strategy for the clinical treatment of SACC. Since a replication-defective p53 gene virus (Ad5CMV P53) was reported in 1994 (38), p53-based gene therapy for tumors has gained extensive attention. Roth et al directly injected a retroviral vector containing the wild-type p53 gene into patients with non-small cell lung cancer under control of the actin promoter and achieved satisfactory therapeutic effects (39). Moreover, many clinical trials regarding p53 have also been completed, including its application in esophageal cancer (40). Several trials have reached the third stage, yet p53 gene therapy has not yet received final approval from the FDA (41). In the present study, we found that the downregulation of the p53 gene could induce ‘EMT-like changes’ in SACC-83 cells, and thus these ‘EMT-like changes’ promoted in vitro PNI activity of SACC-83 cells. Our findings suggest that the p53 gene may be used as a new target gene for the clinical treatment of SACC.

Acknowledgements

The present study was sponsored by the National Natural Science Foundation of China (grant nos. 81072230 and 30772428).

References

1 

Khan AJ, DiGiovanna MP, Ross DA, Sasaki CT, Carter D, Son YH and Haffty BG: Adenoid cystic carcinoma: a retrospective clinical review. Int J Cancer. 96:149–158. 2001. View Article : Google Scholar : PubMed/NCBI

2 

Chummun S, McLean NR, Kelly CG, Dawes PJ, Meikle D, Fellows S and Soames JV: Adenoid cystic carcinoma of the head and neck. Br J Plast Surg. 54:476–480. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Wiseman SM, Popat SR, Rigual NR, Hicks WL Jr, Orner JB, Wein RO, McGary CT and Loree TR: Adenoid cystic carcinoma of the paranasal sinuses or nasal cavity: a 40-year review of 35 cases. Ear Nose Throat J. 81:510–517. 2002.PubMed/NCBI

4 

Hotte SJ, Winquist EW, Lamont E, MacKenzie M, Vokes E, Chen EX, Brown S, Pond GR, Murgo A and Siu LL: Imatinib mesylate in patients with adenoid cystic carcinoma of the salivary glands expressing c-kit: a Princess Margaret Hospital phase II consortium study. J Clin Oncol. 23:585–590. 2005. View Article : Google Scholar : PubMed/NCBI

5 

Fordice J, Kershaw C, El-Naggar A and Goepfert H: Adenoid cystic carcinoma of the head and neck: predictors of morbidity and mortality. Arch Otolayrngol Head Neck Surg. 125:149–152. 1999. View Article : Google Scholar

6 

Batsakis JG: Nerves and neurotropic carcinomas. Ann Otol Rhinol Laryngol. 94:426–427. 1985.PubMed/NCBI

7 

Hassan MO and Maksem J: The prostatic perineural space and its relation to tumor spread: an ultrastructural study. Am J Surg Pathol. 4:143–148. 1980. View Article : Google Scholar : PubMed/NCBI

8 

Rodin AE, Larson DL and Roberts DK: Nature of the perineural space invaded by prostatic carcinoma. Cancer. 20:1772–1779. 1967. View Article : Google Scholar : PubMed/NCBI

9 

Ozaki H, Hiraoka T, Mizumoto R, Matsuno S, Matsumoto Y, Nakayama T, Tsunoda T, Suzuki T, Monden M, Saitoh Y, Yamauchi H and Ogata Y: The prognostic significance of lymph node metastasis and intrapancreatic perineural invasion in pancreatic cancer after curative resection. Surg Today. 29:16–22. 1999. View Article : Google Scholar : PubMed/NCBI

10 

Law WL and Chu KW: Anterior resection for rectal cancer with mesorectal excision: a prospective evaluation of 622 patients. Ann Surg. 240:260–268. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Beard CJ, Chen MH, Cote K, Loffredo M, Renshaw AA, Hurwitz M and D’Amico AV: Perineural invasion is associated with increased relapse after external beam radiotherapy for men with low-risk prostate cancer and may be a marker for occult, high-grade cancer. Int J Radiat Oncol Biol Phys. 58:19–24. 2004. View Article : Google Scholar

12 

Su CH, Tsay SH, Wu CC, Shyr YM, King KL, Lee CH, Lui WY, Liu TJ and P’eng FK: Factors influencing postoperative morbidity, mortality, and survival after resection for hilar cholangiocarcinoma. Ann Surg. 223:384–394. 1996. View Article : Google Scholar : PubMed/NCBI

13 

Duraker N, Sişman S and Can G: The significance of perineural invasion as a prognostic factor in patients with gastric carcinoma. Surg Today. 33:95–100. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Savagner P: Leaving the neighborhood: molecular mechanisms involved during epithelial-mesenchymal transition. Bioessays. 23:912–923. 2001. View Article : Google Scholar : PubMed/NCBI

15 

Thiery JP, Acloque H, Huang RY and Nieto MA: Epithelial-mesenchymal transitions in development and disease. Cell. 139:871–890. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Jechlinger M, Grunert S, Tamir IH, Janda E, Lüdemann S, Waerner T, Seither P, Weith A, Beug H and Kraut N: Expression profiling of epithelial plasticity in tumor progression. Oncogene. 22:7155–7169. 2003. View Article : Google Scholar : PubMed/NCBI

17 

Shi Y and Massagué J: Mechanisms of TGF-β signaling from cell membrane to the nucleus. Cell. 113:685–700. 2003. View Article : Google Scholar

18 

Lee JM, Dedhar S, Kalluri R and Thompson EW: The epithelial-mesenchymal transition: new insights in signaling, development, and disease. J Cell Biol. 172:973–981. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Hennessy BT, Gonzalez-Angulo AM, Stemke-Hale K, Gilcrease MZ, Krishnamurthy S, Lee JS, Fridlyand J, Sahin A, Agarwal R, Joy C, Liu W, Stivers D, Baggerly K, Carey M, Lluch A, Monteagudo C, He X, Weigman V, Fan C, Palazzo J, Hortobagyi GN, Nolden LK, Wang NJ, Valero V, Gray JW, Perou CM and Mills GB: Characterization of a naturally occurring breast cancer subset enriched in epithelial-to-mesenchymal transition and stem cell characteristics. Cancer Res. 69:4116–4124. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Tarin D, Thompson EW and Newgreen DF: The fallacy of epithelial mesenchymal transition in neoplasia. Cancer Res. 65:5996–6001. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Klymkowsky MW and Savagner P: Epithelial-mesenchymal transition: a cancer researcher’s conceptual friend and foe. Am J Pathol. 174:1588–1593. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Greenblatt MS, Bennett WP, Hollstein M and Harris CC: Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res. 54:4855–4878. 1994.PubMed/NCBI

23 

Brosh R and Rotter V: When mutants gain new powers: news from the mutant p53 field. Nat Rev Cancer. 9:701–713. 2009.PubMed/NCBI

24 

Chen W, Zhang HL, Shao XJ, Jiang YG, Zhao XG, Gao X, Li JH, Liu BL and Sun MY: Gene expression profile of salivary adenoid cystic carcinoma associated with perinerual invasion. Tohoku J Exp Med. 212:319–334. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Chang CJ, Chao CH, Xia W, Yang JY, Xiong Y, Li CW, Yu WH, Rehman SK, Hsu JL, Lee HH and Hung MC: p53 regulates epithelial-mesenchymal transition and stem cell properties through modulating miRNAs. Nat Cell Biol. 13:317–323. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Tuschl T: Expanding small RNA interference. Nat Biotechnol. 20:446–448. 2002. View Article : Google Scholar : PubMed/NCBI

27 

Dong L, Ge XY, Wang YX, Yang LQ, Li SL, Yu GY, Gao Y and Fu J: Transforming growth factor-β and epithelial-mesenchymal transition are associated with pulmonary metastasis in adenoid cystic carcinoma. Oral Oncol. 49:1051–1058. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Zou W, Yang H, Hou X, Zhang W, Chen B and Xin X: Inhibition of CD147 gene expression via RNA interference reduces tumor cell invasion, tumorigenicity and increase chemosensitivity to paclitaxel in HO-8910pm cells. Cancer Lett. 248:211–218. 2007. View Article : Google Scholar

29 

Chen W, Zhang HL, Jiang YG, Li JH, Liu BL and Sun MY: Inhibition of CD146 gene expression via RNA interference reduces in vitro perineural invasion on ACC-M cells. J Oral Pathol Med. 38:198–205. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Wang L, Sun M, Jiang Y, Yang L, Lei D, Lu C, Zhao Y, Zhang P, Yang Y and Li J: Nerve growth factor and tyrosine kinase A in human salivary adenoid cystic carcinoma: expression patterns and effects on in vitro invasive behavior. J Oral Maxillofac Surg. 64:636–641. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Giono LE and Manfredi JJ: The p53 tumor suppressor participates in multiple cell cycle checkpoints. J Cell Physiol. 209:13–20. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Chen L, Park SM, Tumanov AV, Hau A, Sawada K, Feig C, Turner JR, Fu YX, Romero IL, Lengyel E and Peter ME: CD95 promotes tumour growth. Nature. 465:492–496. 2010. View Article : Google Scholar : PubMed/NCBI

33 

Eliyahu D, Michalovitz D, Eliyahu S, Pinhasi-Kimhi O and Oren M: Wild-type p53 can inhibit oncogene-mediated focus formation. Proc Natl Acad Sci USA. 86:8763–8767. 1989. View Article : Google Scholar : PubMed/NCBI

34 

Baker SJ, Markowitz S, Fearon ER, Willson JK and Vogelstein B: Suppression of human colorectal carcinoma cell growth by wild-type p53. Science. 249:912–915. 1990. View Article : Google Scholar : PubMed/NCBI

35 

Diller L, Kassel J, Nelson CE, Gryka MA, Litwak G, Gebhardt M, Bressac B, Ozturk M, Baker SJ, Vogelstein B, et al: p53 functions as a cell cycle control protein in osteosarcomas. Mol Cell Biol. 10:5772–5781. 1990.PubMed/NCBI

36 

Michalovitz D, Halevy O and Oren M: Conditional inhibition of transformation and of cell proliferation by a temperature-sensitive mutant of p53. Cell. 62:671–680. 1990. View Article : Google Scholar : PubMed/NCBI

37 

Martinez J, Georgoff I, Martinez J and Levine AJ: Cellular localization and cell cycle regulation by a temperature-sensitive p53 protein. Genes Dev. 5:151–159. 1991. View Article : Google Scholar : PubMed/NCBI

38 

Zhang WW, Fang X, Mazur W, French BA, Georges RN and Roth JA: High-efficiency gene transfer and high-level expression of wild-type p53 in human lung cancer cells mediated by recombinant adenovirus. Cancer Gene Ther. 1:5–13. 1994.PubMed/NCBI

39 

Roth JA, Nguyen D, Lawrence DD, Kemp BL, Carrasco CH, Ferson DZ, Hong WK, Komaki R, Lee JJ, Nesbitt JC, Pisters KM, Putnam JB, Schea R, Shin DM, Walsh GL, Dolormente MM, Han CI, Martin FD, Yen N, Xu K, Stephens LC, McDonnell TJ, Mukhopadhyay T and Cai D: Retrovirus-mediated wild-type p53 gene transfer to tumors of patients with lung cancer. Nat Med. 2:985–991. 1996. View Article : Google Scholar : PubMed/NCBI

40 

Shimada H, Matsubara H, Shiratori T, Shimizu T, Miyazaki S, Okazumi S, Nabeya Y, Shuto K, Hayashi H, Tanizawa T, Nakatani Y, Nakasa H, Kitada M and Ochiai T: Phase I/II adenoviral p53 gene therapy for chemoradiation resistant advanced esophageal squamous cell carcinoma. Cancer Sci. 97:554–561. 2006. View Article : Google Scholar : PubMed/NCBI

41 

Brown CJ, Lain S, Verma CS, Fersht AR and Lane DP: Awakening guardian angels: drugging the P53 pathway. Nat Rev Cancer. 9:862–873. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yang X, Jing D, Liu L, Shen Z, Ju J, Ma C and Sun M: Downregulation of p53 promotes in vitro perineural invasive activity of human salivary adenoid cystic carcinoma cells through epithelial-mesenchymal transition-like changes. Oncol Rep 33: 1650-1656, 2015.
APA
Yang, X., Jing, D., Liu, L., Shen, Z., Ju, J., Ma, C., & Sun, M. (2015). Downregulation of p53 promotes in vitro perineural invasive activity of human salivary adenoid cystic carcinoma cells through epithelial-mesenchymal transition-like changes. Oncology Reports, 33, 1650-1656. https://doi.org/10.3892/or.2015.3750
MLA
Yang, X., Jing, D., Liu, L., Shen, Z., Ju, J., Ma, C., Sun, M."Downregulation of p53 promotes in vitro perineural invasive activity of human salivary adenoid cystic carcinoma cells through epithelial-mesenchymal transition-like changes". Oncology Reports 33.4 (2015): 1650-1656.
Chicago
Yang, X., Jing, D., Liu, L., Shen, Z., Ju, J., Ma, C., Sun, M."Downregulation of p53 promotes in vitro perineural invasive activity of human salivary adenoid cystic carcinoma cells through epithelial-mesenchymal transition-like changes". Oncology Reports 33, no. 4 (2015): 1650-1656. https://doi.org/10.3892/or.2015.3750
Copy and paste a formatted citation
x
Spandidos Publications style
Yang X, Jing D, Liu L, Shen Z, Ju J, Ma C and Sun M: Downregulation of p53 promotes in vitro perineural invasive activity of human salivary adenoid cystic carcinoma cells through epithelial-mesenchymal transition-like changes. Oncol Rep 33: 1650-1656, 2015.
APA
Yang, X., Jing, D., Liu, L., Shen, Z., Ju, J., Ma, C., & Sun, M. (2015). Downregulation of p53 promotes in vitro perineural invasive activity of human salivary adenoid cystic carcinoma cells through epithelial-mesenchymal transition-like changes. Oncology Reports, 33, 1650-1656. https://doi.org/10.3892/or.2015.3750
MLA
Yang, X., Jing, D., Liu, L., Shen, Z., Ju, J., Ma, C., Sun, M."Downregulation of p53 promotes in vitro perineural invasive activity of human salivary adenoid cystic carcinoma cells through epithelial-mesenchymal transition-like changes". Oncology Reports 33.4 (2015): 1650-1656.
Chicago
Yang, X., Jing, D., Liu, L., Shen, Z., Ju, J., Ma, C., Sun, M."Downregulation of p53 promotes in vitro perineural invasive activity of human salivary adenoid cystic carcinoma cells through epithelial-mesenchymal transition-like changes". Oncology Reports 33, no. 4 (2015): 1650-1656. https://doi.org/10.3892/or.2015.3750
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team