This article is mentioned in:

Introduction

Protein kinase C (PKC) is a major signaling enzymes that regulates a variety of cell processes including proliferation, apoptosis, cell survival and migration (1–3). In addition, several oncogenes, such as RAS, FOS, MYC and PKC cooperate during transformation, indicating the involvement of PKC in tumorigenesis (4–6). Therefore, PKC has been the subject of extensive studies as a molecular target for the treatment of various types of cancer. However, the cofactors involved in the PKC-mediated tumorigenesis are not clearly defined.

The Aurora kinase family of serine/threonine kinases has been known to be crucial for cell cycle control (7,8). Mammalian genomes contain three genes encoding Aurora kinases: Aurora kinases A, B and C (9). Dysregulated expression of Aurora kinases is thought to promote oncogenesis, since an increased expression of Aurora kinases A and B has been observed in numerous tumor cells (10–12). Overexpression of Aurora kinase A is sufficient to induce colony formation in cultured cells and tumors in nude mice, indicating that Aurora kinase A is important for tumor formation and progression (13,14). However, few studies have demonstrated the role and regulation of Aurora kinases in carcinogenesis.

Matrix metalloproteinases (MMPs) are key regulators of many physiologic and pathologic cell processes such as wound healing and cancer metastasis. In cancer invasion, MMPs directly play a pivotal role in the migration of cancer cells (15). MMPs are now considered to be promising targets for cancer therapy, and clinical trials have begun with a large number of synthetic and natural MMP inhibitors (16). Among MMPs, gelatinases A (MMP-2) and B (MMP-9) are involved in tumor invasion and metastasis (17,18). Although MMP-2 is constitutively expressed in tissues (19), the induction of MMP-9 was reported to be important for human cancer cell invasion, particularly breast cancer cells (20–22). Therefore, the specific inhibition of MMP-9 expression has been suggested to be a reasonable pharmacological strategy for reducing the invasive potential of tumor cells (23–27). MMP-9 can be upregulated by several different growth factors and inflammatory cytokines (28,29). Moreover, phorbol esters, the PKC activators, have been identified as tumor-promoting agents but also strong activators of MMPs (30), indicating that PKC is primarily involved in the expression of MMPs in cancer.

In the present study, we first examined whether PKC regulates Aurora kinases in MCF-7 breast cancer cells. Subsequently, we investigated whether the inhibition of Aurora kinases blocks PKC-induced invasion and MMP-9 expression of MCF-7 breast cancer cells. The results showed that Aurora kinase is activated by PKC and is essential for MMP-9 expression and invasion of MCF-7 breast cancer cells.

Materials and methods

Cells and reagents

MCF-7 was purchased from ATCC (Manassas, VA, USA). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics at 37°C in a 5% CO2 incubator. Reversine and Aurora kinase inhibitor were obtained from Calbiochem (St. Louis, MO, USA). VX-680 was purchased from Selleck (Houston, TX, USA). 12-O-tetradecanoylphorbol-13-acetate (TPA), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), dimethylsulfoxide (DMSO) and anti-β-actin antibodies were obtained from Sigma (St. Louis, MO, USA). Primary antibodies against Aurora kinase A and B, phosphorylated (p)-Aurora kinase A, p-Aurora kinase B, p-IκBα, p-c-Jun, p38, p-p38, JNK, p-JNK, ERK and p-ERK were purchased from the Cell Signaling Technology (Beverly, MA, USA). Antibodies against MMP-9, IκBα, p65, PCNA and horseradish peroxidase (HRP)-conjugated IgG were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). DMEM, FBS and phosphate-buffered saline (PBS) were obtained from Gibco-BRL (Gaithersburg, ME, USA). Ninety-six-well plates, 6-well plates, 6 and 10 cm dishes were purchased from SPL Life Sciences (Pocheon, Gyeonggi, Korea). Matrigel was purchased from BD Biosciences (Bedford, MA, USA).

Determination of cell viability

A cell viability assay was performed using an MTT assay. Briefly, the cells were seeded at a density of 3ⅹl04 cells/well and allowed to attach to the plate surface. After 24 h, the cells were treated with Aurora kinase inhibitors. After incubation for an additional 24 h, the cells were washed with PBS, treated with MTT (0.5 mg/ml PBS) and incubated at 37°C for 30 min. Formazan crystals were dissolved with DMSO (100 µl/well) and detected at 570 nm using a microplate reader (Model 3550; Bio-Rad, Richmond, CA, USA).

Western blot analysis

The cells were lysed with an ice-cold M-PER® Mammalian Protein Extraction reagent (Pierce Biotechnology, Rockford, IL, USA). The protein concentration of each lysate was determined using the Bradford assay (31). Samples (20 µg) were resolved by electrophoresis on 10% acrylamide gel, and transferred electrophoretically to Hybond™-PVDF membranes. The membranes were blocked with 5% bovine serum albumin or 5% skim milk and subsequently incubated overnight with primary antibodies (1 µg/ml), followed by incubation with secondary antibodies (HRP-conjugated anti-IgG). ECL reagents (GE Healthcare) were used as substrates for the detection of peroxidase.

Gelatin zymography assay

The procedure for a gelatin zymography assay was performed as previously described (32).

Quantitative PCR assay

Total RNA was extracted from cells using a FastPure™ RNA kit (Takara, Shiga, Japan). cDNA was synthesized from 1 µg total RNA using a PrimeScript™ RT reagent kit (Takara). The mRNA levels were determined by quantitative PCR using the ABI PRISM 7900 sequence detection system and SYBR-Green (Applied Biosystems, Foster City, CA, USA). Aurora kinase A and B, and 18S primers were purchased from SABiosciences (Qiagen Inc., Valencia, CA, USA). The primers used were: MMP-9 (NM 004994) sense, CCTGGAGACCTGAGAACCAATCT and antisense, CCA CCCGAGTGTAACCATAGC; and GAPDH (NM 002046) sense, ATGGAAATCCCATCACCATCTT and antisense, CGCCCCACTTGATTTTGG. To control for variation in mRNA concentration, the results were normalized to the housekeeping gene, GAPDH or 18S. Relative quantification was performed using the comparative Ct method according to the manufacturer’s instructions.

Electrophoretic mobility shift assay (EMSA)

Cells were washed twice, scraped into 1.5 ml of ice-cold PBS (pH 7.5) and pelleted at 3,000 rpm for 3 min. Cytosol and nuclear extracts were prepared from cells using the NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology). Activation of AP-1 and NF-κB was analyzed by a gel mobility shift assay using nuclear extracts. Oligonucleotides containing the κ-chain (κB, 5′-CCGGTTAACAGAGGGGGCTTTCCGAG-3′) and AP-1 (5′-CGCTTGATGAGTCAGCCGGAA-3′) binding site were synthesized and used as probes for the gel retardation assays. Complementary strands were annealed and labeled with [α-32P]dCTP. Labeled oligonucleotides (10,000 cpm), 10 µg of nuclear extracts and binding buffer [10 mM Tris-HCl, pH 7.6, 500 mM KCl, 10 mM EDTA, 50% glycerol, 100 ng poly(dI•dC), 1 mM DTT] were then incubated for 30 min at room temperature in a final volume of 20 µl. Reaction mixtures were analyzed by electrophoresis on 4% polyacrylamide gels in a 0.5X Tris-borate buffer (pH 8.3). The gels were dried and examined by autoradiography. Specific binding was demonstrated through competition with a 50-fold excess of cold κB or AP-1 oligonucleotide.

Invasion assay

The invasion assay was carried out in 24-well chambers (8-µm pore size) coated with Matrigel diluted in DMEM (52 µl/cm2 of growth surface) according to the manufacturer’s instructions (BD Biosciences). Matrigel coating was re-hydrated in 0.5 ml DMEM for 30 min immediately prior to experiments. Cells (2×105) were added to the upper chamber and chemoattractant was added to the bottom well. Conditioned medium (0.5 ml) was added to the lower compartment of the invasion chamber. After 24 h incubation, the cells on the upper side of the chamber were removed using cotton swabs, and migrated cells were fixed and stained with toluidine blue solution. Invading cells were counted in five random areas of the membrane with the assistance of a light microscope.

Migration assay

The migration assay was carried out in 24-well chambers (8-µm pore size). Cells (2×105) were added to the upper chamber and chemoattractant was added to the bottom well. Conditioned medium (0.5 ml) was added to the lower compartment of the chamber. After a 24-h incubation, the cells on the upper side of the chamber were removed using cotton swabs, and migrated cells were fixed and stained with toluidine blue solution. Invading cells were counted in five random areas of the membrane with the assistance of a light microscope.

RNA interference

Aurora kinase-specific small interfering RNA (siRNA) and negative control siRNA were purchased from Bioneer (Daejeon, Korea). Transfection of MCF-7 cells was performed according to the manufacturer’s instructions (Amaxa GmbH, Cologne, Germany). Briefly, cells (3×105) were collected and re-suspended in 100 µl of MCF-7 nucleofector solution. The cell suspensions were mixed with 100 pmol siRNA, placed in a sterile electroporation cuvette, and subjected to program P-020 with the Nucleofector II (Amaxa GmbH).

Preparation of the lentivirus

miR RNAi Aurora kinase A and B lentiviral vectors were produced using the BLOCK-iT™ Pol II miR RNAi Expression system protocol (Invitrogen, Carlsbad, CA, USA). Single-stranded DNA oligos (Aurora kinase A and B) were created by the BLOCK-iT™ RNAi Express system (Invitrogen). As a control, LacZ Oligo sequences were provided by the RNAi expression system kit. Lentivirus was produced by the ViraPower™ Lentiviral Expression systems protocol (Invitrogen).

Statistical analysis

Data are presented as means ± SE from three individual experiments performed in triplicate replicates. Statistical data analysis was performed using one-way ANOVA program and Student’s t-test. Differences with p<0.05 were considered to indicate a statistically significant result.

Results

Activation of PKC increases the phosphorylation of Aurora kinase A and B in MCF-7 cells

Previous studies have shown that PKC strongly induces invasion in MCF-7 cells (33,34). To examine whether PKC activates Aurora kinases or regulates the expression of these kinases, we determined levels of phosphorylated Aurora kinases (p-AURKs) and total protein levels of the kinases using MCF-7 cells as a model system. As shown in Fig. 1A and B, treatment of cells with TPA, a PKC activator, increased the levels of total protein and phosphorylation of AURKA and AURKB in a time-dependent manner. The phosphorylation of AURKA and AURKB was constantly increased for 24 h (Fig. 1C). Furthermore, we confirmed that AURKA and B activation is dependent on PKC using PKC inhibitor (Fig. 1D).

Figure 1 TPA induces the phosphorylation of Aurora kinase A and B in MCF-7 breast cancer cells. Phosphorylation and expression of aurora kinases were assessed by western blotting. (A-C) Monolayer MCF-7 cells were treated with TPA for the indicated time periods. (D) Cells were treated with PKC inhibitor (GF109203X) for 1 h prior to treatment with 100 nM TPA. Increased levels of Aurora kinases were quantified by densitometry. *P<0.01 vs. untreated control. Data are presented as means ± SE of three independent experiments. TPA, 12-O-tetradecanoylphorbol-13-acetate.

PKC-induced phosphorylation of Aurora kinase A and B is mediated by MAPK

To investigate the molecular basis of the TPA-induced activation of Aurora kinases, MCF-7 cells were pretreated with various pharmacological inhibitors of cell signaling pathways, including MAPK, NF-κB and phosphatidylinositol 3-kinase (PI3K). The TPA-induced phosphorylation (Aurora kinase A, Th288; Aurora kinase B, Th232) of Aurora kinases A and B was abrogated by MAPK inhibitors (Fig. 2A). TPA upregulated total protein levels of Aurora kinases were blocked by MAPK inhibitors (Fig. 2B). By contrast, NF-κB and PI3K inhibitors did not block the TPA-induced phosphorylation/upregulation of Aurora kinase A and B expression (Fig. 2C and D). These results indicated that TPA induces the phosphorylation of Aurora kinases through a MAPK-mediated pathway in MCF-7 cells.

Figure 2 TPA upregulates Aurora kinases through MAPK signaling pathway in MCF-7 breast cancer cells. Cells were treated with (A and B) MAPK signaling inhibitors (p38 inhibitor, SB203580; JNK inhibitor, SP600125; ERK inhibitor, PD98059) or (C and D) NF-κB inhibitors (PDTC), PI3K inhibitor (LY294002) for 1 h priot to treatment with 100 nM TPA. Proteins in cell extracts were analyzed by western blotting. TPA, 12-O-tetradecanoylphorbol-13-acetate.

Aurora kinases are involved in the PKC-induced invasion of MCF-7 cell

To examine whether AURKs are involved in the invasion of MCF-7 cells, we used Aurora kinase inhibitors (reversine and VX-680) and AURK A- and B-specific siRNAs. Treatment of cells with TPA significantly increased the invasion/migration of MCF-7 cells compared to that of control cells. The TPA-induced increase of cell invasion/migration was significantly reduced by pretreatment with the inhibitors of Aurora kinases (Fig. 3A). Supporting the results, transfection of cells with Aurora kinase A or B specific siRNA also reduced the TPA-induced invasion of cells (Fig. 3B).

Figure 3 Suppression of Aurora kinases inhibited TPA-induced invasion/migration in MCF-7 breast cancer cells. (A) Cells of treated with pharmacological inhibitors of Aurora kinases [reversine (R), 5 µM; VX-680 (V) 5 µM] and (B) knockdown cells of Aurora kinases were analyzed by invasion and/or migration assay. Each value is the mean ± SE of three independent experiments. *P<0.01 vs. untreated control. #P<0.01 vs. TPA. TPA, 12-O-tetradecanoylphorbol-13-acetate.

Activation of Aurora kinases by TPA upregulates the expression of MMP-9

MMP-9 is a key enzyme for degrading type IV collagen, which is a major component of the basement membrane, therefore MMP-9 plays a critical role in cancer cell invasion. Treatment of MCF-7 cells with the Aurora kinase inhibitors did not lead to a significant change in cell viability, as measured by the MTT assay at the indicated concentrations and incubation lengths (Fig. 4A). To determine whether Aurora kinases are involved in TPA-induced MMP-9 expression, MCF-7 cells were pretreated with Aurora kinase inhibitors for 1 h and then additionally treated with TPA for 24 h. As shown in Fig. 4B, treatment of MCF-7 cells with TPA significantly increased MMP-9 expression and secretion. The TPA-induced upregulation of MMP-9 expression and secretion in MCF-7 cells was significantly suppressed by pretreatment with Aurora kinase inhibitors. RT-PCR analysis revealed that TPA increased the levels of MMP-9 mRNA in MCF-7 cells and that Aurora kinase inhibitors blocked the TPA-induced upregulation of MMP-9 mRNA expression (Fig. 4C). To confirm the result, we performed siRNA-mediated gene silencing of Aurora kinases in MCF-7 cells. As shown in Fig. 4D, transfection of MCF-7 cells with Aurora kinase A- and B-targeting siRNA markedly reduced the protein levels of Aurora kinases. The siRNA-mediated silencing of Aurora kinase A and B markedly decreased TPA-mediated increases in MMP-9 mRNA expression and protein levels (Fig. 4E and F). To determine the off-target effect, infected MCF-7 cells by miR RNAi-AURK A and B lentivirus were treated with TPA. The TPA-induced upregulation of MMP-9 expression in MCF-7 cells was significantly suppressed by miR RNAi-AURK A and B lentivirus (Fig. 4G and H). These results indicated that Aurora kinases serve as one of the underlying mechanisms for PKC-induced MMP-9 expression.

Figure 4 Suppressions of Aurora kinases prevent TPA-induced MMP-9 expression. (A) MCF-7 cells (3×104 cells/well) were cultured in 96-well plates until 70% confluence was reached. Aurora kinase inhibitors were added at the indicated concentrations for 24 h. [Reversine (R), 5 µM; Aurora kinases inhibitor II (A), 10 µM; VX-680 (V), 5 µM]. The cytotoxicity of each inhibitor was determined using an MTT assay. The optical density of the control cells was defined as 100%. Data are presented as means ± SE of three independent experiments. (B and E) Cell lysates subjected to western blot analysis. MMP-9 expression levels are relative to β-actin. Conditioned medium was prepared and used for MMP-9 gelatin zymography. (C and F) MMP-9 mRNA levels were analyzed by quantitative PCR, with GAPDH was used as an internal control. *P<0.01 vs. untreated control. #P<0.05 vs. TPA. Data are presented as means ± SE of three independent experiments. (D) MCF-7 cells were transfected with siRNAs and then cell lysates were analyzed by western blotting (G and H) Monolayer MCF-7 cells were infected with miR RNAi-LacZ and Aurora kinases lentivirus. Two days later, TPA treated in infected MCF-7 cells for 24 h. Proteins in cell lysates were immunoblotted with anti-MMP-9 and anti-β-actin. TPA, 12-O-tetradecanoylphorbol-13-acetate.

Suppression of Aurora kinases A and B inhibits the TPA-induced activation of NF-κB and AP-1 transcription factor

The MMP-9 promoter has been reported to contain NF-κB and AP-1 binding sites. These transcription factors are centrally involved in the induction of MMP-9 gene expression by TPA (27,32). Therefore, we examined whether the Aurora kinase-mediated upregulation of MMP-9 expression was nvolved NF-κB or AP-1. MCF-7 cells were pretreated with Aurora kinase inhibitors for 1 h and then treated with TPA (100 nM) for 3 h, and the nuclear extracts were analyzed by EMSA. As shown in Fig. 5A and B, NF-κB and AP-1 DNA binding activities were markedly increased by TPA. The TPA-induced increases of DNA binding were significantly blocked by Aurora kinase inhibitors. Additionally, the nuclear translocation of the p65 subunit of NF-κB and the phosphorylation status of c-Jun a subunit of AP-1 were analyzed by western blotting (Fig. 5C). Activation of NF-κB is known to be regulated by IκBα phosphorylation and degradation (33,35). Therefore, we examined the effect of Aurora kinase inhibitors on the TPA-induced phosphorylation and degradation of IκBα by western blotting. As shown in Fig. 5C Aurora kinase inhibitors suppressed the TPA-induced phosphorylation and degradation of IκBα. Moreover, in Aurora kinase A and B knockdown cells, NF-κB and AP-1 DNA binding activities, the nuclear translocation of p65 and degradation of IκBα and phosphorylation of c-Jun by TPA were significantly blocked (Fig. 5D–F, respectively).

Figure 5 Inhibition of Aurora kinase blocks TPA-induced NF-κB and AP-1 activation. TPA was treated for 4 h in cells that were pre-treated with Aurora kinase inhibitors for 1 h or transfected with Aurora kinase-targeting siRNAs. EMSA results show DNA-binding activity of (A and D) NF-κB and (B and E) AP-1, respectively. (C and F) Western blotting of proteins from the cells analyzed using the indicated antibodies. TPA, 12-O-tetradecanoylphorbol-13-acetate; EMSA, electrophoretic mobility shift assay.

Discussion

PKCs have been shown to be a transforming oncogene, and PKC-mediated oncogenic activity is linked to its ability to promote cell invasion (2). However, the mechanisms by which PKC signals cell invasion remain elusive. The present study has shown that TPA increases the phosphorylation of Aurora kinase A and B through MAPK, a major PKC downstream molecule. Our results also showed that AURKs are involved in the PKC-induced invasion of breast cancer cells, MMP-9 expression, and activation of NF-κB and AP-1. These findings suggest that Aurora kinases play central roles in cancer invasion.

Aurora kinase A has been shown to be overexpressed in a high proportion of invasive breast carcinomas, preinvasive carcinomas and even proliferative benign breast disease (BBDs) (36–38), suggesting that Aurora kinase A has an important role in human mammary tumor metastasis. Aurora kinases A and B promote inappropriate cellular mobility (39,40), a characteristic of invasion and metastasis of tumor cells. RNA interference targeting Aurora kinase A reduces the migration ability of human hepatic cancer cells, and Aurora kinase A has also been shown to enhance collagen-induced cell migration (41). However, the PKC-mediated expression of Aurora kinases has not been studied. Our results showed that PKC signaling upregulates the expression of Aurora kinases.

PKC regulates various cell functions, including signal transduction and gene expression (42). Thus, alterations in PKC signaling leads to malignant transformation and tumor progression. Overexpression of several PKCs has been reported in malignant breast tissue and breast cancer cell lines (43). As the major cell receptor for phorbol esters such as TPA, PKC acts as an important mediator for the transcriptional regulation of growth factor-responsive MMP genes (30). Notably, in the present study, the results reveal that activation of PKC with TPA increases phosphorylation of Aurora kinase A and B. TPA-induced phosphorylation (Aurora kinase A, Th288; Aurora kinase B, Th232) of Aurora kinases A and B were abrogated only by MAPK inhibitors. Supporting these observations, Oktay et al have shown that c-Jun N-terminal kinase, JNK functions upstream of Aurora kinase B (44). These findings suggest that PKC/MAPK signaling pathways activates Aurora kinases in MCF-7 cells.

Activation of PKCs has been shown to be correlated with the MMP-9 expression in breast cancer cells (20). MMP-9 is believed to be an important enzyme in tumor invasion due to its ability to degrade collagen (15,18). Numerous studies have shown that TPA stimulates the synthesis and secretion of MMP-9 in MCF-7 cells (45,46). In the present study, we found that inhibition of Aurora kinases strongly suppressed TPA-induced MMP-9 expression/secretion. The findings suggest that activation of Aurora kinases is necessary for the PKC-mediated induction of MMP-9 gene expression.

Nuclear transcriptional factors, AP-1 and NF-κB are involved in the upregulation of MMP-9 expression (47,48). AP-1 is a sequence-specific transcriptional factor composed of Jun, Fos and ATF family proteins, and is induced by multiple stimuli such as TPA (49). In the present study, suppression of Aurora kinases inhibited the TPA-mediated activation of NF-κB and AP-1. Recently, Briassouli et al have shown that Aurora kinase A regulates NF-κB signaling through IκBα phosphorylation (50). Collectively, these observations indicate that Aurora kinases play central roles in PKC-induced AP-1 and NF-κB activation, and MMP-9 expression.

In conclusion, the present study provides evidence that Aurora kinases A and B mediate PKC-MAPK signal to AP-1 and NF-κB with increasing MMP-9 expression and invasion of cancer cells. Tot the best of our knowledge, this is the first study showing that PKC regulates the activity of Aurora kinases, and provides insight into the molecular mechanism. Therefore, we suggest that Aurora kinases are key molecules in PKC-induced invasion in breast cancer cells.

Abbreviations:

Acknowledgments

The present study was supported by the Korea Breast Cancer Foundation, and the National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (nos. 2011-0030716 and 2010-0012716).

References