Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
June-2016 Volume 35 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2016 Volume 35 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway

  • Authors:
    • Xin Gao
    • Jin Wang
    • Weiliang Bai
    • Wenyue Ji
    • Liping Wang
  • View Affiliations / Copyright

    Affiliations: Department of Otorhinolaryngology-Head and Neck Surgery, Shengjing Hospital of China Medical University, Heping, Shenyang, Liaoning 110004, P.R. China
  • Pages: 3313-3320
    |
    Published online on: March 24, 2016
       https://doi.org/10.3892/or.2016.4707
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Nin one binding protein (NOB1) plays important roles in the synthesis and degradation of proteins, thus having effects on the cellular process. In the present study, the expression level of NOB1 in laryngeal cancer patients was detected by quantitative PCR and western blotting, and the effect of NOB1 on growth and metastasis of laryngeal cancer cells was explored. Silence of NOB1 was found to inhibit the proliferation of laryngeal cancer cells, arrest cell cycle and induce cell apoptosis. NOB1 silence was also found to inhibit the migration and invasion of laryngeal cancer cells and to downregulate the protein levels of matrix metalloproteinases (MMPs)-2 and MMP-9. Further mechanism study revealed that the JNK signaling pathway was involved in the function of NOB1. Our present results suggest that NOB1 plays an oncogenic role in laryngeal cancer cells through the regulation of JNK signaling pathway, and lays a theoretical foundation for further exploration of NOB1.

Introduction

Laryngeal cancer is a common malignant tumor appearing in head and neck. More than 90% of laryngeal cancer is laryngeal squamous cell carcinoma which accounts for 14% of the squamous cell carcinoma of head and neck (1,2). Despite advances in therapies, the incidence of laryngeal cancer is high with ~160,000 new cases each year and the mortality of laryngeal cancer is still high with a 64% 5-year survival rate (3). Tumorigenesis of laryngeal cancer is a complex process involved in genetic dysregulation. Understanding fully the underlying mechanism of laryngeal cancer tumorigenesis is imperative to the therapy of laryngeal cancer.

Nin one binding protein (NOB1) gene is located on human chromosome 16q22.1 (4) and NOB1 protein is mainly expressed in liver, lung and spleen. NOB1 protein is a nuclear protein composed of the PIN domain and the C terminal zinc ribbon domain. NOB1 regulates the maturation process of 18S rRNA through the PIN domain, and influences the formation of ribosome, thus having impact on the synthesis of proteins (5–7). NOB1 also promotes the maturation of 20S proteasome as well as the formation of 26S proteasome, mediating the ubiquitin-mediated protein degradation (8,9). NOB1 plays crucial roles in the synthesis and degradation of proteins, which indicates the importance of NOB1 in multiple physiologic activities of cells.

Recent studies show that NOB1 has higher expression in various tumors, such as breast (10), prostate (11) and lung cancer (12), than the adjacent non-tumor tissues. Inhibition of NOB1 is shown to perform anticancer function in breast (13), prostate (11), colon (14) and ovarian cancer (15). However, no data show the expression and function of NOB1 in laryngeal cancer. In the present study, we detected the expression level of NOB1 in laryngeal cancer patients and explored the effect of NOB1 silence on the proliferation, apoptosis and migration of laryngeal cancer cells. Results of the present study showed that NOB1 acted as an oncogene in laryngeal cancer cells and silence of NOB1 may become a promising therapeutic method in the treatment of laryngeal cancer.

Materials and methods

Clinical exploration

Paired laryngeal cancers and adjacent normal tissues were obtained from 28 patients who underwent primary surgical resection of laryngeal cancer in Shengjing Hospital of China Medical University from April, 2014 to April, 2015. Following surgical removal, these tissue samples were cut into small pieces immediately and frozen in liquid nitrogen. These tissue samples were subjected to quantitative real-time PCR (RT-qPCR) and western blotting as described below. The relative mRNA level of NOB1 in laryngeal cancer patients was calculated using the 2−∆∆Ct method and the relative protein level of NOB1 was normalized to β-actin. The study protocol was approved by the Human Research Ethics Committee of China Medical University.

Cell culture

Human laryngeal cancer cell line Hep2 was obtained from Type Culture Collection Center of Chinese Academy of Science (Shanghai, China). Cells were cultured in RPMI-1640 medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA) and maintained in a humid atmosphere at 37°C with 5% CO2.

Infection

Sequence containing NOB1 shRNA or its corresponding negative control (NC) (Table I) was synthesized by Sangon Biotech (Shanghai, China) and inserted into pRNA-H1.1 plasmid. After sequencing confirmation, these two plasmids were named as NOB1 shRNA and NC, respectively. Cells were seeded into 6-well plates and infected with NOB1 shRNA or NC using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Then, cells were cultured in RPMI-1640 medium supplemented with 10% FBS and 100 µg/ml G418 (Invitrogen) for positive colony selection.

Table I

Sequence of shRNA.

Table I

Sequence of shRNA.

Sense (5′−>3′)Antisense (5′−>3′)
NOB1 shRNA GATCCCCGTGAGGACGTTCCAAGTGATTCA AGCTAAAAAGTGAGGACGTTCCAAGTGATC
AGAGATCACTTGGAACGTCCTCACTTTTT TCTTGAATCACTTGGAACGTCCTCACGGG
NC GATCCCCTTCTCCGAACGTGTCACGTTTCAA AGCTAAAAATTCTCCGAACGTGTCACGTTCT
GAGAACGTGACACGTTCGGAGAATTTTT CTTGAAACGTGACACGTTCGGAGAAGGG

[i] NOB1, Nin one binding protein; NC, negative control.

MTT assay

Cells were seeded into 96-well plates (3×103 cells/well) in quintuplicate, and MTT was added into each well at 0, 24, 48, 72 and 96 h. After incubation for additional 4 h, the supernatant was removed gently and 200 µl dimethyl sulfoxide (DMSO) was added into each well. The absorbance at 490 nm was measured using a microplate reader.

Colony formation

Cells were seeded into cell culture dishes (500 cells/dish). The dishes were maintained at 37°C for 7 days to allow the colonies to form. The culture medium was changed every 2–3 days. After the colonies were formed, they were washed with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde and stained with Wright-Giemsa dye (Jiancheng Bio, Nanjing, China) for 5 min. Images of the stained colonies were captured and the ratio of colony formation (>50 cells/colony) was calculated.

Cell cycle assay

The cell cycle assay was performed by flow cytometry. Cells were harvested, washed with PBS and fixed with ice-cold 70% ethanol. The fixed cells were stained with Cell Cycle Detection kit (Beyotime, Shanghai, China), and incubated at 37°C for 30 min in the dark. Then, the cell cycle distribution was analyzed by flow cytometer (Becton-Dickinson, Franklin Lakes, NJ, USA).

Apoptosis assay

The apoptosis of cells in each group was evaluated by flow cytometry using a Cell Apoptosis Detection kit (Wanleibio, Shenyang, China). Cells were harvested and resuspended in 500 µl binding buffer. Then, 5 µl Annexin V-FITC and 5 µl propidium iodide was added into the suspension. The cell suspension was then incubated at room temperature for 15 min in the dark. Then, apoptosis level of cells in each group was detected using flow cytometry.

Hoechst staining

For Hoechst staining, cells were seeded in a 12-well plate (1×105 cells/well). Cells were fixed after culture at 37°C for 24 h. After washing with PBS, cells were stained with Hoechst staining kit (Beyotime), then cells were observed under fluorescence microscope with a magnification of ×400, and the images were captured.

Wound-healing assay

Cells were seeded into 6-well plates. When cell confluence was 80–90%, cells were treated with 1 µg/ml mitomycin C for 1 h, and then 200 µl pipette tips were used to make scratches on the cell monolayer to generate a wound. After the scratches were made, cells were cultured in serum-free medium and images of the wounds were captured at 0, 24 and 48 h. The migration rate was calculated by measuring the gap size of the wounds. Migration rate = (1 − gap size at 24 or 48 h/gap size at 0 h) × 100%.

Transwell assay

After infection with NOB1 shRNA, cells were made into cell suspension and 200 µl cell suspension of each group was added into the upper chamber of Transwell plate (Corning, Tewksbury, MA, USA) pre-coated with Matrigel (Becton-Dickinson) at a density of 2×104 cells/well. Medium (800 µl) with 20% FBS were added into the lower chambers. After incubation at 37°C for 24 h, cells above the microporous membrane were removed by cotton swabs and cells at the bottom of the microporous membrane were fixed with 4% paraformaldehyde for 20 min at room temperature, and stained with 0.5% crystal violet for 5 min. Images of cells in five random fields were captured using light microscopy with a magnification of ×200.

RT-qPCR

Total RNA was extracted using total RNA extraction kit (BioTeke, Beijing, China) according to the manufacturer's protocol and reverse transcribed to cDNA with super M-MLV reverse transcriptase (BioTeke) and oligo(dT)15. The mRNA level of NOB1 was detected by SYBR-Green quantitative real-time PCR with primers as in Table II. The relative mRNA level of NOB1 was calculated using the 2−∆∆Ct method (16).

Table II

Sequence of primers used in RT-qPCR.

Table II

Sequence of primers used in RT-qPCR.

Forward primer (5′−>3′)Reverse primer (5′−>3′)
NOB1 GCTTGTGAGCCTGAGAACCTG TTATCCAGCCACCCCCGTC
β-actin CTTAGTTGCGTTACACCCTTTCTTG CTGTCACCTTCACCGTTCCAGTTT

[i] NOB1, Nin one binding protein.

Western blotting

Cells were harvested and lysed in RIPA lysis buffer (Beyotime) with 1% phenylmethanesulfonyl fluoride, and protein was extracted by centrifugation. After measurement of protein concentration with a BCA protein assay kit (Beyotime), equal amount of protein from each group was injected into SDS-PAGE for electrophoresis. Then, protein was transferred to polyvinylidene fluoride (PVDF) membranes. After blockade with 5% skim milk or 1% BSA, the membranes were incubated with the primary antibodies against NOB1 (1:1,000; Proteintech, Chicago, IL, USA), cleaved-caspase-3, cleaved-PARP (1:1,000; Abcam, Cambridge, UK), matrix metalloproteinases (MMPs)-2, MMP-9, B-cell lymphoma-2 (Bcl-2), Bcl-2-associated X protein (Bax) (1:400; Boster, Wuhan, China), p-JNK, JNK (1:500; Bioss, Beijing, China) and β-actin (1:1,000; Santa Cruz Biotechnology, Inc., Dallas, TX, USA). After washing with TBST, the membranes were incubated with corresponding horseradish peroxidase-conjugated secondary antibodies (1:5,000; Beyotime). Then, the membranes were visualized using an enhanced chemiluminescence (ECL) detection system and the gray scale analysis was carried out with Gel-Pro-Analyzer.

Statistical analysis

All experiments were repeated three times and the results are presented as means ± standard deviation (SD). One-way analysis of variance (ANOVA) and Bonferroni's multiple comparison were used to analyze the difference between each group. p<0.05 was considered to be significant.

Results

NOB1 level in laryngeal cancer patients

The NOB1 level in laryngeal cancer patients was detected by RT-qPCR and western blotting. Results of RT-qPCR showed that laryngeal cancer tissues had a higher NOB1 level than those of the adjacent tissues (Fig. 1A). Similar to the results of RT-qPCR, western blotting also showed that NOB1 had a higher level in laryngeal cancer (Fig. 1B). These results demonstrated that NOB1 expressed at high level in laryngeal cancer.

Figure 1

NOB1 level in laryngeal cancer patients. Paired laryngeal cancers and adjacent normal tissues were collected and the level of NOB1 was measured using (A) RT-qPCR and (B) western blotting. The results are presented as mean ± SD; *p<0.05, **p<0.01.

NOB1 shRNA decreases the level of NOB1

NOB1 shRNA was used to explore the function of NOB1. RT-qPCR and western blotting were employed to detect the effect of NOB1 shRNA. Results of RT-qPCR showed that, in cells infected with NOB1 shRNA, the NOB1 level was decreased to 27±4% (Fig. 2A), but there was no significant change in cells infected with NC. Similar altered patterns were also found in the results of western blotting, after infected with NOB1 shRNA, the protein level of NOB1 was decreased to 22±4% (Fig. 2B and C). These results demonstrate that NOB1 shRNA downregulates NOB1 level effectively.

Figure 2

NOB1 shRNA downregulates the NOB1 level in laryngeal cancer cells. (A) After infection with NOB1 shRNA, the mRNA level of NOB1 was measured by RT-qPCR. (B and C) The protein level of NOB1 was detected by western blotting after infection with NOB1 shRNA. β-actin was used as the internal reference. Each experiment was repeated three times. Typical results are presented. The results are presented as mean ± SD; ***p<0.001.

NOB1 shRNA inhibits the proliferation of laryngeal cancer cells

To explore the effect of NOB1 on the proliferation of laryngeal cancer cells, colony formation assay was carried out to explore the effect of NOB1. After infection with NOB1 shRNA, the ratio of colony formation was significantly decreased comparing with that of cells infected with NC (Fig. 3A and B; p<0.01). Then, MTT assay was also carried out. As shown in Fig. 3C, cells infected with NOB1 shRNA showed a slow growth comparing to cells infected with NC. These results suggest that NOB1 shRNA inhibits growth of laryngeal cancer cells.

Figure 3

NOB1 shRNA inhibits the growth of laryngeal cancer cells. (A and B) Colony formation assay was performed after infection with NOB1 shRNA and the ratio of colony formation was calculated. (C) After infection with NOB1 shRNA, the cell viability was measured using MTT. (D and E) Cell cycle assay was performed after infection with NOB1 shRNA and the distribution of cell cycle was analyzed. All experiments were repeated three times and typical results are presented. Results are presented as mean ± SD; *p<0.05, **p<0.01.

Cell cycle is a crucial event that influences the growth of cells. The effect of NOB1 shRNA on cell cycle was detected in the present study. As shown in Fig. 3D and E, after infection with NOB1 shRNA, the percentage of cells in G1 phase was increased from 60.67±5.14 to 74.47±5.44%, and the percentage of cells in S phase was decreased from 21.30±2.46 to 12.23±3.36%. The distribution of cell cycle was changed after infection with NOB1 shRNA, which indicates the important role of NOB1 in the cell cycle.

NOB1 shRNA induces laryngeal cancer cell apoptosis

Cell apoptosis is also an important event that influences cell growth. Effect of NOB1 shRNA on cell apoptosis was detected using flow cytometry. Results showed that the percentage of apoptotic cells was 4.12±0.54% in cells infected with NC, but the percentage of apoptosis was increased to 22.25±2.46% after infection with NOB1 shRNA (Fig. 4A and B). Hoechst staining was also employed to detect cell apoptosis. As shown in Fig. 4C, there was obvious pyknosis of chromatin in cells infected with NOB1 shRNA. The protein levels of cleaved caspase-3, cleaved PARP, Bcl-2 and Bax were also detected in the present study. Results of western blotting showed that the protein level of cleaved caspase-3 was increased to 3.09±0.37-fold, the protein level of cleaved PARP was increased to 2.2±0.4-fold, the protein level of Bax was increased to 1.87±0.19-fold, but the protein level of Bcl-2 was decreased to 49±10% (Fig. 4D and E). These results demonstrate that NOB1 shRNA induces apoptosis of laryngeal cancer cells.

Figure 4

NOB1 silencing induces cell apoptosis. (A and B) Cell apoptosis was detected using flow cytometry and the percentage of cells in each phase was calculated. (C) Hoechst staining was used to detect cell apoptosis after infection with NOB1 shRNA. (D and E) Protein levels of cleaved PARP, cleaved caspase-3, Bax and Bcl-2 were detected using western blotting with β-actin as the internal reference. All experiments were repeated three times. Typical results are presented and results are presented as mean ± SD; **p<0.01, ***p<0.001.

NOB1 shRNA inhibits migration and invasion of laryngeal cancer cells

The effect of NOB1 shRNA on migration of laryngeal cancer cells was also explored in the present study. Wound-healing and Transwell assays were performed to detect the cell migration capability. Results of wound-healing assay showed that the migration capability of cells infected with NOB1 shRNA was significantly decreased at both 24 and 48 h (Fig. 5). In the results of Transwell assay, the number of cells passing through the micropore membrane in the NOB1 shRNA group was 72.2±7.46, significantly lower than of the NC group (119.4±12.9) (Fig. 6A). MMP-2 and MMP-9 play important roles in the process of cell migration and were detected by western blotting in the present study. The protein levels of MMP-2 and MMP-9 were decreased to 64±7 and 52±7%, respectively, in cells infected with NOB1 shRNA, significantly lower than that of cells infected with NC (Fig. 6B and C). These results suggest that downregulation of NOB1 inhibits the migration of laryngeal cancer cells.

Figure 5

Silencing of NOB1 inhibits migration of laryngeal cancer cells. (A) After infection with NOB1 shRNA, wound-healing assay was performed to detect changes in migration capacity. (B) Relative migration rate at 24 h. (C) Relative migration rate at 48 h. Each experiment was repeated three times and typical results are presented. Results are shown as mean ± SD; **p<0.01.

Figure 6

Silencing of NOB1 inhibits invasion of laryngeal cancer cells. (A) Transwell assay was carried out after infection with NOB1 shRNA and the number of cells passing through the micropore membrane was calculated. (B and C) Protein levels of MMP-2 and MMP-9 were detected after infection with NOB1 shRNA. All experiments were repeated three times. Results are presented as mean ± SD and typical results are presented; **p<0.01, ***p<0.001.

JNK signaling pathway is involved in the function of NOB1

JNK and P38 signaling pathways play important roles in various events, such as cell growth and migration. In the present study, the protein levels JNK, P38, phosphorylated JNK (p-JNK) and phosphorylated P38 (p-P38) were detected by western blotting. As shown in Fig. 7, there was a significant increase in the JNK phosphorylation level after infection with NOB1 shRNA, leaving no significant changes in protein level of JNK (Fig. 7A and B; p<0.01). After infection with NOB1 shRNA, the P38 phosphorylation level showed a slight increase, but not significantly (Fig. 7C and D). These results indicate that JNK signaling pathway may be involved in function of NOB1.

Figure 7

NOB1 shRNA induces the activation of JNK. (A and B) Protein levels of JNK and phosphorylated JNK (p-JNK) were detected by western blotting. (C and D) Western blotting was used to detect the protein level of P38 and phosphorylated P38 (p-P38). Each experiment was repeated three times and the results are presented as mean ± SD. Typical results are presented; **p<0.01.

Discussion

In the present study, we found the expression level of NOB1 in laryngeal cancer patients was high and we further explored the function of NOB1 on proliferation, apoptosis and migration of laryngeal cancer cells. Silence of NOB1 was found to inhibit the proliferation of laryngeal cancer cells, arrest cell cycle process and induce apoptosis. NOB1 silence also inhibited the migration and invasion of laryngeal cancer cells. Further mechanism study showed that the JNK was activated after infection with NOB1 shRNA, which indicates that the function of NOB1 on proliferation and migration of laryngeal cancer cells may be associated with JNK signaling pathway.

In the process of tumorigenesis, the expression of multiple genes has been shown out of control. NOB1 shows high level in breast (10) and prostate cancer (11), and is associate with these cancers (11,13). In the present study, clinical detection showed that the expression level of NOB1 in laryngeal cancer was high. This indicates that NOB1 may be associated with tumorigenesis of laryngeal cancer.

Dysregulation of cell growth is a characteristic of cancer. In the present study, we found that silencing of NOB1 inhibited the growth and colony formation capability of laryngeal cancer cells. NOB1 was reported to influence the growth of breast (13), ovarian (15), colon (14), prostate (11) and renal cancer (17), which was consistent with the results of the present study. Cell cycle is an important event in the process of cell growth, and in the present study, NOB1 showed a regulatory role in the cell cycle process of laryngeal cancer cells. Knockdown of NOB1 was also reported to have influence on the expression of cell cycle-related genes, such as cyclin and CDKs (18), and induce cell cycle arrest at G0/G1 phase (11,13–15,17–19).

Apoptosis is also an important event that has influence on cell growth. Results of the present study showed that NOB1 had an anti-apoptosis function in laryngeal cancer cells. Consistent with the present study, downregulation of NOB1 was reported to induce cell apoptosis in colon (20) and lung cancer (21). The ratio of Bax and Bcl-2 is associated with the opening of mitochondrion permeability transition pore and the release of cytochrome c which activates caspase-9 and induces cell apoptosis. In the present study, the expression of Bax and Bcl-2 was also found to be regulated by NOB1 silence. These results prompted us to clarify whether the effect of NOB1 silencing on apoptosis is associated with the mitochondria-mediated apoptosis. Cell apoptosis is an important way through which radiotherapy and chemotherapy kill tumor cells. Meng et al reported that silence of NOB1 enhanced the sensitivity of tumor cells to radiotherapy (22) and Liu et al also showed that silence of NOB1 boosted the anticancer activity of chemotherapeutics drugs (23). The effects of NOB1 silencing on the proliferation and apoptosis of cancer cells suggested that NOB1 may be a promising therapeutic target in the treatment of laryngeal cancer.

Metastasis is a crucial cause of tumor deterioration. The expression level of NOB1 was reported to be associated with the mortality of cancer cells (24). Downregulation of NOB1 inhibits the migration and invasion of glioma (19), prostate cancer (11) and osteosarcoma (25). Consistent with these reports, in the present study, silencing of NOB1 was found to inhibit the migration and invasion of laryngeal cancer cells. MMPs are crucial enzymes that degrade extracellular matrix and contribute to the migration and invasion of cells. Downregulation of MMP-2 and MMP-9 by NOB1 shRNA was also observed in the present study. Silence of NOB1 was reported to increase the level of E-cadherin (25), which suggests the potential regulatory role of NOB1 in EMT process.

JNK is a member of the mitogen-activated protein kinases (MAPKs) which play important roles in cell proliferation, migration and differentiation. JNK is activated by various stimuli leading to contradictory responses (26), JNK phosphorylates the anti-apoptosis Bcl-2 to promote apoptosis of cells (27) or phosphorylates the pro-apoptotic BAD to inhibit apoptosis (28). In laryngeal cancer cells, JNK plays a pro-apoptotic role (29). In the present study, we found that the NOB1 silence induced the activation of JNK and this indicated that JNK signaling may be involved in the function of NOB1. The activation of P38 was also detected in the present study, but no significant change was found after infection with NOB1 shRNA. These results indicate that P38 signaling may be not involved in the function of NOB1, at least in laryngeal cancer cells. However, Che et al showed that the expression level of NOB1 was associated with the activation of P38, and NOB1 silencing inhibited the expression of P38 in prostate carcinoma (24).

In the present study, silence of NOB1 was found to inhibit the proliferation and migration of laryngeal cancer cells, arrest cell cycle and induce apoptosis, and these functions of NOB1 may be associated with the JNK signaling pathway. NOB1, which is associated with the proliferation, apoptosis and migration of laryngeal cancer cells, may be a promising therapeutic target in the treatment of laryngeal cancer, and it may also show potential as a clinical marker of laryngeal cancer.

Acknowledgments

The present study was supported by grants from the Natural Science Foundation of Liaoning Province (no. 20092135). Ethical approval was given by the Medical Ethics Committee of Shengjing Hospital of China Medical University with the reference no. 2014PS17K.

References

1 

Morshed K, Polz-Dacewicz M, Szymański M and Polz D: Short-fragment PCR assay for highly sensitive broad-spectrum detection of human papillomaviruses in laryngeal squamous cell carcinoma and normal mucosa: Clinico-pathological evaluation. Eur Arch Otorhinolaryngol. 265(Suppl 1): S89–S96. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Jemal A, Siegel R, Ward E, Hao Y, Xu J and Thun MJ: Cancer statistics, 2009. CA Cancer J Clin. 59:225–249. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Ramroth H, Schoeps A, Rudolph E, Dyckhoff G, Plinkert P, Lippert B, Feist K, Delank KW, Scheuermann K, Baier G, et al: Factors predicting survival after diagnosis of laryngeal cancer. Oral Oncol. 47:1154–1158. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Zhang Y, Ni J, Zhou G, Yuan J, Ren W, Shan Y, Tang W, Yu L and Zhao S: Cloning, expression and characterization of the human NOB1 gene. Mol Biol Rep. 32:185–189. 2005. View Article : Google Scholar : PubMed/NCBI

5 

Fatica A, Oeffinger M, Dlakić M and Tollervey D: Nob1p is required for cleavage of the 3′ end of 18S rRNA. Mol Cell Biol. 23:1798–1807. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Fatica A, Tollervey D and Dlakić M: PIN domain of Nob1p is required for D-site cleavage in 20S pre-rRNA. RNA. 10:1698–1701. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Lamanna AC and Karbstein K: Nob1 binds the single-stranded cleavage site D at the 3′-end of 18S rRNA with its PIN domain. Proc Natl Acad Sci USA. 106:14259–14264. 2009. View Article : Google Scholar

8 

Tone Y and Toh-E A: Nob1p is required for biogenesis of the 26S proteasome and degraded upon its maturation in Saccharomyces cerevisiae. Genes Dev. 16:3142–3157. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Veith T, Martin R, Wurm JP, Weis BL, Duchardt-Ferner E, Safferthal C, Hennig R, Mirus O, Bohnsack MT, Wöhnert J, et al: Structural and functional analysis of the archaeal endonuclease Nob1. Nucleic Acids Res. 40:3259–3274. 2012. View Article : Google Scholar :

10 

Li XY, Luo QF, Li J, Wei CK, Kong XJ, Zhang JF and Fang L: Clinical significance of NOB1 expression in breast infiltrating ductal carcinoma. Int J Clin Exp Pathol. 6:2137–2144. 2013.PubMed/NCBI

11 

Zhang X, Zhang D, Qu F, Hong Y, Cao J, Pan X, Li L, Huang Y, Huang H, Yin L, et al: Knockdown of NOB1 expression inhibits the malignant transformation of human prostate cancer cells. Mol Cell Biochem. 396:1–8. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Liu K, Gu MM, Chen HL and You QS: NOB1 in non-small-cell lung cancer: Expression profile and clinical significance. Pathol Oncol Res. 20:461–466. 2014. View Article : Google Scholar

13 

Huang WY, Chen DH, Ning L and Wang LW: siRNA mediated silencing of NIN1/RPN12 binding protein 1 homolog inhibits proliferation and growth of breast cancer cells. Asian Pac J Cancer Prev. 13:1823–1827. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Liu Y, Huang H, Yuan B, Zhuang LY, Luo TP and Zhang Q: Lentivirus-mediated knockdown of NOB1 suppresses the proliferation of colon cancer cells. Z Gastroenterol. 52:429–435. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Lin Y, Peng S, Yu H, Teng H and Cui M: RNAi-mediated down-regulation of NOB1 suppresses the growth and colony-formation ability of human ovarian cancer cells. Med Oncol. 29:311–317. 2012. View Article : Google Scholar

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 25:402–408. 2001. View Article : Google Scholar

17 

Jia JW, Liu AQ, Wang Y, Zhao F, Jiao LL and Tan J: Evaluation of NIN/RPN12 binding protein inhibits proliferation and growth in human renal cancer cells. Tumour Biol. 36:1803–1810. 2015. View Article : Google Scholar

18 

Lu Z, Guo Q, Shi A, Xie F and Lu Q: Downregulation of NIN/RPN12 binding protein inhibit the growth of human hepatocellular carcinoma cells. Mol Biol Rep. 39:501–507. 2012. View Article : Google Scholar

19 

Wang H, Li P and Zhao B: Knockdown of NOB1 expression by RNAi inhibits cellular proliferation and migration in human gliomas. Gene. 528:146–153. 2013. View Article : Google Scholar : PubMed/NCBI

20 

He XW, Feng T, Yin QL, Jian YW and Liu T: NOB1 is essential for the survival of RKO colorectal cancer cells. World J Gastroenterol. 21:868–877. 2015.PubMed/NCBI

21 

Li Y, Ma C, Qian M, Wen Z, Jing H and Qian D: Downregulation of NOB1 suppresses the proliferation and tumor growth of non-small cell lung cancer in vitro and in vivo. Oncol Rep. 31:1271–1276. 2014.PubMed/NCBI

22 

Meng W, Wang PS, Liu J, Xue S, Wang GM, Meng XY and Chen G: Adenovirus-mediated siRNA targeting NOB1 inhibits tumor growth and enhances radiosensitivity of human papillary thyroid carcinoma in vitro and in vivo. Oncol Rep. 32:2411–2420. 2014.PubMed/NCBI

23 

Liu J, Dong BF, Wang PS, Ren PY, Xue S, Zhang XN, Han Z and Chen G: Silencing NOB1 enhances doxorubicin antitumor activity of the papillary thyroid carcinoma in vitro and in vivo. Oncol Rep. 33:1551–1559. 2015.PubMed/NCBI

24 

Che JP, Li W, Yan Y, Liu M, Wang GC, Li QY, Yang B, Yao XD and Zheng JH: Expression and clinical significance of the nin one binding protein and p38 MAPK in prostate carcinoma. Int J Clin Exp Pathol. 6:2300–2311. 2013.PubMed/NCBI

25 

Chen B, Liu J, Wu D, Qin Y, Peng C, Li C and Wang J: Gene silencing of NOB1 by lentivirus suppresses growth and migration of human osteosarcoma cells. Mol Med Rep. 9:2173–2179. 2014.PubMed/NCBI

26 

Bode AM and Dong Z: The functional contrariety of JNK. Mol Carcinog. 46:591–598. 2007. View Article : Google Scholar : PubMed/NCBI

27 

Maundrell K, Antonsson B, Magnenat E, Camps M, Muda M, Chabert C, Gillieron C, Boschert U, Vial-Knecht E, Martinou JC, et al: Bcl-2 undergoes phosphorylation by c-Jun N-terminal kinase/stress-activated protein kinases in the presence of the constitutively active GTP-binding protein Rac1. J Biol Chem. 272:25238–25242. 1997. View Article : Google Scholar : PubMed/NCBI

28 

Yu C, Minemoto Y, Zhang J, Liu J, Tang F, Bui TN, Xiang J and Lin A: JNK suppresses apoptosis via phosphorylation of the proapoptotic Bcl-2 family protein BAD. Mol Cell. 13:329–340. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Brahim S, Aroui S, Abid K and Kenani A: Involvement of C-jun NH2-terminal kinase and apoptosis induced factor in apoptosis induced by deglycosylated bleomycin in laryngeal carcinoma cells. Cell Biol Int. 33:964–970. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao X, Wang J, Bai W, Ji W and Wang L: NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway. Oncol Rep 35: 3313-3320, 2016.
APA
Gao, X., Wang, J., Bai, W., Ji, W., & Wang, L. (2016). NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway. Oncology Reports, 35, 3313-3320. https://doi.org/10.3892/or.2016.4707
MLA
Gao, X., Wang, J., Bai, W., Ji, W., Wang, L."NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway". Oncology Reports 35.6 (2016): 3313-3320.
Chicago
Gao, X., Wang, J., Bai, W., Ji, W., Wang, L."NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway". Oncology Reports 35, no. 6 (2016): 3313-3320. https://doi.org/10.3892/or.2016.4707
Copy and paste a formatted citation
x
Spandidos Publications style
Gao X, Wang J, Bai W, Ji W and Wang L: NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway. Oncol Rep 35: 3313-3320, 2016.
APA
Gao, X., Wang, J., Bai, W., Ji, W., & Wang, L. (2016). NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway. Oncology Reports, 35, 3313-3320. https://doi.org/10.3892/or.2016.4707
MLA
Gao, X., Wang, J., Bai, W., Ji, W., Wang, L."NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway". Oncology Reports 35.6 (2016): 3313-3320.
Chicago
Gao, X., Wang, J., Bai, W., Ji, W., Wang, L."NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway". Oncology Reports 35, no. 6 (2016): 3313-3320. https://doi.org/10.3892/or.2016.4707
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team