OCT4 pseudogene 5 upregulates OCT4 expression to promote proliferation by competing with miR-145 in endometrial carcinoma

  • Authors:
    • Mingzhu Bai
    • Mu Yuan
    • Hong Liao
    • Jiazhou Chen
    • Binying Xie
    • Dong Yan
    • Xiaowei Xi
    • Xianming Xu
    • Zhenbo Zhang
    • Youji Feng
  • View Affiliations

  • Published online on: January 29, 2015     https://doi.org/10.3892/or.2015.3763
  • Pages: 1745-1752
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

OCT4 plays a critical role in the maintenance of stem cell pluripotency and proliferation, and is overexpressed in multiple human tumors, including endometrial cancer. OCT4 expression can be modulated by miR-145 and the OCT4 pseudogene 5 (OCT4-pg5), which share similar binding sites in the OCT4 3'-untranslated region. The goal of the present study was to evaluate the interaction between miR-145 and OCT4‑pg5 on OCT4 expression in endometrial cancer. We assessed OCT4-pg5 expression in 14 benign endometrium and 29 endometrial carcinoma samples. Furthermore, miR-145 mimic transfection was performed to explore its effect on OCT4-pg5 and OCT4 expression, and small interfering RNA (siRNA)-mediated knockdown of OCT4 was conducted to determine whether the effect of OCT4-pg5 on cellular growth was OCT4-dependent. We observed that OCT4-pg5 was abnormally activated in the endometrial carcinomas, and that overexpression of OCT4-pg5 contributed to enhanced cell proliferation and OCT4-PI3K/AKT-cyclin D1 signaling. Moreover, the miR-145 mimic depleted OCT4 expression, whereas elevated OCT4-pg5 restored OCT4 expression and OCT4-PI3K/AKT-cyclin D1 signaling. In conclusion, these data indicate that OCT4-pg5 can act as an RNA sponge to protect OCT4 transcripts from being inhibited by miR-145, providing novel insight into the control of OCT4 expression.

Introduction

Endometrial carcinoma is the fourth leading cause of cancer-related deaths in women worldwide, with an incidence of approximately 2.26% of the total newly occurring cases among females in 2008 (1). Surgery, chemotherapy, radiation and hormonal therapy are common types of treatment for patients with endometrial cancer (2). Since each patient may have a different genetic background and pathogenesis, identifying mechanistic differences at the molecular level will benefit the development of patient-specific therapies. Extensive research focusing on endometrial carcinoma has identified several molecules (e.g. PTEN, CA125 and CA199) that are associated with its initiation (35); however, its molecular pathogenesis has not been fully elucidated.

OCT4 is a member of the POU domain-containing family of transcription factors, that is primarily expressed in embryonic stem (ES) and primordial germ cells, playing an important role in maintaining pluripotency and self-renewal (610). It is also known that OCT4, together with three other reprogramming factors, is essential for generating induced pluripotent stem cells (11,12). Notably, OCT4 expression is closely related to the occurrence, development and metastasis of multiple tumors (1315), suggesting that OCT4 plays a critical role in carcinogenesis. Previously, we reported that aberrant expression of OCT4 in ovarian cancer was associated with cancer cell anti-apoptotic activity (16). It is known that OCT4 is overexpressed in endometrial carcinoma (17), although little is known concerning the function of OCT4 during endometrial carcinogenesis.

MicroRNAs (miRNAs) are small single-stranded RNAs which can suppress gene expression transcriptionally and post-transcriptionally. The effects of miRNAs are mediated by sequence-specific binding within the 3′-untranslated regions (UTRs) of cognate mRNA targets, typically resulting in the inhibition of translation or mRNA degradation (18). A recent study showed that the tumor-suppressive miRNA, miR-145, directly inhibited the pluripotency factors OCT4, SOX2 and KLF4 in ES cells, and that miR-145 inhibited the transcription of OCT4 by binding to its promoter (19), suggesting that it may play a critical role in OCT4 dysregulation in carcinogenesis (20).

In 2011, Salmena et al proposed the competing endogenous RNA (ceRNA) hypothesis, positing that certain RNAs (i.e. pseudogenes and long non-coding RNAs) regulate biological function by competing for miRNA binding (21). Prior to this hypothesis, pseudogenes were considered to be non-functional genomic sequences (22); however, it has subsequently been shown that many pseudogenes demonstrate biological activity by regulating their homologous genes in cells (23,24). More recent studies indicate that pseudogene transcripts can both regulate tumor oncogenes and suppressor genes by forming small interfering RNAs (siRNA) or reducing the concentration of miRNAs in cells (17,25,26). It has also been directly shown that pseudogenes can function as ceRNAs to regulate other RNA transcripts by competing for shared miRNAs (27). The OCT4 pseudogene 5 (OCT4-pg5) is truncated at the 5′-end and expresses only a partial open reading frame region followed by a 3′UTR. Furthermore, it is the target of miR-145 (27,28). Notably, Suo et al found that OCT4-pg5 was exclusively expressed in cancer tissues but not in normal tissues (15).

The goal of the present study was to determine the expression level of OCT4-pg5 in endometrial cancer, and explore the possibility that it acts as a ceRNA to regulate OCT4 expression, and activate the OCT4-mediated PI3K/AKT-cyclin D1 signaling pathway by competitively binding with miR-145.

Materials and methods

Reagents

The primary antibodies raised against OCT4 (ab19857), AKT (ab126811), PCNA (ab29), GAPDH (ab8245)and cyclin D1 (ab134175) were all purchased from Abcam (Cambridge Science Park, Cambridge, UK), and the anti-p-AKT (244F9) antibody was purchased from Cell Signaling Technology (Danvers, MA, USA). siRNA specifically targeting OCT4 (1027416) and negative control siRNA were obtained from Qiagen (Dusseldorf, Germany). The 3′UTR of OCT4-pg5 and OCT4 plasmids were constructed by GeneChem (Shanghai, China). The miRNA inhibitor negative control, miR-145 inhibitor (4464084), miRNA mimic negative control, and miR-145 mimic (4464066) were obtained from Ambion (Austin, TX, USA). Lipofectamine 2000, TRIzol reagent, antibiotics and antimycotics (Invitrogen, Grand Island, NY, USA); M-MLV reverse transcriptase (Promega, Madison, WI, USA), Dulbecco’s modified Eagle’s medium (DMEM), RPMI-1640, fetal bovine serum (FBS; Thermo Scientific, South Logan, UT, USA), SYBR-Green (Takara, Dalian, China) and PCR primers (Shanghai Sangon Biotech, Shanghai, China) were all commercially purchased.

Cell lines and tissue samples

The endometrial cancer cell lines Ishikawa, AN3CA, SPEC-2, HEC-1b, KLE and RL95–2 were maintained by our laboratory. Ishikawa, AN3CA, SPEC-2, HEC-1b and KLE cells were cultured in DMEM with 10% FBS. RL95-2 cells were cultured in RPMI-1640 medium with 10% FBS. All cell lines were maintained with 100 IU/ml penicillin and 100 μg/ml streptomycin in humidified 5% CO2 at 37°C. Fourteen samples of fresh human endometrium and 29 cases of cryopreserved endometrial carcinoma were obtained with informed consent from patients in the Shanghai First People’s Hospital of Jiaotong University (Shanghai, China). Half of the fresh endometrium samples were in the proliferative phase and the other half were in the secretory phase. All endometrial carcinoma tissues were diagnosed as endometrioid adenocarcinoma. The use of clinical specimens in the present study was approved by the Ethics Committee of Shanghai First People’s Hospital of Jiaotong University.

Transient transfection

Transfections were performed using Lipofectamine 2000 following the manufacturer’s instructions (Invitrogen). Briefly, the cells were seeded in 60-mm dishes at a density of 1×104 cells/well and cultured to 50–60% confluency. After serum starvation for 24 h, the double-stranded miR-145 mimic, inhibitor, OCT4 siRNA or plasmids were transfected into the cells with Lipofectamine 2000. Twenty four or 48 h later, the cells were collected for RNA and protein analysis. The sequences of the miR-145 mimic, inhibitor and OCT4 siRNA are listed in Table I.

Table I

MicroRNA and OCT4 siRNA sequences.

Table I

MicroRNA and OCT4 siRNA sequences.

NameSequence
hsa-miR-145 mimic GUCCAGUUUUCCCAGGAAUCCCUGGAUUCCUGGGAAAACUGGACUU
hsa-miR-145 inhibitor AGGGAUUCCUGGGAAAACUGGACCAGUACUUUUGUGUAGUACAA
OCT4 siRNA CAUGUGUAAGCUGCGGCCCTTGGGCCGCAGCUUACACAUGTT

[i] siRNA, small interfering RNA.

RNA isolation and real-time quantitative PCR

Total RNA was isolated using TRIzol reagent (Invitrogen) following the manufacturer’s recommendations. Complementary DNA was synthesized from 2.5 μg of total RNA with random primers and M-MLV reverse transcriptase in a 25-μl reaction system. The cDNA template (2 μl) was used in a 20-μl reaction volume with SYBR-Green for real-time PCR. GAPDH served as an internal normalization control. The PCR primers for OCT4, OCT4-pg5 and GAPDH are listed in Table II. Amplification was carried out for 38 cycles consisting of 15 sec at 95°C and 30 sec at 62.4°C for OCT4-pg5, and 64°C for OCT4, then 30 sec at 72°C. The 2−ΔΔCT method was used to determine relative gene expression levels, with the mRNA levels normalized to GAPDH expression. Each experiment was repeated in triplicate.

Table II

Target gene PCR primer sequences.

Table II

Target gene PCR primer sequences.

GeneSequenceAnnealing temperature (°C)
OCT4
 Forward primer 5′-TCCCTTCGCAAGCCCTCAT-3′64
 Reverse primer 5′-TGACGGTGCAGGGCTCCGGGGAGGCCCCATC-3′
Oct4-pg5
 Forward primer 5′-TTGCTGCAGAAGTGGGTGGAGGAAG-3′62.4
 Reverse primer 5′-GTACCAAAATGGGAGCCTGGGGC-3′
GAPDH
 Forward primer 5′-GCACCGTCAAGGCTGAGAAC-3′60
 Reverse primer 5′-TGGTGAAGACGCCAGTGGA-3′

[i] The primers of OCT4 and Oct4-pg5 above were designed by Suo et al (15).

Western blot analysis

Protein was isolated using cell lysis buffer supplemented with a protease and phosphatase inhibitor. Isolated protein (30 μg/lane) was separated on 10% sodium dodecyl sulfate-polyacrylamide gels, transferred to polyvinylidene fluoride membranes, and then blocked with 5% skimmed milk for 1 h. Membranes were incubated overnight with the primary antibodies (OCT4, 1:1,000; AKT, 1:1,000; PCNA, 1:1,000; GAPDH, 1:10,000 and cyclin D1 1:10,000). Antibody binding was revealed after incubation with an appropriate secondary antibody coupled to peroxidase by using enhanced chemiluminescence.

Cell proliferation assay

To assess cell proliferation, the cells were stained with sulforhodamine B (SRB). Briefly, the cells were trypsinized and seeded in 96-well plates for experimental assessment 24 h after transfection. The following day (d 0), 1 plate per day was washed twice with PBS and fixed in 10% trichloroacetic acid solution at 4°C. On day 5, all the plates were stained with 0.4% SRB for 30 min at room temperature, and rinsed with 1% acetic acid 4 times. After lysis with 10 mM Tris, the optical density (OD) of the cell lysates was measured at 490 nm using a microplate reader (Bio-Rad, Hercules, CA, USA). This experiment was performed in 96-well plates with 6 replicate wells at least 3 times.

Colony formation assay

After the cells were transfected with the plasmids or the miR-145 mimic, they were seeded at ~600 cells/well in a 6-well plate and cultured for 10 days. Following paraformaldehyde fixation and crystal violet staining, the stained cell colonies were counted. The experiment was carried out in triplicate wells and repeated 3 times.

Statistical analyses

Statistical analysis was performed using SPSS 21.0 (IBM, Armonk, NY, USA). All data are presented as mean ± standard deviation (SD). Statistical significance of the real-time PCR and cell growth assay was analyzed by the Student’s t-test. A P-value <0.05 was considered to indicate a statistically significant result.

Results

OCT4-pg5 is overexpressed in endometrial cancer and is directly targeted by miR-145

To investigate the relative expression level of OCT4-pg5 in endometrial cancer, real-time PCR was performed to assess its mRNA expression level (Fig. 1). OCT4-pg5 mRNA levels were significantly higher in the endometrial cancer samples compared to the level in the normal endometrial tissues (P<0.05). Further studies revealed that OCT4-pg5 expression was also significantly elevated in the endometrial cancer cell lines AN3CA, Ishikawa and KLE, with an upward trend in HEC-1B cells and no change in SPEC-2 cells, as compared to the expression level in the primary cultured endometrial cells (Fig. 2A). The elevated level of OCT4-pg5 in endometrial cancers suggests that it may play a functional role during carcinogenesis.

It has been previously reported that miR-145 can regulate OCT4 expression by targeting its 3′UTR in various cancer types (17,29). Given that OCT4-pg5 and miR-145 share a binding site within the OCT4 3′UTR (Fig. 3A), it was hypothesized that miR-145 may also target OCT4-pg5. In agreement with this hypothesis, it was observed that treatment with 30 nM with miR-145 mimic in Ishikawa cells resulted in a significant reduction in OCT4-pg5 expression, compared with the negative control group (Fig. 2B). On the other hand, treatment with a miR-145 inhibitor resulted in a potent increase in OCT4-pg5 expression, compared to the negative control (Fig. 2C).

OCT4 is directly targeted by miR-145

In order to confirm previous studies that miR-145 regulates OCT4 expression (17,29), OCT4 expression was assessed in the Ishikawa cells treated with 30 nM of the miR-145 mimic. The results showed a marked suppression in the OCT4 mRNA (Fig. 3B) and protein levels (Fig. 3D) in the cells treated with the miR-145 mimic, as compared to the levels in the negative control group. Conversely, treatment with the miR-145 inhibitor was associated with increased OCT4 mRNA (Fig. 3C) and protein expression levels (Fig. 3E), when compared with these levels in the inhibitor negative control. These data suggest that miR-145 regulates OCT4 expression via transcriptional inhibition in Ishikawa cells.

OCT4-pg5 functions as an antagonist against miR-145 binding to OCT4 to promote proliferation

The data presented above indicated that OCT4-pg5 may function as an antagonist against miR-145 binding with the OCT4 promoter in Ishikawa cells. To investigate this interaction, overexpression of OCT4-pg5 3′UTR was performed in Ishikawa cells (Fig. 4). It was observed that increasing the expression level of OCT4-pg5 3′UTR markedly elevated the OCT4 mRNA and protein levels in a dose-dependent manner (Fig. 4A). In terms of its biological function, our SRB assay showed that overexpression of the OCT4-pg5 3′UTR significantly accelerated cell proliferation (Fig. 4B) and increased the colony formation rate (Fig. 4C).

Given that miR-145 targets both OCT4 and OCT4-pg5, we investigated whether OCT4-pg5 regulates OCT4 expression by competitive binding with miR-145. As expected, OCT4-pg5-induced OCT4 expression was attenuated by treatment with the miR-145 mimic (Fig. 4D), which we attributed to reduced miR-145 mimic binding to the OCT4 3′UTR as a result of increasing miR-145 mimic absorption by elevated OCT4-pg5 3′UTR. We subsequently observed that the exogenous miR-145 mimic also inhibited OCT4-pg5-induced clone formation (Fig. 4E), although a similar proliferative profile was observed (Fig. 4F), suggesting that the miR-145 mimic only partly blocked the role of OCT4-pg5 3′UTR on proliferation. All things considered, these results imply that the increase in OCT4 expression and cell proliferation mediated by OCT4-pg5 overexpression was largely dependent on endogenous miR-145 expression in endometrial cancer. It also suggests that OCT4-pg5 functions as a competitive antagonist of miR-145 to protect OCT4 from being repressed by miR-145 in endometrial cancer.

OCT4-pg5-mediated Ishikawa cell proliferation is dependent on OCT4-PI3K/AKT-cyclin D1 signaling

To investigate whether OCT4-pg5-induced proliferation is dependent on the OCT4-PI3K/AKT-cyclin D1 signaling pathway in Ishikawa cells, the role of OCT4 on cellular growth and the effect of OCT4-pg5 3′UTR on this signaling pathway were studied. Similar to the effect of OCT4-pg5 overexpression described above (Fig. 4B), increased expression of OCT4 was associated with increased cell proliferation (Fig. 5A). Dissection of the OCT4-PI3K/AKT-cyclin D1 signaling pathway in these cells revealed that OCT4-pg5 3′UTR transfection resulted in increased protein expression levels of p-AKT, PCNA and cyclin D1 (Fig. 5B). To confirm that activation of the PI3K/AKT-cyclin D1 signaling pathway was mediated by OCT4, knockdown of OCT4 or overexpression of OCT4-pg5 3′UTR was performed (Fig. 5C and D). The results from these studies demonstrated that downregulation of p-AKT, PCNA and cyclin D1 by the miR-145 mimic was rescued by overexpression of OCT4-pg5, and their upregulation by OCT4-pg5 was blocked by OCT4 siRNA (Fig. 5D). Similarly, the increased cell proliferation induced by OCT4-pg5 3′UTR was also attenuated by OCT4 siRNA (Fig. 5C).

Discussion

The molecular mechanisms underlying the development of endometrial carcinoma have not been fully elucidated. Recently, OCT4 was observed to be aberrantly expressed in endometrial carcinoma, with a resultant association with malignancy (17,30,31). Aberrant OCT4 expression has also been detected in a broad spectrum of other cancers, including non-small cell lung cancer, hepatoma, breast and bladder cancer (3235). Indeed, it has been suggested that elevated expression of OCT4 contributes to cancer chemotherapy resistance, anti-apoptotic properties, proliferation and invasion (3639). Previously, we observed that OCT4 is over-expressed in ovarian carcinomas and inhibited FSH-induced apoptosis through enhancing stem cell-like cell expansion and signaling through the OCT4-AKT-survivin pathway (16). All things considered, these facts imply that OCT4 may be an important trigger in carcinogenesis. It has been reported that OCT4 expression is increased in endometrial cancer, that OCT4-induced cell growth was blocked by miR-145 through targeting its 3′UTR, and that OCT4 and miR-145 expression are inversely correlated (17). The goal of the present study was to investigate the factors affecting miR-145 and OCT4 in endometrial carcinogenesis.

OCT4 pseudogenes are reportedly overexpressed in various cancer types (15). In agreement with this notion, we observed markedly elevated OCT4-pg5 expression levels in primary endometrial carcinoma samples and several endometrial cancer cell lines. Indeed, consistent with Wu et al, we observed that upregulation of OCT4-pg5 was correlated with OCT4 expression (17). Furthermore, exogenous transfection of OCT4-pg5 3′UTR resulted in a dose-dependent increase in OCT4 at the mRNA and protein levels, suggesting that OCT4 is a target of OCT4-pg5, and that this pseudogene is a critical factor affecting OCT4-mediated carcinogenesis.

Our subsequent experiments were designed to gain a mechanistic insight into the role of OCT4-pg5, with special emphasis on miR-145. It is known that OCT4 can be transcriptionally activated by itself (40), and negatively regulated by miR-145 (19). Indeed, miR-145 is a well-known tumor-suppressor miRNA that is downregulated in numerous types of malignancies, including endometrial cancer (17,41). Poliseno et al previously suggested that OCT4 and its pseudogenes share a similar sequence and have conserved microRNA binding sites (27). In this regard, we confirmed by sequence alignment that there is a conserved miR-145 binding site in the OCT4 and OCT4-pg5 3′UTR. Furthermore, treatment with the miR-145 mimic potently inhibited both OCT4 and OCT4-pg5 expression, whereas its inhibitor sharply increased their expression levels. These data indicate that miR-145 is an important modulator of OCT4-pg5′s regulation of OCT4 expression.

All transcribed pseudogenes are theoretically capable of competing with cognate mRNAs for miRNA binding; however, a small percentage of pseudogenes could be processed into endogenous siRNAs to inhibit the expression of cognate genes through RNA interference (42). Ebert et al introduced the concept of ‘miRNA sponges’ as a means to create loss-of-function phenotypes for miRNAs in mammalian cells (43). Similarly, Poliseno et al found that the mammalian pseudogene PTENP1 could function as a ceRNA to regulate PTEN expression by competing for shared miRNAs with PTENP1 3′UTR, with a similar effect found between KRAS and its pseudogene KRAS1P (27). In the context of the present study, Wang et al reported that OCT4-pg4 functions as a natural microRNA sponge to regulate OCT4 expression by competing for miR-145 in hepatocellular carcinoma (44). Here, we observed that the inhibition of OCT4 expression by the miR-145 mimic could be reversed by overexpression of OCT4-pg5 3′UTR, indicating that exogenous OCT4-pg5 3′UTR ‘absorbed’ more miR-145, thereby preventing it from binding to the OCT4 3′UTR. These data are consistent with the hypothesis that OCT4-pg5 upregulates OCT4 expression by competing against miR-145 in endometrial cancer.

Our subsequent functional studies demonstrated that OCT4-pg5 promoted the cell proliferation and colony-forming ability in endometrial cancer, and that the negative effects of the miR-145 mimic on these parameters could be restored by OCT4-pg5. It was also observed that knockdown of OCT4 in Ishikawa cells resulted in a lower rate of cell proliferation, suggesting an oncogenic role for OCT4 in endometrial carcinogenesis. In our previous studies, the OCT4-PI3K/AKT-survivin signaling pathway was found to be involved in the development of ovarian cancer (16). Similarly, Hu et al showed that OCT4 may maintain the survival of cancer stem cell-like cells in murine 3LL and human MCF7 tumor cell lines partly through Oct4/Tcl1/Akt1 signaling, by inhibiting apoptosis (45). Wang et al also observed that OCT4 can mediate chemoresistance through a potential Oct4-AKT-ABCG2 pathway (36). Here, we demonstrated that overexpression of OCT4-pg5 increased the protein levels of cyclin D1 and PCNA and activated the PI3K/AKT signaling pathway. Nevertheless, OCT4-pg5-induced phosphorylation of AKT and the increase in cyclin D1 and PCNA were blocked by depletion of OCT4, as well as transfection with the miR-145 mimic, suggesting that activating OCT4-PI3K/AKT-cyclin D1 signaling is required for OCT4-pg5 to promote endometrial cancer proliferation by acting as a miR-145 antagonist.

This is the first study to investigate the relationship among OCT4-pg5, miR-145 and OCT4 expression in endometrial carcinogenesis. We observed that the OCT4-pg5 expression level was significantly higher in endometrial carcinoma tissues than in benign endometrial tissues. Our results demonstrate that OCT4-pg5 plays an essential role in miR-145-mediated endometrial carcinoma cell proliferation through regulation of OCT4 expression and the PI3K/AKT-cyclin D1 signaling pathway. These findings provide novel insight into the molecular mechanism of cell proliferation in endometrial carcinoma cells, and may help to reveal novel targets for the treatment of endometrial cancer.

Acknowledgements

The present study was supported by grants from The National Natural Science Foundation of China (NSFC nos. 81272883, 81202044, 81370074 and 81172478), The Science and Technology Commission of Shanghai Municipality (STCSM no. 12ZR1447600), The Shanghai Municipal Public Health Bureau (no. XYQ2013119), The Shanghai Jiaotong University (no. BXJ201339) and the grant of ‘Chenxin plan’ from Shanghai Jiaotong University for Z.Z.

References

1 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

2 

NCCN Practice Guidelines in Oncology. Uterine Neoplasms Version 1.2013. 2013, http://www.nccn.org/professionals/physician_gls/f_guidelines.asp#uterine.

3 

Cheng H, Liu P, Zhang F, et al: A genetic mouse model of invasive endometrial cancer driven by concurrent loss of Pten and Lkb1 is highly responsive to mTOR inhibition. Cancer Res. 74:15–23. 2014. View Article : Google Scholar :

4 

Daniilidou K, Frangou-Plemenou M, Grammatikakis J, Grigoriou O, Vitoratos N and Kondi-Pafiti A: Prognostic significance and diagnostic value of PTEN and p53 expression in endometrial carcinoma. A retrospective clinicopathological and immunohistochemical study. J BUON. 18:195–201. 2013.PubMed/NCBI

5 

Patsner B and Yim GW: Predictive value of preoperative serum CA-125 levels in patients with uterine cancer: the Asian experience 2000 to 2012. Obstet Gynecol Sci. 56:281–288. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Niwa H: Molecular mechanism to maintain stem cell renewal of ES cells. Cell Struct Funct. 26:137–148. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Niwa H, Miyazaki J and Smith AG: Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet. 24:372–376. 2000. View Article : Google Scholar : PubMed/NCBI

8 

Pesce M and Scholer HR: Oct-4: control of totipotency and germline determination. Mol Reprod Dev. 55:452–457. 2000. View Article : Google Scholar : PubMed/NCBI

9 

Pesce M and Scholer HR: Oct-4: gatekeeper in the beginnings of mammalian development. Stem Cells. 19:271–278. 2001. View Article : Google Scholar : PubMed/NCBI

10 

Pan GJ, Chang ZY, Schöler HR and Pei D: Stem cell pluripotency and transcription factor Oct4. Cell Res. 12:321–329. 2002. View Article : Google Scholar

11 

Yu J, Vodyanik MA, Smuga-Otto K, et al: Induced pluripotent stem cell lines derived from human somatic cells. Science. 318:1917–1920. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Takahashi K and Yamanaka S: Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126:663–676. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Wang YD, Cai N, Wu XL, Cao HZ, Xie LL and Zheng PS: OCT4 promotes tumorigenesis and inhibits apoptosis of cervical cancer cells by miR-125b/BAK1 pathway. Cell Death Dis. 4:e7602013. View Article : Google Scholar : PubMed/NCBI

14 

Monk M and Holding C: Human embryonic genes re-expressed in cancer cells. Oncogene. 20:8085–8091. 2001. View Article : Google Scholar

15 

Suo G, Han J, Wang X, et al: Oct4 pseudogenes are transcribed in cancers. Biochem Biophys Res Commun. 337:1047–1051. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Huang Y, Jin H, Liu Y, et al: FSH inhibits ovarian cancer cell apoptosis by up-regulating survivin and down-regulating PDCD6 and DR5. Endocr Relat Cancer. 18:13–26. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Wu Y, Liu S, Xin H, et al: Up-regulation of microRNA-145 promotes differentiation by repressing OCT4 in human endometrial adenocarcinoma cells. Cancer. 117:3989–3998. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Bartel DP: MicroRNAs: target recognition and regulatory functions. Cell. 136:215–233. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Xu N, Papagiannakopoulos T, Pan G, Thomson JA and Kosik KS: MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 137:647–658. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Hu J, Guo H, Li H, et al: MiR-145 regulates epithelial to mesenchymal transition of breast cancer cells by targeting Oct4. PLoS One. 7:e459652012. View Article : Google Scholar : PubMed/NCBI

21 

Salmena L, Poliseno L, Tay Y, Kats L and Pandolfi PP: A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146:353–358. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Petrov DA and Hartl DL: Pseudogene evolution and natural selection for a compact genome. J Hered. 91:221–227. 2000. View Article : Google Scholar : PubMed/NCBI

23 

Hirotsune S, Yoshida N, Chen A, et al: An expressed pseudogene regulates the messenger-RNA stability of its homologous coding gene. Nature. 423:91–96. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Korneev SA, Park JH and O’Shea M: Neuronal expression of neural nitric oxide synthase (nNOS) protein is suppressed by an antisense RNA transcribed from an NOS pseudogene. J Neurosci. 19:7711–7720. 1999.PubMed/NCBI

25 

Harrison PM, Zheng D, Zhang Z, Carriero N and Gerstein M: Transcribed processed pseudogenes in the human genome: an intermediate form of expressed retrosequence lacking protein-coding ability. Nucleic Acids Res. 33:2374–2383. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Han YJ, Ma SF, Yourek G, Park YD and Garcia JG: A transcribed pseudogene of MYLK promotes cell proliferation. FASEB J. 25:2305–2312. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Poliseno L, Salmena L, Zhang J, Carver B, Haveman WJ and Pandolfi PP: A coding-independent function of gene and pseudogene mRNAs regulates tumour biology. Nature. 465:1033–1038. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Pain D, Chirn GW, Strassel C and Kemp DM: Multiple retrop-seudogenes from pluripotent cell-specific gene expression indicates a potential signature for novel gene identification. J Biol Chem. 280:6265–6268. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Zhang S, Wu Y, Feng D, et al: miR-145 inhibits lung adenocarcinoma stem cells proliferation by targeting OCT4 gene. Zhongguo Fei Ai Za Zhi. 14:317–322. 2011.(In Chinese). PubMed/NCBI

30 

Mak VC, Siu MK, Wong OG, Chan KK, Ngan HY and Cheung AN: Dysregulated stemness-related genes in gynecological malignancies. Histol Histopathol. 27:1121–1130. 2012.PubMed/NCBI

31 

Zhou X, Zhou YP, Huang GR, et al: Expression of the stem cell marker, Nanog, in human endometrial adenocarcinoma. Int J Gynecol Pathol. 30:262–270. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Karoubi G, Gugger M, Schmid R and Dutly A: OCT4 expression in human non-small cell lung cancer: implications for therapeutic intervention. Interact Cardiovasc Thorac Surg. 8:393–397. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Huang PZ, Lu CL, Li BK, et al: OCT4 expression in hepatocellular carcinoma and its clinical significance. Chin J Cancer. 29:111–116. 2010.(In Chinese). View Article : Google Scholar

34 

Ezeh UI, Turek PJ, Reijo RA and Clark AT: Human embryonic stem cell genes OCT4, NANOG, STELLAR, and GDF3 are expressed in both seminoma and breast carcinoma. Cancer. 104:2255–2265. 2005. View Article : Google Scholar : PubMed/NCBI

35 

Xu K, Zhu Z and Zeng F: Expression and significance of Oct4 in bladder cancer. J Huazhong Univ Sci Technolog Med Sci. 27:675–677. 2007. View Article : Google Scholar

36 

Wang XQ, Ongkeko WM, Chen L, et al: Octamer 4 (Oct4) mediates chemotherapeutic drug resistance in liver cancer cells through a potential Oct4-AKT-ATP-binding cassette G2 pathway. Hepatology. 52:528–539. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Zhang Z, Zhu Y, Lai Y, et al: Follicle-stimulating hormone inhibits apoptosis in ovarian cancer cells by regulating the OCT4 stem cell signaling pathway. Int J Oncol. 43:1194–1204. 2013.PubMed/NCBI

38 

Li C, Yan Y, Ji W, et al: OCT4 positively regulates survivin expression to promote cancer cell proliferation and leads to poor prognosis in esophageal squamous cell carcinoma. PLoS One. 7:e496932012. View Article : Google Scholar : PubMed/NCBI

39 

Dai X, Ge J, Wang X, Qian X, Zhang C and Li X: OCT4 regulates epithelial-mesenchymal transition and its knockdown inhibits colorectal cancer cell migration and invasion. Oncol Rep. 29:155–160. 2013.

40 

Pei D: Regulation of pluripotency and reprogramming by transcription factors. J Biol Chem. 284:3365–3369. 2009. View Article : Google Scholar

41 

Slaby O, Svoboda M, Fabian P, et al: Altered expression of miR-21, miR-31, miR-143 and miR-145 is related to clinicopathologic features of colorectal cancer. Oncology. 72:397–402. 2007. View Article : Google Scholar

42 

Tam OH, Aravin AA, Stein P, et al: Pseudogene-derived small interfering RNAs regulate gene expression in mouse oocytes. Nature. 453:534–538. 2008. View Article : Google Scholar : PubMed/NCBI

43 

Ebert MS, Neilson JR and Sharp PA: MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat Methods. 4:721–726. 2007. View Article : Google Scholar : PubMed/NCBI

44 

Wang L, Guo ZY, Zhang R, Xin B, Chen R, Zhao J, Wang T, Wen WH, Jia LT, Yao LB and Yang AG: Pseudogene OCT4-pg4 functions as a natural micro RNA sponge to regulate OCT4 expression by competing for miR-145 in hepatocellular carcinoma. Carcinogenesis. 34:1773–1781. 2013. View Article : Google Scholar : PubMed/NCBI

45 

Hu T, Liu S, Breiter DR, Wang F, Tang Y and Sun S: Octamer 4 small interfering RNA results in cancer stem cell-like cell apoptosis. Cancer Res. 68:6533–6540. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

April-2015
Volume 33 Issue 4

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Bai M, Yuan M, Liao H, Chen J, Xie B, Yan D, Xi X, Xu X, Zhang Z, Feng Y, Feng Y, et al: OCT4 pseudogene 5 upregulates OCT4 expression to promote proliferation by competing with miR-145 in endometrial carcinoma. Oncol Rep 33: 1745-1752, 2015.
APA
Bai, M., Yuan, M., Liao, H., Chen, J., Xie, B., Yan, D. ... Feng, Y. (2015). OCT4 pseudogene 5 upregulates OCT4 expression to promote proliferation by competing with miR-145 in endometrial carcinoma. Oncology Reports, 33, 1745-1752. https://doi.org/10.3892/or.2015.3763
MLA
Bai, M., Yuan, M., Liao, H., Chen, J., Xie, B., Yan, D., Xi, X., Xu, X., Zhang, Z., Feng, Y."OCT4 pseudogene 5 upregulates OCT4 expression to promote proliferation by competing with miR-145 in endometrial carcinoma". Oncology Reports 33.4 (2015): 1745-1752.
Chicago
Bai, M., Yuan, M., Liao, H., Chen, J., Xie, B., Yan, D., Xi, X., Xu, X., Zhang, Z., Feng, Y."OCT4 pseudogene 5 upregulates OCT4 expression to promote proliferation by competing with miR-145 in endometrial carcinoma". Oncology Reports 33, no. 4 (2015): 1745-1752. https://doi.org/10.3892/or.2015.3763