Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
October-2015 Volume 34 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2015 Volume 34 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Inhibition of sphingosine-1-phosphate phosphatase 1 promotes cancer cells migration in gastric cancer: Clinical implications

Corrigendum in: /10.3892/or.2018.6269
  • Authors:
    • Xiang Y. Gao
    • Lin Li
    • Xiao H. Wang
    • Xian Z. Wen
    • Ke Ji
    • Lin Ye
    • Jun Cai
    • Wen G. Jiang
    • Jia F. Ji
  • View Affiliations / Copyright

    Affiliations: Beijing Cancer Hospital and Key Laboratory of Carcinogenesis and Translational Research, Department of Gastrointestinal Surgery, Peking University Cancer Hospital and Institute, Beijing 100142, P.R. China, Cardiff China Medical Research Collaborative, Cardiff University School of Medicine, Heath Park, Cardiff CF14 4XN, UK
  • Pages: 1977-1987
    |
    Published online on: July 30, 2015
       https://doi.org/10.3892/or.2015.4162
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Sphingosine-1-phosphate (S1P) plays an important role in regulating many biological processes. Sphingosine-1-phosphate phosphatase 1 (SGPP1) can dephosphorylate S1P into sphingosine and tip the balance of sphingosine-S1P. Increased levels of sphingosine leads to a decrease in the ability of cell invasion as well as an increase in the ability of cell apoptosis. However, little is known regarding the effects of SGPP1 in gastric cancer. The present study examined the function of SGPP1 on gastric cancer cell lines as well as its clinical relevance in gastric cancer progression. Using immunohistochemistry and RT-qPCR techniques, the clinical significance of SGPP1 expression was analyzed in 288 paraffin-embedded gastric tissue specimens and 219 fresh gastric tissues, respectively. Transgenes encoding ribozymes to specifically target human SGPP1 (pEF-SGPP1) was constructed. Human gastric cancer cell lines (AGS and HGC27) were transfected with pEF-SGPP1 transgene and examined by functional analysis. SGPP1 was downregulated in gastric cancer tissues, compared with adjacent normal gastric tissues (p=0.034). SGPP1 mRNA levels in gastric cancer tissues were significantly decreased when compared with their adjacent non-cancerous tissues (p<0.001). Weakly expressed SGPP1 was positively correlated with the lymph node metastasis (p=0.005) and distant metastasis (p=0.031). Kaplan-Meier survival curves revealed that patients with SGPP1 positive expression had a significant increase in overall survival (OS) (p=0.034) and progression-free survival (PFS) (p=0.041). Multivariate analysis indicated the expression of SGPP1 was an independent prognostic factor in gastric cancer patients (p=0.041). In vitro experiments showed that knockdown of SGPP1 resulted in an increase in the invasion (2-fold) and migration (5-fold) of AGS and HGC27. The two gastric cancer cells transfected with pEF-SGPP1 exhibited a slower rate of growth with less adhesion. Thus, our findings provided evidence that SGPP1 may serve as a prognostic biomarker for patients with advanced gastric cancers.

Introduction

Gastric cancer is the fifth most common cancer and the third leading cause of cancer mortality worldwide (1). Surgery alone is no longer acceptable as a standard treatment for resectable gastric cancer (2). Optimal locoregional treatment for gastric cancer can be achieved by a combination of radical surgery with individualized neoadjuvant or adjuvant treatment, with modern 3D radiotherapy and optimum target therapy (3). Many clinical trials showed that although chemotherapy and target therapy are effective in short-term treatment for advanced gastric cancer (4–6), these treatments do not improve overall survival (OS) rate (<1 year). Thus, sensitive validated biomarkers for early detection of the tumor and a more accurate prediction of disease outcome as well as patient response to treatments can significantly improve efficacy of the treatments and greatly decrease the mortality of gastric cancer.

Sphingosine-1-phosphate (S1P) has been identified to play an important regulatory role in proliferation, inflammation, vasculogenesis and anti-apoptosis (7). Sphingosine-1-phosphate phosphatase 1 (SGPP1), which is intracellularly localized on endoplasmic reticulum (ER), is responsible for converting S1P to sphingosine (8). SGPP1 is located in the region 14q23.2 of the chromosome (9). Furthermore, overexpression of SGPP1 may elevate ceramide levels and induce apoptosis, whereas knockdown of SGPP1 enhanced resistance to TNF-α, the chemotherapeutic agent daunorubicin (8) and radiotherapy (10).

In the present study, we aimed to examine the possible role of SGPP1 in the progression of gastric cancer and determine whether SGPP1 may serve as a prognostic biomarker.

Materials and methods

Materials

Human gastric cancer cell lines, AGS and HGC27 were obtained from the European Collection of Cell Cultures, (ECACC; Salisbury, UK). Reagents and kits were obtained from Promega Corporation (Madison, WI, USA) and Gibco Invitrogen Corporation (Paisley, Scotland, UK). Anti-SGPP1 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), TRI reagent (Sigma-Aldrich, Poole, UK), Universal Z Probe (TCS Biologicals Ltd., Oxford, UK), and the DC Protein Assay kit (Bio-Rad, Hemel Hempstead, UK) were also used in the present study.

Gastric tissues

Gastric adenocarcinoma or Siewert type III gastroesophageal junction (GEJ) adenocarcinoma tissues (282 of paraffin-embedded tissues and 218 of fresh-frozen tissues), along with matched normal tissue from the same patients, were collected immediately after surgical resection at the Beijing Cancer Hospital and were stored in the Tissue Bank of Peking University Oncology School. Clinicopathological factors, including age, gender, histological type, Lauren type, tumor location, vascular invasion, TNM stage and lymph node metastasis, were recorded and stored in the patients' database. All protocols were reviewed and approved by the Local Ethics Committee. Informed consent was obtained from the patients before therapy.

The gastric tissues used in the present study were obtained from gastric cancer patients with cT2-4N0M0 or cT1-4N1-3M0 treated between January, 2003 and December, 2011. Gastrectomy with D2 lymphadenectomy was performed and no treatment was conducted before the surgery. Primary tumor site, grade, depth of tumor invasion, status of lymph node metastasis, distant metastasis and TNM stage were recorded in histopathology reports. Pathological stage was determined according to the seventh edition of the TNM staging system recommended by the International Union against Cancer.

Immunohistochemistry (IHC)

Sections (4 mm) obtained from formalin-fixed, paraffin-embedded tissues were mounted on poly-L-lysine-coated slides and then deparaffinised in xylene and rehydrated through alcohol to distilled water. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide for 15 min at room temperature. After pressure cooking the slides in 10 mmol/l EDTA (pH 8.0) for 3 min, the sections were incubated with 5% goat serum, then incubated overnight at 4°C with SGPP1 antibody (1:200; Santa Cruz Biotechnology, Inc.) and without the primary antibody as a negative control. Primary antibodies were detected using a two-step EnVision system (Dako, Glostrup, Denmark). Horseradish peroxidase and diaminobenzedene hydrochloride were the enzyme and chromogen used, respectively. Staining score was independently assessed by two pathologists. The percentage of positive cells and the intensity of cytoplasmic staining were analyzed. Thus all final scoring estimations were stratified as follows: −, 0% of stained cells; +, <20% weakly to moderately stained cells; ++, 10–20% intensively stained cells and 20–50% weakly stained cells; and +++, 20–50% positive cells with moderate-to-marked staining or >50% positive cells. There was a low level of discrepancy (<5% cases) among the pathologists in terms of scoring, but a consensus was reached after joint review.

RNA isolation and RT-PCR

Total RNA was isolated from the homogenized gastric tissues and cell lines using the Total RNA Isolation reagent (TRI reagent; Sigma-Aldrich). Synthesis of cDNA and subsequent PCR were performed as previously described (11). SGPP1 primers used were: sense, 5′-GGGCAACGAACTCTTCTAC-3′ and antisense, 5′-TCC AGGTGTCAAGAGTGAA-3′.

Quantitative RT-PCR

The level of SGPP1 transcripts was quantitatively analyzed with the iCycler iQ5 system with qPCR Master Mix (both from Bio-Rad) as previously described (12). SGPP1 primers designed using the Beacon Design software (Premier Biosoft, Palo Alto, CA, USA) were as follows: sense, 5′-ATGGACAAGCATCCCTTCC-3′ and antisense, 5′- ACTGAACCTGACCGTACA CTCTGTCAGGGAAATACCAA3-3′. The underlined sequence in the reverse primers was the additional Z sequence, which is complementary to the Universal Z Probe (TCS Biologicals Ltd., Oxford, UK). Internal standard GAPDH primer sequences used were: sense, 5′-CTGAGTACGTCGTGGAGTCC-3′ and antisense, 5′- ACTGAACCTGACCGTACA GAGATGATGACCCTTTTG-3′. To exclude the effect of tissue heterogeneity, the SGPP1 quantification was normalized against the corresponding CK19 (an epithelial marker) of each individual sample. The primers used for CK19 were: sense, 5′-CAGGTC CGAGGTTACTGAC-3′ and antisense, 5′- ACTGAACCTGACCGTACA CCGTTTCTGCCAGTGTGTCTTC-3′.

Construction of SGPP1 ribozyme transgenes and transfection

Anti-SGPP1 ribozyme transgenes were used to knock down the expression of SGPP1 in the AGS and HGC27 gastric cancer cells and were generated using the methods previously described (13). Briefly, an anti-SGPP1 hammerhead ribozyme was designed based on the secondary structure of SGPP1 mRNA and generated using the Zuker's RNA mFold program. The ribozymes that specifically target DAP3 were generated using the touchdown PCR with the appropriate primers (sense, 5′-CTGCAGTTCAACCACTTCTCCCAGAGCTGATGAGTCCGTGAGGA-3′ and antisense, 5′-ACTAGTAGAGAAAGCACTGAGAAAGGGAGTTTCGTCCTCACGGACT-3′). The amplified ribozymes were cloned into the pEF6/V5-His TOPO TA plasmid vector (Invitrogen, Paisley, UK) in accordance with the protocol provided. Ribozyme transgenes and control plasmids were transfected into HGC27 and AGS cells individually using an Easyjet Plus electroporator (EquiBio, Kent, UK). After up to 5 days of selection with blasticidin, the transfectants were verified for knockdown of SGPP1.

Western blotting

HGC27 and AGS cells were plated into small flasks at a density of 25×105 cells/well. Proteins were isolated from cells by lysis buffer. Protein concentrations were determined using the DC Protein Assay kit (Bio-Rad) and an ELx800 spectrophotometer (Bio-Tek, Bedfordshire, UK). Western blot analysis was performed after SDS-PAGE and transferred onto membranes. The proteins were probed with the anti-SGPP1-antibody (1:500) and anti-GAPDH-antibody (1:1,000) (Santa-Cruz Biotechnology, Inc.) as an internal control, followed by a peroxidase-conjugated secondary antibody (1:1,000). Protein bands were visualized and photographed using a UVITech imager (UVITech, Inc., Cambridge, UK).

Cell growth assay

Crystal violet assay was conducted as previously described (11). Cells were added into 96-well plates at 2×103 cells/well. The cells were fixed in 4% paraformaldehyde at room temperature for 10 min after 1, 3 and 5 days. After being washed, the plates were stained with 0.5% crystal violet solution. The plates were washed with tap water and air-dried. Acetic acid (10%) was added to each well for extraction of dye. Growth rates under normal conditions and under treatment were assessed. Absorbance of the staining was determined by a spectrophotometer at 540 nm (EL×800; Bio-Tek).

Cell matrix adhesion assay

The cell matrix adhesion assay was performed as previously described (14). Cells were added to a 96-well plate precoated with Matrigel (5 mg/well) (2×104 cells/well). After 40 min of incubation, non-adherent cells were washed off using BSS buffer. The remaining cells were fixed with 4% paraformaldehyde, stained with 0.5% crystal violet solution and counted.

Wound-healing assay

The motility of gastric cancer cells was analyzed using a wound-healing assay as previously described (15). The cells were grown until they reached confluence. A scrape in the cell monolayer was made in one direction with a fine gauge needle. The wounded cell monolayers were washed with PBS to remove cell debris. The migration of the invading cell front was recorded on a time lapse video recorder and analyzed using Optimas 6.0 motion analysis (Meyer Instruments, Houston, TX, USA).

Invasion assay

The in vitro Matrigel invasion assay was performed as previously described (15). Transwell inserts with 8-mm pore size were coated with 50 µg of Matrigel (Collaborative Research Products, Bedford, MA, USA) and air-dried. Following rehydration, 4×104 cells were added to each well. After 3 days of incubation, the cells that had migrated through the matrix to the other side of the insert were fixed, stained and counted.

Statistical analysis

Statistical analysis was performed using the SPSS software (SPSS standard version 13.0; SPSS Inc.). The relationship between SGPP1 expression and tumor grade, TNM staging and nodal status was assessed using the Mann-Whitney U test and Kruskal-Wallis test. Survival was analyzed using the Kaplan-Meier survival analysis. Results are presented as mean ± SEM. P<0.05 was considered statistically significant.

Results

Immunohistochemical staining of SGPP1 in human gastric specimens

In total, 282 paraffin-embedded specimens of gastric cancer patients from Beijing Cancer Hospital were included in the IHC study. This cohort comprised 196 males (69.5%) and 86 females (31.5%), with a median age of 69 (22–87) years. The patients underwent surgery without any prio treatment. The median follow-up time was 41.13 (1.00–137.17) months. The result was that, 36 patients had recurrence, 130 patients succumbed to gastric cancer, 15 patients succumbed to other causes (heart attack and cerebral haemorrhage), 11 were lost in follow-up and 107 remained alive and progression-free.

Negative staining results were considered as low expression and '+', '++', '+++' as high expression. SGPP1 was mainly detected in cytoplasm and the staining was obviously stronger in normal tissue compared with tumor tissues (p<0.001). A low expression of SGPP1 was positively associated with lymph node metastasis (p=0.005) and distant metastasis (p=0.031) (Table I). Kaplan-Meier survival curves revealed that patients with a high SGPP1 expression had a significant increase in OS and progression-free survival (PFS) in gastric cancer patients (p=0.034, 0.041; Fig. 1). Multivariate analysis indicated the expression of SGPP1 was an independent prognostic factor in gastric cancer patients (p=0.041; Table II).

Figure 1

(A) Representative images of immunohistochemical staining of SGPP1 on gastric tissues including the positive control (top panel), the negative control (middle panel) and the location of cytoplasm (bottom panel, with arrow pointing to the staining of SGPP1 in the cytoplasm of cancer cells). (B) Representative images of immunohistochemical staining of SGPP1 on gastric tumor tissues including the strong (top panel), moderate (middle panel) and weak (bottom panel) expression. (C) Kaplan-Meier survival analysis indicated that the relationship between the protein levels of SGPP1 and overall survival (top) and the relationship between the protein levels of SGPP1 and progression-free survival (bottom). SGPP1, sphingosine-1-phosphate phosphatase 1.

Table I

Association of SGPP1 expression with clinicopathological characteristics in gastric cancer patients.

Table I

Association of SGPP1 expression with clinicopathological characteristics in gastric cancer patients.

Clinicopathological characteristicsSGPP1 expression
P-value
Negative (%)Positive (%)
Gender0.357
 Male138 (71.1)56 (28.9)
  Female65 (76.5)20 (23.5)
Age (years)0.616
 ≤60100 (71.4)40 (28.6)
 >60103 (74.1)36(25.9)
Tumor location0.016
 Upper 1/337 (61.7)23 (38.3)
 Middle 1/345 (67.2)22 (32.8)
 Low 1/3112 (78.3)31 (21.7)
 Total9 (100.0)0 (0.0)
Cardia and non-cardia0.007
 Non-cardiac cancer175 (76.1)55 (23.9)
 Cardiac cancer28 (57.1)21 (42.9)
Tumor size (cm)0.855
 ≤4.0112 (73.2)41 (26.8)
 >4.091 (72.2)35 (27.8)
Lauren type0.560
 Intestinal type40 (70.2)17 (29.8)
 Diffuse116 (75.3)38 (24.7)
 Mixed type47 (69.1)21 (30.9)
Differentiation0.216
 Well-moderate90 (69.2)40 (30.8)
 Poor113 (75.8)36 (24.2)
 Well7 (58.3)5 (41.7)0.474
 Moderate83 (70.3)35 (29.7)
 Poor101 (76.5)31 (23.5)
 Signet12 (70.6)5 (29.4)
Histology0.464
 Adenocarcinoma169 (71.9)66 (28.1)
 Other typesa34 (77.3)10 (22.7)
Lymphovascular invasion0.486
 Absent100 (70.9)41 (29.1)
 Present103 (74.6)35 (25.4)
Depth of invasion
 T114 (77.8)4 (22.2)0.385
 T225 (67.6)12 (32.4)
 T37 (100.0)0 (0.0)
 T4157 (72.4)60 (27.6)
 T1+T239 (42.5)16 (57.5)0.731
 T3+T4164 (26.0)60 (74.0)
 T114 (77.8)4 (22.2)0.787
 T2+T3+T4189 (72.4)72 (27.6)
Lymph node metastasis
 N046 (71.9)18 (28.1)0.005
 N128 (53.8)24 (46.2)
 N235 (76.1)11 (23.9)
 N394 (80.3)23 (19.7)
 No46 (71.9)18 (28.1)0.856
 Yes157 (73.0)58 (27.0)
Distant metastasis0.031
 No177 (70.8)73 (29.2)
 Yes26 (89.7)3 (10.3)
TNM stage0.171
 I26 (74.3)9 (25.7)
 II28 (68.3)13 (31.7)
 III123 (70.7)51 (29.3)
 IV26 (89.7)3 (10.3)
 I26 (74.3)9 (25.7)0.828
 II–IV177 (72.5)67 (27.5)
 I+II54 (71.1)22 (28.9)0.695
 III+IV149 (73.4)54 (26.6)

a Other types: Signet-ring cell carcinoma and mucinous adenocarcinoma. SGPP1, sphingosine-1-phosphate phosphatase 1.

Table II

Patient survival associated with clinicopathological characteristics in gastric cancer.

Table II

Patient survival associated with clinicopathological characteristics in gastric cancer.

Clinicopathological characteristicsUnivariate analysis
Multivariate analysis
RR95% CIP-valueRR95% CIP-value
Gender
 Male vs. female1.2110.858–1.7100.276
Age (years)
 ≤60 vs. >600.7870.579–1.0680.125
Tumor location
 Upper 1/30.3800.184–0.7840.009
 Middle 1/30.2120.101–0.4460.230
 Low 1/30.2570.128–0.5140.118
 Multiple site0.000
Tumor size (cm)
 >4.0 vs. ≤4.00.6610.487–0.8970.008
Lauren type
 Intestinal vs. diffuse/mixed1.0420.718–1.5140.828
Differentiation
 Well-moderate vs. poor1.2700.935–1.7260.1261.4111.017–1.9570.039
Histology
 Adenocarcinoma vs. other typesa1.2640.851–1.8770.246
Lymphovascular invasion
 Absent vs. present2.0721.519–2.825<0.0011.4491.046–2.0070.026
Depth of invasion
 T10.0000.938
 T20.1600.160–0.5440.000
 T30.1530.153–2.4990.500
 T410.001
 T1+T2 vs. T3+T45.3752.911–9.924<0.0012.6271.372–5.0330.004
Lymph node metastasis
 N00.1180.066–0.211<0.001
 N10.2410.148–0.391<0.001
 N20.6730.431–0.9420.024
 N31.000<0.001
 No vs. yes5.3913.055–9.513<0.0013.6281.990–6.614<0.001
Distant metastasis
 No vs. yes0.1680.110–0.256<0.0010.2770.179–0.428<0.001
SGPP1
 Negative vs. positive0.6730.465–0.9730.0360.6710.458–0.9850.041

a Other types: Signet-ring cell carcinoma and mucinous adenocarcinoma. CI, confidence interval; RR, relative risk; SGPP1, sphingosine-1-phosphate phosphatase 1.

Quantification of SGPP1 mRNA expression in human gastric cancer

mRNA derived from the 219 gastric cancer patient tissues from the Beijing Cancer Hospital were subjected to a SGPP1 gene-specific qPCR study. This cohort comprised 144 males (65.8%) and 75 females (34.2%). The patients underwent the surgery without any prior treatment. The result was that, 86 patients were alive, 130 patients succumbed to gastric cancer, 9 patients had metastasis and 117 remained disease-free.

We compared the transcript levels of SGPP1 in gastric cancer tissues with adjacent normal tissues of patients. The transcript level of SGPP1 was significantly different in the T stage (p=0.009) and TNM stage (p=0.0255). Statistical analysis revealed significant links between the different clinical outcomes (p=0.0379) and different transcript levels. A markedly decreased transcript of SGPP1 was observed in tumor tissues compared with the normal background tissues (p<0.0001; Table III).

Table III

Correlation of the mRNA expression of SGPP1 and clinical parameters.

Table III

Correlation of the mRNA expression of SGPP1 and clinical parameters.

CategoryNo.MedianQ1Q3P-value
T/Nb<0.001
 Normal1832.50056
 Tumor3220.10021
Gender0.7876
 Male2290.10016
 Female930.10029
Location
 Cardia660.30053
 Fundus212.900520.3310
 Corpus610.100270.4796
 Pylorus1300.000160.1696
Differentiation
 Diff-H10.00N/AN/A
 Diff-HM60.0301.69
 Diff-M620.03060.3812
 Diff-ML810.080280.2121
 Diff-L1370.100290.2510
T stage
 T1160.0100.64
 T2250.00000.3706
 T3316.200830.0586
 T42320.080260.2526
0.009
 T1+T2410.0000
 T3+T42730.10028
N stage
 N0710.0005
 N1480.00080.8221
 N2640.000240.1375
 N31330.000450.0244
0.000.0519
 N01330.00045
 N1+N2+N32450.00029
M stage00.7139
 M02800.10013
 M1410.00093
TNM stage0
 I250.0000.60
 II590.020100.5474
 III2200.20300.0516
 IV91.0002580.0334
0.0255
 I+II840.0004
 III+IV2290.00032
Vascular invasion0.6462
 No invasion1520.00023
 Invasion1550.10019
Clinical outcome00.0379
 Alive1340.0004
 Dead1850.40045

[i] SGPP1, sphingosine-1-phosphate phosphatase 1.

Knockdown effect of SGPP1 on the functions of gastric cancer cells

The expression of SGPP1 in HGC27 and AGS cells transfected with corresponding anti-SGPP1 ribozyme transgenes was examined using conventional PCR. The results showed a significantly lower expression level of SGPP1 compared with the control group (2- to 3-fold) (Fig. 2A), and the same knockdown effect was observed in qPCR and western blot analysis (2- to 3-fold) (Fig. 2B and C).

Figure 2

(A) Representative image of RT-PCR analysis of efficacy of SGPP1 knockdown in HGC27 and AGS cells, respectively, with correspondent densitometric analysis [presented as the relative ratio of SGPP1 to GAPDH, (n=3)]. (B) RT-qPCR analysis confirmed SGPP1 knockdown in HGF27 and AGS cells, respectively. (C) Western blot analysis of SGPP1 protein levels in HGC27 and AGS cells used in response to SGPP1 knockdown. P<0.05, statistically significant. SGPP1, sphingosine-1-phosphate phosphatase 1.

Migration and invasion assay

To determine whether downregulating the expression of SGPP1 affected the biological behavior of gastric cancer cell lines, we performed a wound-healing assay of the cells. The AGS and HGC27 cells transfected with anti-SGPP1 ribozyme exhibited a significant increase in the ability of migration of tumor cells compared with the control cells. A significant difference was identified for the two cells (p<0.05, 2- to 5-fold; Fig. 3A).

Figure 3

(A) Wound-healing assay was used to assess the effect of SGPP1 knockdown on the migration ability of the gastric cancer cells. HGC27 cells (top panel) and AGS cells (bottom panel). (B) The influence of SGPP1 knockdown on the invasive ability of HGC27/AGS cells. HGC27 cells (left panel) and AGS cells (right panel). Data shown are the mean value of three experiments in triplicate. Experiments were repeated at least three times. Data are presented as mean ± SEM; *p<0.05. SGPP1, sphingosine-1-phosphate phosphatase 1.

The effect of SGPP1 knockdown on cell lines on migration was investigated using an in vitro invasion assay. The decrease in the expression of SGPP1 was significantly correlated with an increase in cell invasion in AGS and HGC27 cell lines (p<0.05, 3-fold; Fig. 3B).

Adhesion and growth assay

An in vitro matrix adhesion assay was used to investigate the effect of SGPP1 knockdown on cell lines on the adhesion ability of gastric cancer cell lines. The HGC27 and AGS cell lines transfected with SGPP1 ribozyme significantly inhibited matrix adhesion ability compared with the control cell line (p<0.05, 2- to 5-fold; Fig. 4A).

Figure 4

(A) In vitro adhesion test in AGS and HGC27 cell lines. Both HGC27 SGPP1 KD cell (left panel) and AGS KD cell (right panel) showed less adhesion ability compared with the control cell lines. (B) In vitro growth test in AGS and HGC27 cell lines; HGC27 SGPP1 KD cell grew slower than the corresponding control cell lines on day 5 (left panel), although no significant difference in AGS knockdown cell was observed (left panel). Experiments were repeated at least three times. Data are represented as mean ± SEM; *p<0.05. SGPP1, sphingosine-1-phosphate phosphatase 1; KD, knockdown.

Furthermore, to determine whether the expression of SGPP1 affected the growth of gastric cancer cells, we carried out a growth assay. The results showed that the HGC27 cell line transfected with SGPP1 ribozyme markedly inhibited growth on day 5 (p<0.05) and there was no significant difference on day 3, whereas this effect was not observed in the AGS cell line transfected with SGPP1 ribosome (Fig. 4B).

Discussion

Gastric cancer has become the fifth most common cancer worldwide over the past decades. There are ~480,000 new patients developing this cancer in China each year (1). At the same time, gastric cancer, whose estimated mortality rates ranks the highest in China, has also become the third leading cause of cancer mortality worldwide. Although the incidence rates of gastric cancer have gradually decreased (16), ~80% of patients with gastric cancer in China are at an advanced stage (17).

Despite new developments in the treatment for advanced gastric cancer patients, such as adjuvant chemotherapy (18), new adjuvant chemotherapy and concurrent chemoradiotherapy (19) plus surgery or surgery, the 5-year survival rate of patients has only been marginally improved (20). The main reason for this lack of significant improvement is mostly due to the fact that diagnosis is frequently made after progression to later stages, at which point current therapeutic strategies exert limited effectiveness. Furthermore, the major challenge to cancer treatment is the recurrence of diseases due to therapeutic resistance. In many patients, microscopic or macroscopic metastases have already occurred by the time the in situ lesion is detected. Therefore, early detection and more accurate methods in predicting disease outcomes, may enable physicians to make informed decisions regarding the potential necessity of early intervention. Consequently, early intervention would significantly decrease the mortality of gastric cancer and greatly improve the 5-year survival rate.

S1P is a bioactive sphingolipid that is important in regulating diverse biological processes (21). S1P is a component of cell membranes with high amphotericity, which enables S1P to possess sufficient aqueous solubility to move between membranes (22–24) as a bioactive signalling molecule. S1P is known to be involved in the regulation of diverse biological behavior. Particularly, S1P has emerged as an important signalling mediator participating in the regulation of various cell processes and diseases, including cancer, wound healing, atherosclerosis and immunity. S1P functions through either a family of five G protein-coupled membrane receptors known as S1PR1-5 (25,26) or intracellular targets, such as, prohibitin 2 (27), TNF receptor-associated factor 2 (TRAF2) (28), and histone deacetylase (HDAC) (29). Through interaction of these intracellular targets, S1P regulates a wide variety of biological effects (30), such as cell movement, differentiation, survival, inflammation, immunity, calcium homeostasis, and angiogenesis.

S1P may be dephosphorylated by SGPPs which convert S1P to sphingosine. Previous studies have shown that S1P level has a 2-fold increase in the SGPPs knockdown cell lines (8). There are two isoforms of SGPPs, SGPP1 (31) and SGPP2 (32). SGPPs can dephosphorylate S1P to regenerate sphingosine, leading to S1P inactivation. This, in turn, would lead cells to apoptosis as well as degeneration (9). SGPPs were highly selective for sphingolipid substrates (33). SGPPs have also been reported to be regulated by other factors. For example, laminar shear stress also downregulates the expression of SGPP1 while concomitantly stimulating S1P released from endothelial cells in vitro (34). SGPP1 may also control the unfolded protein response and ER stress-induced autophagy (35), as well as vascular tone (36). Overexpression of SGPPs may elevate ceramide levels and provoke apoptosis, whereas knockdown of SGPP1 enhanced resistance to TNF-α and the chemotherapeutic agent daunorubicin (8) and radiotherapy (10) (Fig. 5).

Figure 5

Diagram depicting S1P signaling pathway. S1P, sphingosine-1-phosphate.

In this study, we examined the function of SGPP1 on gastric cancer cell lines as well as its clinical significance in gastric cancer progression. SGPP1 is a potential biomarker candidate for early diagnosis and/or prognosis for patients with advanced gastric cancer. By accessing a relative large cohort of gastric cancer, we retrospectively evaluated the relationship between the level of SGPP1 expression and clinical characteristics. Our results showed that the patients who had a higher level of SGPP1 expression had a longer OS and PFS compared with a lower level of SGPP1 expression. Our study has demonstrated that a positive expression of SGPP1 was an early diagnosis of improved clinical outcome in gastric cancer patients. In addition, the study showed that SGPP1 expression was statistically associated with the location of tumor and lymph node metastasis in gastric cancer patients. Moreover, multivariate survival analysis showed that SGPP1 was an independent prognostic factor. Based on these results, we suggest that SGPP1 was a novel molecular prognosticator in the evaluation of gastric cancer patient survival.

Invasion and metastasis are major obstacles in the effort to improve survival of gastric cancer patients (37). Our in vitro study showed that the cell ability of invasion and migration was markedly increased in the gastric cell lines which the expression of SGPP1 is downregulated compared with the negative control. This phenomenon is similar to the observation in the data, showing a significant association with lymph node metastasis. Collectively, we suggest that SGPP1 serves as a novel prognostic marker of cancer cell invasion and metastasis. In addition, we found that downregulating the expression of SGPP1 affected the adhesion and growth ability in HGC27 cells but no significant change occurred in AGS cells. The reason for this phenomenon may be that the cancer cell decreases the ability of adhesion from the primary location and at the same time increases the ability of invasion and metastasis and epithelial-mesenchymal transition

In conclusion, the result show that SGPP1 expression is significantly lower in tumor tissue than that in the normal paired tissue, while downregulation of SGPP1 leads to an increase in cell migration and invasion in gastric cancer. A lower SGPP1 expression is correlated with lymph node metastasis and SGPP1 expression knockdown may lead to a more aggressive invasion and migration ability. Therefore, there is a significant correlation between SGPP1 expression and OS, PFS in the gastric cancer cohort. Taken together, the results indicate SGPP1 is a potential molecular marker that may be used to predict the effectiveness of prognosis in gastric cancer patients.

Acknowledgments

The authors wish to thank Cancer Research Wales, the Albert Hung Foundation, the Yiling Foundation, the Ser Cymru Welsh Life Science Network, Beijing Municipal Science & Technology Commission (D141100000414002) and the Natural Science Foundation of China (81374016) for supporting their work. Dr Xiang Y. Gao is a recipient of Cardiff University China Medical Scholarship.

References

1 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Cunningham D and Chua YJ: East meets west in the treatment of gastric cancer. N Engl J Med. 357:1863–1865. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Petrelli NJ: The debate is over; it's time to move on. J Clin Oncol. 22:2041–2042. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Cunningham D, Allum WH, Stenning SP, Thompson JN, Van de Velde CJ, Nicolson M, Scarffe JH, Lofts FJ, Falk SJ, Iveson TJ, et al MAGIC Trial Participants: Perioperative chemotherapy versus surgery alone for resectable gastroesophageal cancer. N Engl J Med. 355:11–20. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Bang YJ, Van Cutsem E, Feyereislova A, Chung HC, Shen L, Sawaki A, Lordick F, Ohtsu A, Omuro Y, Satoh T, et al ToGA Trial Investigators: Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): A phase 3, open-label, randomised controlled trial. Lancet. 376:687–697. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Van Cutsem E, de Haas S, Kang YK, Ohtsu A, Tebbutt NC, Ming Xu J, Peng Yong W, Langer B, Delmar P, Scherer SJ, et al: Bevacizumab in combination with chemotherapy as first-line therapy in advanced gastric cancer: A biomarker evaluation from the AVAGAST randomized phase III trial. J Clin Oncol. 30:2119–2127. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Payne SG, Milstien S and Spiegel S: Sphingosine-1-phosphate: Dual messenger functions. FEBS Lett. 531:54–57. 2002. View Article : Google Scholar : PubMed/NCBI

8 

Johnson KR, Johnson KY, Becker KP, Bielawski J, Mao C and Obeid LM: Role of human sphingosine-1-phosphate phosphatase 1 in the regulation of intra- and extracellular sphin-gosine-1-phosphate levels and cell viability. J Biol Chem. 278:34541–34547. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Le Stunff H, Galve-Roperh I, Peterson C, Milstien S and Spiegel S: Sphingosine-1-phosphate phosphohydrolase in regulation of sphingolipid metabolism and apoptosis. J Cell Biol. 158:1039–1049. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Huang X, Taeb S, Jahangiri S, Emmenegger U, Tran E, Bruce J, Mesci A, Korpela E, Vesprini D, Wong CS, et al: miRNA-95 mediates radioresistance in tumors by targeting the sphingolipid phosphatase SGPP1. Cancer Res. 73:6972–6986. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Ji K, Ye L, Toms AM, Hargest R, Martin TA, Ruge F, Ji J and Jiang WG: Expression of signal-induced proliferation-associated gene 1 (SIPA1), a RapGTPase-activating protein, is increased in colorectal cancer and has diverse effects on functions of colorectal cancer cells. Cancer Genomics Proteomics. 9:321–327. 2012.PubMed/NCBI

12 

Jiang WG, Grimshaw D, Lane J, Martin TA, Abounader R, Laterra J and Mansel RE: A hammerhead ribozyme suppresses expression of hepatocyte growth factor/scatter factor receptor c-MET and reduces migration and invasiveness of breast cancer cells. Clin Cancer Res. 7:2555–2562. 2001.PubMed/NCBI

13 

Parr C and Jiang WG: Metastasis suppressor 1 (MTSS1) demonstrates prognostic value and anti-metastatic properties in breast cancer. Eur J Cancer. 45:1673–1683. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Jiang WG, Hiscox S, Hallett MB, Scott C, Horrobin DF and Puntis MC: Inhibition of hepatocyte growth factor-induced motility and in vitro invasion of human colon cancer cells by gamma-linolenic acid. Br J Cancer. 71:744–752. 1995. View Article : Google Scholar : PubMed/NCBI

15 

Jiang WG, Hiscox SE, Parr C, Martin TA, Matsumoto K, Nakamura T and Mansel RE: Antagonistic effect of NK4, a novel hepatocyte growth factor variant, on in vitro angiogenesis of human vascular endothelial cells. Clin Cancer Res. 5:3695–3703. 1999.PubMed/NCBI

16 

Bertuccio P, Chatenoud L, Levi F, Praud D, Ferlay J, Negri E, Malvezzi M and La Vecchia C: Recent patterns in gastric cancer: A global overview. Int J Cancer. 125:666–673. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Rivera F, Vega-Villegas ME and López-Brea MF: Chemotherapy of advanced gastric cancer. Cancer Treat Rev. 33:315–324. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Sasako M, Sakuramoto S, Katai H, Kinoshita T, Furukawa H, Yamaguchi T, Nashimoto A, Fujii M, Nakajima T and Ohashi Y: Five-year outcomes of a randomized phase III trial comparing adjuvant chemotherapy with S-1 versus surgery alone in stage II or III gastric cancer. J Clin Oncol. 29:4387–4393. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Lee J, Lim H, Kim S, Park SH, Park JO, Park YS, Lim HY, Choi MG, Sohn TS, Noh JH, et al: Phase III trial comparing capecitabine plus cisplatin versus capecitabine plus cisplatin with concurrent capecitabine radiotherapy in completely resected gastric cancer with D2 lymph node dissection: The ARTIST trial. J Clin Oncol. 30:268–273. 2012. View Article : Google Scholar

20 

Falcone A: Future strategies and adjuvant treatment of gastric cancer. Ann Oncol. 14(Suppl 2): ii45–47. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Hannun YA: Functions of ceramide in coordinating cellular responses to stress. Science. 274:1855–1859. 1996. View Article : Google Scholar : PubMed/NCBI

22 

Boujaoude LC, Bradshaw-Wilder C, Mao C, Cohn J, Ogretmen B, Hannun YA and Obeid LM: Cystic fibrosis transmembrane regulator regulates uptake of sphingoid base phosphates and lysophosphatidic acid: Modulation of cellular activity of sphingosine 1-phosphate. J Biol Chem. 276:35258–35264. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Hannun YA and Obeid LM: Principles of bioactive lipid signalling: Lessons from sphingolipids. Nat Rev Mol Cell Biol. 9:139–150. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Wojciak JM, Zhu N, Schuerenberg KT, Moreno K, Shestowsky WS, Hiraiwa M, Sabbadini R and Huxford T: The crystal structure of sphingosine-1-phosphate in complex with a Fab fragment reveals metal bridging of an antibody and its antigen. Proc Natl Acad Sci USA. 106:17717–17722. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Hla T, Lee MJ, Ancellin N, Paik JH and Kluk MJ: Lysophospholipids - receptor revelations. Science. 294:1875–1878. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Anliker B and Chun J: Lysophospholipid G protein-coupled receptors. J Biol Chem. 279:20555–20558. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Strub GM, Paillard M, Liang J, Gomez L, Allegood JC, Hait NC, Maceyka M, Price MM, Chen Q, Simpson DC, et al: Sphingosine-1-phosphate produced by sphingosine kinase 2 in mitochondria interacts with prohibitin 2 to regulate complex IV assembly and respiration. FASEB J. 25:600–612. 2011. View Article : Google Scholar :

28 

Alvarez SE, Harikumar KB, Hait NC, Allegood J, Strub GM, Kim EY, Maceyka M, Jiang H, Luo C, Kordula T, et al: Sphingosine-1-phosphate is a missing cofactor for the E3 ubiquitin ligase TRAF2. Nature. 465:1084–1088. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Hait NC, Allegood J, Maceyka M, Strub GM, Harikumar KB, Singh SK, Luo C, Marmorstein R, Kordula T, Milstien S, et al: Regulation of histone acetylation in the nucleus by sphingosine-1-phosphate. Science. 325:1254–1257. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Xia P and Wadham C: Sphingosine 1-phosphate, a key mediator of the cytokine network: Juxtacrine signaling. Cytokine Growth Factor Rev. 22:45–53. 2011. View Article : Google Scholar

31 

Mandala SM, Thornton R, Galve-Roperh I, Poulton S, Peterson C, Olivera A, Bergstrom J, Kurtz MB and Spiegel S: Molecular cloning and characterization of a lipid phosphohydrolase that degrades sphingosine-1- phosphate and induces cell death. Proc Natl Acad Sci USA. 97:7859–7864. 2000. View Article : Google Scholar : PubMed/NCBI

32 

Ogawa C, Kihara A, Gokoh M and Igarashi Y: Identification and characterization of a novel human sphingosine-1-phosphate phosphohydrolase, hSPP2. J Biol Chem. 278:1268–1272. 2003. View Article : Google Scholar

33 

Mandala SM: Sphingosine-1-phosphate phosphatases. Prostaglandins. 64:143–156. 2001. View Article : Google Scholar : PubMed/NCBI

34 

Venkataraman K, Lee YM, Michaud J, Thangada S, Ai Y, Bonkovsky HL, Parikh NS, Habrukowich C and Hla T: Vascular endothelium as a contributor of plasma sphingosine 1-phosphate. Circ Res. 102:669–676. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Lépine S, Allegood JC, Park M, Dent P, Milstien S and Spiegel S: Sphingosine-1-phosphate phosphohydrolase-1 regulates ER stress-induced autophagy. Cell Death Differ. 18:350–361. 2011. View Article : Google Scholar :

36 

Peter BF, Lidington D, Harada A, Bolz HJ, Vogel L, Heximer S, Spiegel S, Pohl U and Bolz SS: Role of sphingosine-1-phosphate phosphohydrolase 1 in the regulation of resistance artery tone. Circ Res. 103:315–324. 2008. View Article : Google Scholar : PubMed/NCBI

37 

Cervantes A, Roselló S, Roda D and Rodríguez-Braun E: The treatment of advanced gastric cancer: Current strategies and future perspectives. Ann Oncol. 19(Suppl 5): v103–v107. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao XY, Li L, Wang XH, Wen XZ, Ji K, Ye L, Cai J, Jiang WG and Ji JF: Inhibition of sphingosine-1-phosphate phosphatase 1 promotes cancer cells migration in gastric cancer: Clinical implications Corrigendum in /10.3892/or.2018.6269. Oncol Rep 34: 1977-1987, 2015.
APA
Gao, X.Y., Li, L., Wang, X.H., Wen, X.Z., Ji, K., Ye, L. ... Ji, J.F. (2015). Inhibition of sphingosine-1-phosphate phosphatase 1 promotes cancer cells migration in gastric cancer: Clinical implications Corrigendum in /10.3892/or.2018.6269. Oncology Reports, 34, 1977-1987. https://doi.org/10.3892/or.2015.4162
MLA
Gao, X. Y., Li, L., Wang, X. H., Wen, X. Z., Ji, K., Ye, L., Cai, J., Jiang, W. G., Ji, J. F."Inhibition of sphingosine-1-phosphate phosphatase 1 promotes cancer cells migration in gastric cancer: Clinical implications Corrigendum in /10.3892/or.2018.6269". Oncology Reports 34.4 (2015): 1977-1987.
Chicago
Gao, X. Y., Li, L., Wang, X. H., Wen, X. Z., Ji, K., Ye, L., Cai, J., Jiang, W. G., Ji, J. F."Inhibition of sphingosine-1-phosphate phosphatase 1 promotes cancer cells migration in gastric cancer: Clinical implications Corrigendum in /10.3892/or.2018.6269". Oncology Reports 34, no. 4 (2015): 1977-1987. https://doi.org/10.3892/or.2015.4162
Copy and paste a formatted citation
x
Spandidos Publications style
Gao XY, Li L, Wang XH, Wen XZ, Ji K, Ye L, Cai J, Jiang WG and Ji JF: Inhibition of sphingosine-1-phosphate phosphatase 1 promotes cancer cells migration in gastric cancer: Clinical implications Corrigendum in /10.3892/or.2018.6269. Oncol Rep 34: 1977-1987, 2015.
APA
Gao, X.Y., Li, L., Wang, X.H., Wen, X.Z., Ji, K., Ye, L. ... Ji, J.F. (2015). Inhibition of sphingosine-1-phosphate phosphatase 1 promotes cancer cells migration in gastric cancer: Clinical implications Corrigendum in /10.3892/or.2018.6269. Oncology Reports, 34, 1977-1987. https://doi.org/10.3892/or.2015.4162
MLA
Gao, X. Y., Li, L., Wang, X. H., Wen, X. Z., Ji, K., Ye, L., Cai, J., Jiang, W. G., Ji, J. F."Inhibition of sphingosine-1-phosphate phosphatase 1 promotes cancer cells migration in gastric cancer: Clinical implications Corrigendum in /10.3892/or.2018.6269". Oncology Reports 34.4 (2015): 1977-1987.
Chicago
Gao, X. Y., Li, L., Wang, X. H., Wen, X. Z., Ji, K., Ye, L., Cai, J., Jiang, W. G., Ji, J. F."Inhibition of sphingosine-1-phosphate phosphatase 1 promotes cancer cells migration in gastric cancer: Clinical implications Corrigendum in /10.3892/or.2018.6269". Oncology Reports 34, no. 4 (2015): 1977-1987. https://doi.org/10.3892/or.2015.4162
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team