Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
July-2015 Volume 34 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2015 Volume 34 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway

  • Authors:
    • Jiyi Xia
    • Xiaolan Yu
    • Li Tang
    • Gang Li
    • Tao He
  • View Affiliations / Copyright

    Affiliations: Research Center for Drug and Functional Food, Luzhou Medical College, Luzhou, Sichuan 646000, P.R. China, Department of Obstetrics and Gynecology, The Affiliated TCM Hospital of Luzhou Medical College, Luzhou, Sichuan 646000, P.R. China, Experimental Medicine Center, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000, P.R. China, Department of Pediatrics, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000, P.R. China, Department of Biochemistry, Luzhou Medical College, Luzhou, Sichuan 646000, P.R. China
  • Pages: 103-110
    |
    Published online on: May 13, 2015
       https://doi.org/10.3892/or.2015.3979
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Purinergic signaling has been implicated in the regulation of many cellular processes. A high concentration of ATP has been observed in the tumor microenvironment, suggesting a possible role of extracellular ATP in tumor progression. The P2X7 receptor, which belongs to the ligand-gated ion channel receptor family, is involved in tumor development and metastasis. In the present study, we found that extracellular ATP stimulated the invasion and migration of human T47D breast cancer cells, in a dose-dependent manner. BzATP (ATP analogue), but not ADP, also promoted invasion and migration. We further found that the P2X7 receptor was highly expressed in the T47D cells. After knockdown of the P2X7 receptor, ATP-stimulated invasion and migration were markedly inhibited. Moreover, activation of the P2X7 receptor by ATP downregulated the protein level of E-cadherin and upregulated the production of MMP-13. In addition, ATP time-dependently induced the activation of AKT via the P2X7 receptor, and the AKT pathway was required for the ATP-mediated invasion and migration. Taken together, our results revealed that activation of the P2X7 receptor by ATP promotes breast cancer cell invasion and migration, possibly via activation of the AKT pathway and regulation of E-cadherin and MMP-13 expression. Therefore, the P2X7 receptor may be a useful therapeutic target for the treatment of breast cancer.

Introduction

Purinergic signaling acts as an important pathway in the regulation of cell growth, differentiation and development (1). Extracellular ATP, which is widely distributed in the tumor microenvironment, has been reported to be involved in the progression of cancer (2). ATP acts through P2 receptors, which are further categorized as P2X and P2Y receptors. P2Y receptors belong to the G-protein coupled receptors, while P2X receptors belong to the ligand-gated ion channel receptors. To date, seven P2X receptor subtypes (P2X1-7) and eight P2Y receptor subtypes (P2Y1, P2Y2, P2Y4, P2Y6, P2Y11, P2Y12, P2Y13 and P2Y14) have been cloned in human cells (3). As one subtype of the P2X receptors, the P2X7 receptor has been found to be highly expressed in many types of cancers, such as acute myelogenous leukemia (AML), acute lymphoblastic leukemia (ALL), chronic myelogenous leukemia (CML) and thyroid papillary cancer (4,5). However, the level of the P2X7 receptor is low in tissues of complex hyperplasia with atypia or in endometrial adenocarcinoma and uterine epithelial cancer (6,7).

Breast cancer is one of the most common cancers among women worldwide. Advancements in treatment including surgery, chemotherapy and radiotherapy have increased the overall survival rate of breast cancer patients (8). However, invasion and metastasis remain the major reasons for breast cancer-related mortality (9). One study reported that P2X7 receptor activation participated in the SK3 channel- and cystein cathepsin-dependent cancer cell invasiveness in MDA-MB-435s breast cancer cells (10), but the role of the P2X7 receptor in breast cancer cell invasion and metastasis requires further clarification.

In the present study, we identified that P2X7 receptor activation via extracellular ATP promoted the invasion and migration of T47D breast cancer cells. We also elucidated the function of the AKT pathway in the P2X7-mediated cell invasion and migration.

Materials and methods

Reagents

ATP, BzATP, ADP, P2X inhibitor APPDS and AKT inhibitor LY294002 were obtained from Sigma Chemical Co. (St. Louis, MO, USA). Antibodies to E-cadherin and β-actin were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies to phospho-AKT and AKT were obtained from Cell Signaling Technology (Danvers, MA, USA).

Cell culture

Human T47D breast cancer cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and were maintained in RPMI-1640 medium, supplemented with 10% fetal bovine serum (FBS), 100 mg/ml streptomycin, 100 U/ml penicillin and 2 mM L-glutamine. Cells were grown at 37°C in a humidified atmosphere of 95% air and 5% CO2.

Transwell invasion assay

A 24-well cell culture Transwell chamber (Corning Costar, San Diego, CA, USA) was used to analyze the cell invasion capacity. The filters of the upper inserts were coated with Matrigel before being used. The upper inserts were seeded with 1×105 cells/200 µl in RPMI-1640 medium and the lower inserts were filled with RPMI-1640 medium, supplemented with 20% FBS. After stimulation with different nucleotides (ATP, BzATP or ADP), the cells that invaded through the Matrigel and filters were fixed with methanol, and the nuclei were labeled with 4′,6-diamidino-2-phenylindole (DAPI). Nuclei were counted using immunofluorescence microscopy (Nikon, Tokyo, Japan) at ×200 magnification.

Transwell migration assay

Cell migration capacity was also determined using 24-well cell culture Transwell chambers (Corning Costar). Briefly, the upper inserts were seeded with 5×105 cells/200 µl in RPMI-1640 medium, and the lower inserts were filled with RPMI-1640 medium supplemented with 20% FBS as a chemoattractant. The cells were stimulated with or without the different nucleotides (ATP, BzATP or ADP). After an 18-h incubation at 37°C, the migrated cells were fixed with methanol, and the nuclei were labeled with DAPI. Finally, the nuclei were counted in seven random fields using immunofluo-rescence microscopy (Nikon) at ×200 magnification.

RNA extraction, reverse transcription and real-time PCR

Total RNA was isolated from the T47D cells by TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Then 2 µg of RNA was reverse-transcribed into cDNA using the cDNA synthesis kit (Tiangen Biotech Co., Ltd., Beijing, China). Real-time PCR was performed with a SYBR-Green PCR kit (Tiangen Biotech) and the primers are listed in Table I. The fold-change in the expression of each objective gene relative to β-actin was calculated based on the 2−ΔΔCt method.

Table I

Real-time PCR primers.

Table I

Real-time PCR primers.

GeneSequence (5′-3′)
P2X1 GGCTGACTACGTCTTCCCAG
GCGCAGTAGCCTTGAGTCT
P2X2 AGCTGGGCTTTATCGTGGAGA
TTGGGGTTGCACTCCGATG
P2X3 AGTCGGTGGTTGTGAAGAGC
AGCCTTCTCGTGCAAGAAAAC
P2X4 CTACCAGGAAACTGACTCCGT
GGTATCACATAATCCGCCACAT
P2X5 CTGTCGCTGTTCGACTACAAG
CCCATACGACCAGGTACGC
P2X6 GAACCCCAGTTTTCCATCATCA
GGCGTCACAAGGAAGTTGGT
P2X7 TATGAGACGAACAAAGTCACTCG
GCAAAGCAAACGTAGGAAAAGAT
MMP-13 ACTGAGAGGCTCCGAGAAATG
GAACCCCGCATCTTGGCTT
β-actin AGCGCGGCTACAGCTTCA
CGTAGCACAGCTTCTCCTTAAT
Small interfering RNA transfection

A P2X7 siRNA (siP2X7) was purchased from Shanghai Genechem Co., Ltd. (Shanghai, China), with the sequence of 5′-CCGAGAAACAGGCGAUAAU-3′. A scramble sequence not targeting any known gene was used as a control siRNA (siCtrl). T47D cells were plated in 24-well plates at the density of 1×104 cells/ml. Six hours later, the cells were transfected with siP2X7 or siCtrl using Lipofectamine 2000 (Invitrogen). After 36 h of transfection, real-time PCR was performed to assess the knockdown efficiency.

Western blot analysis

The cells were stimulated with or without the different nucleotides (ATP, BzATP or ADP) for various times, and the inhibitors were applied 30 min before ATP stimulation when the inhibitors were used. The cells were lysed in ice-cold RIPA buffer containing protease and phosphatase inhibitors (Applygen Technologies Inc., Beijing, China). Protein concentrations were determined with the BCA protein assay kit (Applygen Technologies). Then fifty micrograms of proteins were separated on 10% SDS gel electrophoresis and transferred to a PVDF membrane. After blocking with 5% BSA in buffered saline, the membrane was further probed with primary antibodies overnight at 4°C, and then incubated with the secondary antibodies for 1 h at room temperature. The immunoreactive bands were detected using ECL reagents (Applygen Technologies).

ELISA assay

After stimulation with or without ATP, the supernatant was collected and centrifuged at 10,000 × g for 15 min at 4°C. The MMP-13 ELISA kit was purchased from Invitrogen (Carlsbad, CA, USA) and used to measure the protein level of MMP-13, according to the manufacturer’s instructions.

Analysis of data

Experiments were repeated at least three times. Data are expressed as the means ± SD, and were analyzed using the Student’s t-test. Statistical significance is indicated when P<0.05.

Results

Extracellular ATP promotes the invasion and migration of breast cancer cells

To determine the effect of ATP on the invasion and migration of breast cancer cells, we performed Transwell invasion and migration assays in the T47D cells. The results showed that ATP produced a concentration-dependent (100–300 µM) increase in the invasion and migration capacities of the T47D cells, with a maximal effect occurring at 200 µM (Fig. 1A and B). Therefore, subsequent experiments were carried out using 200 µM. Furthermore, the ATP analogue BzATP also promoted the invasion and migration of the T47D cells. However, ADP had little effect on the invasion and migration (Fig. 1C and D). Together, these data suggest that extracellular ATP promotes the invasion and migration of breast cancer cells.

Figure 1

Effect of purinergic nucleotides on breast cancer cell invasion and migration. Human breast cancer T47D cells were stimulated with different concentrations of ATP. (A) Effect of ATP on the invasion of T47D cells after an 18-h incubation with ATP. (B) Effect of ATP on the migration of T47D cells after an 18-h incubation with ATP. (C) Invasion of T47D cells was observed after an 18-h incubation with ATP (200 µM), BzATP (200 µM) or ADP (200 µM). (D) Migration of T47D cells was observed after an 18-h incubation with ATP (200 µM), BzATP (200 µM) or ADP (200 µM); *P<0.05, compared with the controls.

Effect of P2X7 receptor activation on the invasion and migration of breast cancer cells

Next, we found that PPADS (100 µM), a non-selective P2X receptor antagonist, attenuated the ATP-induced invasion and migration of the T47D cells (Fig. 2A and B). Seven P2X receptor subtypes (P2X1-7) have been cloned in human cells, and the P2X7 receptor has been reported to play an important role in tumor progression (11). Using real-time PCR, we found that the P2X7 receptor was significantly expressed in the T47D cells (Fig. 2C). Thus, we silenced the expression of P2X7 receptor in the T47D cells by transfection of siRNA (Fig. 2D), and then investigated the effect of P2X7 knockdown on cell invasion and migration. We found that knockdown of the P2X7 receptor markedly inhibited the invasion and migration of the T47D cells promoted by ATP stimulation (Fig. 2E and F), indicating the involvement of the P2X7 receptor in breast cancer cell invasion and migration.

Figure 2

Involvement of the P2X7 receptor in ATP-mediated breast cancer cell invasion and migration. (A and B) T47D cells were pretreated with PPADS (P2X7 inhibitor, 100 µM) for 30 min, and then stimulated with or without ATP. Cell invasion and migration abilities were determined by Transwell invasion and migration assays. (C) The mRNA expression level of P2X receptor subtypes (P2X1-7) were detected by real-time PCR. (D) T47D cells were transfected with control siRNA (siCtrl) or P2X7 siRNA (siP2X7), and knockdown efficiency was examined by real-time PCR. (E) Effect of P2X7 receptor knockdown on ATP-induced invasion of T47D cells. (F) Effect of P2X7 receptor knockdown on ATP-induced migration of T47D cells; *P<0.05.

Activation of the P2X7 receptor affects the levels of E-cadherin and MMP-13

E-cadherin is essential for tumor invasion and metastasis (12). Using western blot analysis, we found that ATP and its analogue BzATP downregulated the protein level of E-cadherin in the T47D cells, whereas ADP did not affect the protein level of E-cadherin (Fig. 3A). MMP-13 plays an important role in tumor invasion. In the present study, real-time PCR and ELISA assay showed that ATP and its analogue BzATP increased the expression and secretion of MMP-13 in the T47D cells. However, ADP did not affect the production of MMP-13 (Fig. 3B and C).

Figure 3

P2X7 receptor activation participates in the regulation of E-cadherin and MMP-13 expression in breast cancer cells. (A) T47D cells were incubated with ATP (200 µM), BzATP (200 µM) or ADP (200 µM) for 18 h, and the protein level of E-cadherin was detected by western blot analysis. (B) T47D cells were incubated with ATP (200 µM), BzATP (200 µM) or ADP (200 µM) for 18 h, and the mRNA level of MMP-13 was detected by real-time PCR. (C) T47D cells were incubated with ATP (200 µM), BzATP (200 µM) or ADP (200 µM) for 18 h, and the secretion of MMP-13 was detected by ELISA assay; *P<0.05.

Extracellular ATP regulates the expression of E-cadherin and MMP-13 via the P2X7 receptor

As shown in Fig. 4A, after stimulation of ATP, the expression of E-cdherin was decreased in the control siRNA (siCtrl) cells. However, the expression of E-cadherin did not show any change in the P2X7 siRNA (siP2X7) cells stimulated with ATP. Furthermore, ATP increased the expression and secretion of MMP-13 in the siCtrl cells, whereas ATP stimulation had little effect on MMP-13 production in the siP2X7 cells (Fig. 4B and C). These findings imply that activation of the P2X7 receptor by ATP decreases the expression level of E-cadherin and MMP-13 in breast cancer cells.

Figure 4

Effect of P2X7 receptor knockdown on E-cadherin and MMP-13 expression. (A) Western blot analysis showing the protein level of E-cadherin upon ATP stimulation for 18 h in the siCtrl or siP2X7 cells. (B) Real-time PCR and (C) ELISA assay showing the expression and secretion of MMP-13 upon ATP stimulation for 18 h in the siCtrl or siP2X7 cells; *P<0.05.

Activation of the P2X7 receptor by ATP induces the AKT pathway in breast cancer cells

AKT, a pivotal kinase in the cell signaling pathway, participates in tumor metastasis and development (13). Therefore, we examined whether ATP could stimulate the activation of the AKT pathway in breast cancer cells. As shown in Fig. 5A, ATP (200 µM) time-dependently stimulated a marked increase in the level of phosphorylated AKT in the T47D cells, and peak activation occurred at 30 min. Moreover, western blot analysis showed that the ATP-induced activation of AKT was greatly inhibited after knockdown of the P2X7 receptor (Fig. 5B), suggesting that the P2X7 receptor contributes to the ATP-induced activation of the AKT pathway in breast cancer cells.

Figure 5

ATP activates the AKT pathway through the P2X7 receptor. (A) T47D cells were stimulated with 200 µM ATP for 5, 15, 30, 60 or 90 min, and the level of phosphorylated AKT was detected by western blot analysis. (B) Western blot analysis showing the level of phosphorylated AKT upon ATP stimulation for 30 min in the siCtrl or siP2X7 cells; *P<0.05.

Effect of the AKT pathway on P2X7-mediated invasion and migration

To determine whether the P2X7 receptor-stimulated cell invasion and migration are mediated through the AKT pathway, T47D cells were pretreated with 10 mM LY294002 for 30 min before ATP stimulation. Transwell invasion and migration assays showed that LY294002 inhibited the cell invasion and migration induced by ATP (Fig. 6A and B). These data confirm that the AKT pathway is required for the invasion and migration induced by ATP.

Figure 6

Role of the AKT pathway in ATP-induced breast cancer cell invasion and migration. T47D cells were pretreated with LY294002 (AKT inhibitor, 10 mM). (A and B) To assess the invasion and migration abilities, T47D cells were stimulated with or without ATP, and then subjected to Transwell invasion and migration assays; *P<0.05.

Effect of the AKT pathway on P2X7-mediated expression changes of E-cadherin and MMP-13

Western blot analysis showed that ATP stimulation decreased the protein level of E-cadherin in the DMSO-treated cells, whereas the effect of ATP on E-cadherin expression was attenuated in the LY294002-treated cells (Fig. 7A). Furthermore, real-time PCR and ELISA assay showed that ATP stimulation increased the expression and secretion of MMP-13 in the DMSO-treated cells, while in the LY294002-treated cells, this effect was significantly attenuated (Fig. 7B and C).

Figure 7

Role of the AKT pathway in the ATP-mediated expression changes of E-cadherin and MMP-13 in breast cancer cells. T47D cells were pretreated with LY294002 (AKT inhibitor, 10 mM). (A) To assess the E-cadherin protein level, T47D cells were stimulated with or without ATP for 18 h, and then subjected to western blot analysis. (B) To assess the MMP-13 mRNA level, T47D cells were stimulated with or without ATP for 18 h, and then subjected to real-time PCR. (C) To assess the MMP-13 protein level, T47D cells were stimulated with or without ATP for 18 h, and then subjected to ELISA assay; *P<0.05.

Discussion

Many reports have proved the important functions of purinergic signaling in tumor progression. In the present study, we examined the capability of P2X7 receptor activation to induce breast cancer cell invasion and migration. We found that ATP and its analogue BzATP stimulated the invasion and migration of human breast cancer T47D cells. P2X receptor inhibitor PPADS suppressed the ATP-mediated cell invasion and migration. Furthermore, knockdown of the P2X7 receptor inhibited the invasion and migration stimulated by ATP. Altogether, our data suggest that activation of the P2X7 receptor by ATP contributes to the invasion and migration of breast cancer cells.

Previously, studies have found that extracellular ATP stimulation leads to a decrease in the growth of tumor cells (14). Further studies showed that ATP participates in tumor motility, invasion and metastasis (15,16). In the present study, we found that ATP dose-dependently increased the invasion and migration of T47D cells. We further found that BzATP also stimulated cell invasion and migration, whereas ADP stimulation did not affect the invasion and migration of T47D cells, confirming the involvement of ATP in regulating breast cancer cell invasion and migration. ATP functions via P2 receptors, which are divided into P2X and P2Y receptors. In the present study, we found that the P2X receptor inhibitor PPADS could greatly suppress the ATP-induced cell invasion and migration, suggesting that P2X receptors may participate in the invasion and migration of breast cancer cells. There are seven P2X receptor subtypes (P2X1-7) that have been cloned in human cells. Using real-time PCR, we found that the P2X7 receptor was significantly expressed in the T47D cells. Studies have reported that expression of the P2X7 receptor is elevated in thyroid papillary cancer, and is closely associated with poor prognostic factors and lymph node metastasis (4,17,18). It was reported that activation of the P2X7 receptor increased the growth of B16 melanoma cells in vitro and in vivo (19,20) and influenced the motile activity of lung cancer cells (21). Jelassi et al (10) found that P2X7 receptor activation enhanced SK3 channel- and cystein cathepsin-dependent cancer cell invasiveness of MDA-MB-435s breast cancer cells. In the present study, we found that the knockdown of the P2X7 receptor inhibited the ATP-mediated invasion and migration of T47D cells, further confirming that P2X7 receptor activation promotes breast cancer cell invasion and migration.

Epithelial-mesenchymal transition (EMT) is essential for the invasion and metastasis of breast cancer cells (22). Davis et al (23) showed that ATP stimulated the expression of vimentin in MDA-MB-468 breast cancer cells, and Li et al (15) further found that ATP increased the protein levels of E-cadherin and Snail in prostate cancer cells, suggesting that ATP may affect the EMT process in tumor cells. E-cadherin, which is an important EMT-related marker in tumors, regulates cell-cell adhesion and is often weakly expressed in tumor cells (24). In the present study, we found that ATP and its analogue BzATP downregulated the expression of E-cadherin, but ADP had little effect on the expression of E-cadherin in breast cancer cells. Using siRNA technology, we confirmed that ATP stimulation decreased the protein level of E-cadherin via the P2X7 receptor.

A member of the metalloproteinases (MMPs), MMP-13 plays a key role in regulating tumor invasion and metastasis. Many studies have reported that MMP-13 contributes to the bone metastasis of breast cancer (25,26). It was reported that extracellular ATP stimulated MMP-13 mRNA expression in DU-145 prostate cancer cells (27). However, there is no report concerning the effect of the P2X7 receptor on MMP-13 expression. Here, we found that activation of the P2X7 receptor by ATP promoted the expression and secretion of MMP-13 in breast cancer cells.

Many intracellular signaling pathways can be activated by the P2X7 receptor. Studies have confirmed that activation of the P2X7 receptor enhanced the proliferation of ovarian carcinoma cells via the AKT and ERK1/2 pathways (28), and mediated tumor cell death via PI3K/AKT and AMPK-PRAS40-mTOR signaling pathways (29). In the present study, we found that activation of the P2X7 receptor by ATP time-dependently induced the AKT pathway in the T47D cells. It is well known that the AKT pathway plays a vital role in tumor progression (30). The present study showed that blocking of the AKT pathway attenuated the effect of ATP on the invasion and migration in T47D cells. We further identified that inhibition of the AKT pathway suppressed the changes in P2X7-mediated E-cadherin and MMP-13 expression. These data indicate that activation of the P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway.

In conclusion, the present study demonstrated that ATP stimulation promotes the invasion and migration of breast cancer cells via activation of the P2X7 receptor. The function of the P2X7 receptor may be triggered by activation of the AKT pathway and subsequent regulation of E-cadherin and MMP-13 expression. Thus, the P2X7 receptor could act as a new target for the anticancer therapy of breast cancer.

Acknowledgments

The present study was supported by a grant from the Luzhou Administration of Science and Technology, no. 2014-S-44(5/8).

References

1 

Burnstock G: Purinergic signalling: Pathophysiology and therapeutic potential. Keio J Med. 62:63–73. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Braganhol E, Wink MR, Lenz G and Battastini AM: Purinergic signaling in glioma progression. Adv Exp Med Biol. 986:81–102. 2013. View Article : Google Scholar

3 

Burnstock G: Introduction: P2 receptors. Curr Top Med Chem. 4:793–803. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Solini A, Cuccato S, Ferrari D, Santini E, Gulinelli S, Callegari MG, Dardano A, Faviana P, Madec S, Di Virgilio F, et al: Increased P2X7 receptor expression and function in thyroid papillary cancer: A new potential marker of the disease? Endocrinology. 149:389–396. 2008. View Article : Google Scholar

5 

Zhang XJ, Zheng GG, Ma XT, Yang YH, Li G, Rao Q, Nie K and Wu KF: Expression of P2X7 in human hematopoietic cell lines and leukemia patients. Leuk Res. 28:1313–1322. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Li X, Qi X, Zhou L, Catera D, Rote NS, Potashkin J, Abdul-Karim FW and Gorodeski GI: Decreased expression of P2X7 in endometrial epithelial pre-cancerous and cancer cells. Gynecol Oncol. 106:233–243. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Li X, Zhou L, Feng YH, Abdul-Karim FW and Gorodeski GI: The P2X7 receptor: A novel biomarker of uterine epithelial cancers. Cancer Epidemiol Biomarkers Prev. 15:1906–1913. 2006. View Article : Google Scholar : PubMed/NCBI

8 

DeSantis C, Ma J, Bryan L and Jemal A: Breast cancer statistics, 2013. CA Cancer J Clin. 64:52–62. 2014. View Article : Google Scholar

9 

Hanahan D and Weinberg RA: Hallmarks of cancer: The next generation. Cell. 144:646–674. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Jelassi B, Chantôme A, Alcaraz-Pérez F, Baroja-Mazo A, Cayuela ML, Pelegrin P, Surprenant A and Roger S: P2X(7) receptor activation enhances SK3 channels- and cystein cathepsin-dependent cancer cells invasiveness. Oncogene. 30:2108–2122. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Sun SH: Roles of P2X7 receptor in glial and neuroblastoma cells: The therapeutic potential of P2X7 receptor antagonists. Mol Neurobiol. 41:351–355. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Canel M, Serrels A, Frame MC and Brunton VG: E-cadherin-integrin crosstalk in cancer invasion and metastasis. J Cell Sci. 126:393–401. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Sheng S, Qiao M and Pardee AB: Metastasis and AKT activation. J Cell Physiol. 218:451–454. 2009. View Article : Google Scholar

14 

Yang G, Zhang S, Zhang Y, Zhou Q, Peng S, Zhang T, Yang C, Zhu Z and Zhang F: The inhibitory effects of extracellular ATP on the growth of nasopharyngeal carcinoma cells via P2Y2 receptor and osteopontin. J Exp Clin Cancer Res. 33:532014. View Article : Google Scholar : PubMed/NCBI

15 

Li WH, Qiu Y, Zhang HQ, Liu Y, You JF, Tian XX and Fang WG: P2Y2 receptor promotes cell invasion and metastasis in prostate cancer cells. Br J Cancer. 109:1666–1675. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Shi K, Queiroz KC, Stap J, Richel DJ and Spek CA: Protease-activated receptor-2 induces migration of pancreatic cancer cells in an extracellular ATP-dependent manner. J Thromb Haemost. 11:1892–1902. 2013.PubMed/NCBI

17 

Gu LQ, Li FY, Zhao L, Liu Y, Chu Q, Zang XX, Liu JM, Ning G and Zhao YJ: Association of XIAP and P2X7 receptor expression with lymph node metastasis in papillary thyroid carcinoma. Endocrine. 38:276–282. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Kwon JH, Nam ES, Shin HS, Cho SJ, Park HR and Kwon MJ: P2X7 receptor expression in coexistence of papillary thyroid carcinoma with Hashimoto’s thyroiditis. Korean J Pathol. 48:30–35. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Adinolfi E, Raffaghello L, Giuliani AL, Cavazzini L, Capece M, Chiozzi P, Bianchi G, Kroemer G, Pistoia V and Di Virgilio F: Expression of P2X7 receptor increases in vivo tumor growth. Cancer Res. 72:2957–2969. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Hattori F, Ohshima Y, Seki S, Tsukimoto M, Sato M, Takenouchi T, Suzuki A, Takai E, Kitani H, Harada H, et al: Feasibility study of B16 melanoma therapy using oxidized ATP to target purinergic receptor P2X7. Eur J Pharmacol. 695:20–26. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Takai E, Tsukimoto M, Harada H and Kojima S: Autocrine signaling via release of ATP and activation of P2X7 receptor influences motile activity of human lung cancer cells. Purinergic Signal. 10:487–497. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Wang Y and Zhou BP: Epithelial-mesenchymal transition in breast cancer progression and metastasis. Chin J Cancer. 30:603–611. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Davis FM, Kenny PA, Soo ET, van Denderen BJ, Thompson EW, Cabot PJ, Parat MO, Roberts-Thomson SJ and Monteith GR: Remodeling of purinergic receptor-mediated Ca2+ signaling as a consequence of EGF-induced epithelial-mesenchymal transition in breast cancer cells. PLoS One. 6:e234642011. View Article : Google Scholar

24 

Paredes J, Figueiredo J, Albergaria A, Oliveira P, Carvalho J, Ribeiro AS, Caldeira J, Costa AM, Simões-Correia J, Oliveira MJ, et al: Epithelial E- and P-cadherins: Role and clinical significance in cancer. Biochim Biophys Acta. 1826:297–311. 2012.PubMed/NCBI

25 

Morrison C, Mancini S, Cipollone J, Kappelhoff R, Roskelley C and Overall C: Microarray and proteomic analysis of breast cancer cell and osteoblast co-cultures: Role of osteoblast matrix metalloproteinase (MMP)-13 in bone metastasis. J Biol Chem. 286:34271–34285. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Pivetta E, Scapolan M, Pecolo M, Wassermann B, Abu-Rumeileh I, Balestreri L, Borsatti E, Tripodo C, Colombatti A and Spessotto P: MMP-13 stimulates osteoclast differentiation and activation in tumour breast bone metastases. Breast Cancer Res. 13:R1052011. View Article : Google Scholar : PubMed/NCBI

27 

Zhang Y, Gong LH, Zhang HQ, Du Q, You JF, Tian XX and Fang WG: Extracellular ATP enhances in vitro invasion of prostate cancer cells by activating Rho GTPase and upregulating MMPs expression. Cancer Lett. 293:189–197. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Vázquez-Cuevas FG, Martínez-Ramírez AS, Robles-Martínez L, Garay E, García-Carrancá A, Pérez-Montiel D, Castañeda-García C and Arellano RO: Paracrine stimulation of P2X7 receptor by ATP activates a proliferative pathway in ovarian carcinoma cells. J Cell Biochem. 115:1955–1966. 2014.PubMed/NCBI

29 

Bian S, Sun X, Bai A, Zhang C, Li L, Enjyoji K, Junger WG, Robson SC and Wu Y: P2X7 integrates PI3K/AKT and AMPK-PRAS40-mTOR signaling pathways to mediate tumor cell death. PLoS One. 8:e601842013. View Article : Google Scholar : PubMed/NCBI

30 

Lauring J, Park BH and Wolff AC: The phosphoinositide-3-kinase-Akt-mTOR pathway as a therapeutic target in breast cancer. J Natl Compr Canc Netw. 11:670–678. 2013.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xia J, Yu X, Tang L, Li G and He T: P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway. Oncol Rep 34: 103-110, 2015.
APA
Xia, J., Yu, X., Tang, L., Li, G., & He, T. (2015). P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway. Oncology Reports, 34, 103-110. https://doi.org/10.3892/or.2015.3979
MLA
Xia, J., Yu, X., Tang, L., Li, G., He, T."P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway". Oncology Reports 34.1 (2015): 103-110.
Chicago
Xia, J., Yu, X., Tang, L., Li, G., He, T."P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway". Oncology Reports 34, no. 1 (2015): 103-110. https://doi.org/10.3892/or.2015.3979
Copy and paste a formatted citation
x
Spandidos Publications style
Xia J, Yu X, Tang L, Li G and He T: P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway. Oncol Rep 34: 103-110, 2015.
APA
Xia, J., Yu, X., Tang, L., Li, G., & He, T. (2015). P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway. Oncology Reports, 34, 103-110. https://doi.org/10.3892/or.2015.3979
MLA
Xia, J., Yu, X., Tang, L., Li, G., He, T."P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway". Oncology Reports 34.1 (2015): 103-110.
Chicago
Xia, J., Yu, X., Tang, L., Li, G., He, T."P2X7 receptor stimulates breast cancer cell invasion and migration via the AKT pathway". Oncology Reports 34, no. 1 (2015): 103-110. https://doi.org/10.3892/or.2015.3979
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team