Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
May-2017 Volume 37 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2017 Volume 37 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Induction of galectin-1 by TLR-dependent PI3K activation enhances epithelial-mesenchymal transition of metastatic ovarian cancer cells

  • Authors:
    • Ga Bin Park
    • Yoon Hee Chung
    • Daejin Kim
  • View Affiliations / Copyright

    Affiliations: Department of Biochemistry, Kosin University College of Medicine, Busan 49267, Republic of Korea, Department of Anatomy, Chung-Ang University College of Medicine, Seoul 06974, Republic of Korea, Department of Anatomy, Inje University College of Medicine, Busan 47392, Republic of Korea
  • Pages: 3137-3145
    |
    Published online on: March 27, 2017
       https://doi.org/10.3892/or.2017.5533
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The expression of different toll-like receptors (TLRs) on tumor cells has been associated with disease aggressiveness, treatment resistance, and poor prognosis. The phosphatidylinositol 3-kinase (PI3K)/AKT pathway is considered critical for cancer cell survival and proliferation. Thus, we investigated the effect of TLR-stimulated PI3K activation on the epithelial-to-mesenchymal transition (EMT) of primary (Caov-3) and metastatic (SK‑OV‑3) epithelial ovarian cancer cell lines in this study. TLR engagement with various ligands promoted the expression of class IA PI3K (p110α, p110β, and p110δ) and increased the expression of mesenchymal markers (N-cadherin, Slug, Vimentin, Snail, α-SMA, and TCF) in SK‑OV‑3 cells. The migratory activity and secretion of EMT-related cytokines of SK‑OV‑3 were significantly higher compared to those of Caov-3 after activation with TLR agonist. Although the invasive capacity and production of EMT-related cytokines of LPS-stimulated SK‑OV‑3 cells were significantly suppressed by all pharmacological inhibitors of the p110 isoform, the Syk/Src-dependent p110β isoform prominently attenuated migration activity. In contrast, the production of IL-10 and galectin-1 was mainly affected by the p110δ isoform. Gene silencing of TLR4 and galectin-1 with siRNA decreased the expression of matrix metalloproteinase-2 (MMP2) and MMP9 and reduced mesenchymal markers in LPS-treated SK‑OV‑3 cells. This study demonstrated that TLR-mediated PI3K activation modulated the invasion and metastasis of ovarian cancer through the production of galectin-1, suggesting that inhibition of the p110 isoform is a promising therapeutic approach against metastatic ovarian cancer.

Introduction

The epithelial-to-mesenchymal transition (EMT) is a physiological process that occurs during embryogenesis and wound healing in adults (1). During cancer progression, EMT appears to promote dissemination of cells from the tumor mass, facilitating tissue invasion and metastasis (2). Epithelial ovarian cancer is the most common cause of death from gynecologic tumors worldwide; most cases are detected at advanced stages, which are characterized by diverse metastatic lesions (3).

TLRs are usually expressed in immune cells, such as macrophages and dendritic cells (4). However, in addition to their expression in leukocytes, TLRs are found in multiple tumor types, including in ovarian cancer (5). Stimulation of specific TLRs is associated with carcinogenesis, cancer progression, and site-specific metastasis (6,7). Expression of TLR2, 3, 4, and 5 has been detected on the surface epithelium of normal ovaries and benign and malignant ovarian cancers (8). These data suggest that the TLR-mediated signaling pathway plays a role in EMT and metastasis of ovarian cancer; however, the underlying mechanisms of ovarian cancer metastasis related to TLR stimulation remain unclear.

The phosphatidylinositol 3-kinase (PI3K)/AKT pathway is a critical signaling cascade in the progression and drug resistance of human cancer cells (9,10). TLR4-expressing metastatic colorectal cancer cells activate PI3K/AKT signaling and metastatic capacity after stimulation with lipopolysaccharide (LPS) (11). The phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit α (PIK3CA) gene encodes the catalytic subunit p110α of PI3K class IA, which forms dimers with the regulatory subunit p85 of the same enzyme (12). Over-representation of the PIK3CA gene is one of the most frequently reported abnormalities in ovarian carcinogenesis and is thought to be an early event (13). The p110β isoform is also significantly overexpressed both in ovarian cancer patients and paclitaxel-resistant ovarian cancer cell lines (14). However, whether TLR-mediated PI3K-dependent signaling is correlated with invasive capacity dependent of cancer stage and which downstream signaling molecules are triggered in TLR-stimulated ovarian cancer cells remain unclear.

In this study, we investigated the difference in TLR-mediated PI3K signaling activity according to ovarian cancer type using primary (Caov-3) and metastatic (SK-OV-3) ovarian cancer cell lines (15). We also examined which catalytic isoforms of class IA PI3Ks (p110α, p110β, and p110δ) are involved in ovarian cancer metastasis.

Materials and methods

Cell lines

The human ovarian cancer cell lines Caov-3, OVCAR-3, OV-90, and SK-OV-3 were purchased from the ATCC (Manassas, VA, USA). Caov-3 and OVCAR-3 cells, representing primary cancer, were harvested from human ovarian adenocarcinoma confined to the ovary. OV-90 and SK-OV-3 cells, as representative metastatic cancer, were established from ascites derived from ovarian cancer patients. Caov-3 and OV-90 cells were maintained in DMEM medium (Corning Incorporated, Corning, NY, USA) supplemented with 10% FBS (RMBIO, Missoula, MT, USA), penicillin, streptomycin, and glutamine at 37°C in 5% CO2. OVCAR-3 and SK-OV-3 cells were maintained in RPMI-1640 medium (Corning Inc.) supplemented with 10% FBS (RMBIO), penicillin, streptomycin, and glutamine at 37°C in 5% CO2.

Chemicals

LPS (TLR4 ligand) and poly (I:C) (TLR3 ligand) were obtained from Sigma-Aldrich (St. Louis, MO, USA). MALP-2 (TLR2/6 ligand) was purchased from Enzo Life Sciences (Farmingdale, NY, USA). PP1 (Src inhibitor) and Bay 61–3606 (Syk inhibitor) were purchased from Calbiochem (San Diego, CA, USA). A66 (p110α inhibitor), TGX-221 (p110β inhibitor), CAL-101 (p110δ inhibitor), LY294002 (pan-p110 inhibitor), Bay 80–6946 (p110α and p110β inhibitor), and pictilisib (p110α and p110δ inhibitor) were obtained from Selleckchem (Houston, TX, USA). Recombinant Gal-1 was purchased from R&D Systems (Minneapolis, MN, USA).

RT-PCR

Total RNA was isolated using an RNeasy Mini kit (Qiagen, Hilden, Germany). RNA was transcribed into cDNA using oligo (dT) primers (Bioneer, Daejeon, Korea) and reverse transcriptase. To investigate the expression of TLR genes in ovarian cancer cells, PCR amplification was performed using specific primer sets (Table I; Bioneer) and Prime Taq Premix (GeNet Bio, Chungnam, Korea). PCR products were analyzed via agarose gel electrophoresis and visualized with ethidium bromide under UV light using the Multiple Gel DOC system (Fujifilm, Tokyo, Japan). Data were analyzed using ImageJ 1.38 software (National Institutes of Health, Bethesda, MD, USA). Experiments were performed in triplicate.

Table I.

Specific primer sequences used for RT-PCR.

Table I.

Specific primer sequences used for RT-PCR.

Primers, 5′→3′

TargetSenseAntisense
TLR1 CGTAAAACTGGAAGCTTGCAAGA CCTTGGGCCATTCCAAATAAGTCC
TLR2 GGCCAGCAAATTACCTGTGTG CCAGGTAGGTCTTGGTGTTCA
TLR3 ATTGGGTCTGGGAACATTTCTCTTC GTGAGATTTAAACATTCCTCTTCGC
TLR4 CTGCAATGGATCAAGGACCA TCCCACTCCAGGTAAGTGTT
TLR5 CATTGTATGCACTGTCACTC CCACCACCATGATGAGAGCA
TLR6 TAGGTCTCATGACGAAGGAT GGCCACTGCAAATAACTCCG
TLR7 AGTGTCTAAAGAACCTGG CTTGGCCTTACAGAAATG
TLR8 CAGAATAGCAGGCGTAACACATCA AATGTCACAGGTGCATTCAAAGGG
TLR9 TTATGGACTTCCTGCTGGAGGTGC CTGCGTTTTGTCGAAGACCA
TLR10 CAATCTAGAGAAGGAAGATGGTTC GCCCTTATAAACTTGTGAAGGTGT
β-actin ATCCACGAAACTACCTTCAA ATCCACACGGAGTACTTGC
Western blotting

Cells were washed in PBS and lysed in NP-40 buffer (Elpis Biotech, Daejeon, Korea) supplemented with a protease inhibitor cocktail (Sigma-Aldrich). Protein phosphorylation states were preserved through the addition of phosphatase inhibitors (Cocktail II, Sigma-Aldrich) to the NP-40 buffer. Protein concentrations were determined using a BCA assay kit (Pierce, Rockford, IL, USA). Proteins (10 µg/sample) were resolved through SDS-PAGE and then transferred to a nitrocellulose membrane (Millipore Corp., Billerica, MA, USA). Membranes were blocked with 5% skim milk prior to western blot analysis. Chemiluminescence was detected using an ECL kit (Advansta Corp., Menlo Park, CA, USA) and the Multiple Gel DOC system (Fujifilm). The following primary antibodies were used: E-cadherin, N-cadherin, Slug, Snail, Vimentin, α-SMA, TCF8/Zeb1, β-actin, MMP2, MMP9, Myd88, p110α, p110β, p110γ, p110δ, phosphor-p65, p65, Fyn, phospho-Lyn (Tyr507), Lyn, phospho-Src (Tyr416), Src, phospho-Syk (Tyr323), phospho-Syk (Tyr525/526), and Syk (Cell Signaling Technology, Beverly, MA, USA); α-SMA (Bioss, Woburn, MA, USA); and TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, galectin-1, phospho-Fyn (Thr12), phospho-PTEN (Ser380/Thr382/383), and PTEN (Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Small interfering RNA (siRNA) transfection

Experimentally verified human TLR4- and galectin-1-small interfering RNA (siRNA) duplex and negative control-siRNA were obtained from Bioneer. Cells were seeded at a concentration of 1×105 per well in a 96-well plate and grown overnight. Cells were then transfected with 200 nM siRNA using Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Cells were used for further experiments 48 h after transfection.

Quantification of human cytokines by ELISA

A galectin-1 ELISA assay was performed as previously described (16) using capture Ab (200 ng/ml, 100 µl/well; AF1152; R&D Systems), detection Ab (100 ng/ml, 100 µl/well; BAF1152; R&D Systems), and standard recombinant galectin-1 (6–500 pg; R&D Systems). Active TGF-β1, TNF-α, VEGF, IL-6, IL-8, and IL-10 were quantified using a single cytokine ELISA assay kit (R&D Systems). Data are expressed as the average of the biological replicates ± standard deviation (SD).

Invasion assay

Invasion assay was performed using the CultreCoat 96-well Medium BME Cell Invasion assay kit (R&D Systems) according to the manufacturer's protocol. Cells (2.5×104) in serum-free RPMI-1640 or DMEM containing 0.1% FBS were seeded into the upper chamber, and the lower compartment was filled with RPMI-1640 or DMEM containing 10% FBS as a chemoattractant. After incubation for 24 h, non-invading cells on the upper membrane surface were removed with a cotton swab. Invaded cells were stained with calcein-AM and quantified using a microplate reader.

Statistical analysis

Data are expressed as the mean ± standard deviation (SD). Statistical analysis was conducted using one-way analysis of variance. A p-value <0.05 was considered statistically significant.

Results

Stimulation with TLR agonist induces mesenchymal characteristics and invasion activity of SK-OV-3 cells

Using RT-PCR and western blots, we evaluated the expression of TLRs in both primary (Caov-3 and OVCAR-3) and metastatic (OV-90 and SK-OV-3) ovarian cancer cells. mRNA levels of TLR2, 3, 4, 5, 6, 7, and 8 in SK-OV-3 cells were significantly elevated compared to other ovarian cancer cells (Fig. 1A). The protein levels of TLR2, 3, 4, 5, and 6 in SK-OV-3 cells were also upregulated compared to Caov-3 cells (Fig. 1B). Next, we investigated the effects of TLR2/6 agonist macrophage-activating lipopeptide 2 (MALP-2), TLR4 agonist lipopolysaccharide (LPS), and TLR3 agonist polyinosinic-polycytidylic acid (poly I:C) on changes in EMT-related markers and invasion capacity in primary (Caov-3) and metastatic (SK-OV-3) ovarian cancer cells. TLR activation with various TLR agonists considerably increased mesenchymal characteristics (N-cadherin, Slug, Vimentin, Snail, α-SMA, and TCF8) in SK-OV-3 cells compared to Caov-3 cells (Fig. 1C). In addition, LPS stimulation of SK-OV-3 cells increased the population of cells with spindle-shaped morphology compared to LPS-treated Caov-3 cells (Fig. 1D). All TLR agonists significantly increased the migratory capacity of SK-OV-3 cells, but not Caov-3 cells (Fig. 1E). These results suggest that TLR-mediated signaling influences the migratory capacity of metastatic ovarian cancer cell line SK-OV-3.

Figure 1.

TLR expression and the effects of TLR agonist stimulation on ovarian cancer cells. (A) mRNA expression of TLR1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 in ovarian cancer cells was measured using RT-PCR. (B) Protein expression levels of TLR2, 3, 4, 5, 6 and 7 in ovarian cancer cells were measured using western blotting. β-actin was used as a loading control. (C) Cells (1.5×105/well) were cultured with and without TLR agonist [poly (I:C), LPS, or MALP2], and levels of EMT markers (E-cadherin, Snail, α-SMA, Slug, TCF8, N-cadherin, and Vimentin) were determined using western blot analysis. (D) Comparison of morphologic changes in LPS-stimulated ovarian cancer cells. Photographs were taken at ×100 magnification using a digital camera under an inverted phase-contrast microscope (Olympus). (E) The invasiveness of SK-OV-3 cells was enhanced by TLR agonists [poly (I:C), LPS, and MALP2], as determined by a BME cell invasion assay kit. Each value represented the mean ± standard deviation of three measurements. *p<0.01 (SK-OV-3 vs. Caov-3). Results are representative of three independent experiments.

Syk/Src-dependent PI3K activation induces mesenchymal markers in TLR-stimulated SK-OV-3 cells

Next, we investigated whether TLR stimulation with specific ligands induces activation of PI3K. We also examined Syk- and Src-family tyrosine kinase activity because PI3K signaling is modulated via those tyrosine kinases (16,17). The expression of class IA PI3Ks (p110α, p110β, and p110δ) in SK-OV-3 cells was upregulated, as was the expression of MyD88 after stimulation with several TLR ligands; however, MyD88 and the p110β isoform were slightly increased in Caov-3 after engagement with various TLR agonists (Fig. 2A). Although the activity of Syk and Src tyrosine kinases was elevated in LPS-activated SK-OV-3 cells (Fig. 2B), treatment with PP1 (an Src-specific inhibitor) and Bay61-3606 (a Syk-specific inhibitor) efficiently blocked the phosphorylation of tyrosine kinase and the activation of class IA PI3Ks (Fig. 2C). In addition, pharmacological inhibition of Syk and Src tyrosine kinases significantly reduced the expression of EMT-related proteins (Fig. 2D). Our data suggest that Syk/Src-mediated PI3K signal transduction plays an important role in TLR-induced EMT processes of SK-OV-3 cells.

Figure 2.

Syk/Src-dependent PI3K activation induces mesenchymal markers in TLR-stimulated SK-OV-3 cells. (A and B) Cells (1.5×105/well) were cultured with or without TLR3 agonist poly (I:C) (10 µg/ml), TLR4 agonist LPS (500 ng/ml), or TLR2/6 agonist MALP2 (1 µg/ml) for 24 h. Total cell lysates were immunoblotted with the indicated antibodies. β-actin was used as the loading control. (C and D) Cells were pretreated with 200 nM of Src inhibitor PP1 or 200 nM of Syk inhibitor BAY-61-3606 for 2 h and treated with LPS (500 ng/ml) for 24 h. Total cell lysates were immunoblotted with the indicated antibodies. β-actin was used as the loading control. Results are representative of three independent experiments.

TLR-mediated PI3K activation promotes the secretion of EMT-related cytokines in SK-OV-3 cells

We found that SK-OV-3 cells stimulated by TLR agonist activated class IA PI3Ks (p110α, p110β, and p110δ). Next, we investigated the effects of specific PI3K inhibition on invasion and secretion of EMT-related cytokines in LPS-stimulated SK-OV-3 cells. Pretreatment with a specific inhibitor (A66, p110α inhibitor; TGX-221, p110β inhibitor; CAL-101, p110δ inhibitor; LY294002, p110α/β/δ inhibitor; Pictilisib, p110α/δ inhibitor) for each p110 isoform increased the expression of E-cadherin and decreased the expression of mesenchymal markers in LPS-activated SK-OV-3 cells (Fig. 3A). The migratory activity of LPS-stimulated SK-OV-3 cells was significantly suppressed after treatment with all p110 isoform inhibitors (Fig. 3B). In addition, TGX-221 (p110β inhibitor) and Bay-80-6946 (p110α/β inhibitor) had a prominent influence on invasion attenuation (Fig. 3B). EMT, which is driven by a number of growth factors and cytokines, results in loss of epithelial cell polarities and connections (18). To determine EMT-related cytokine secretion in ovarian cancer cells after TLR stimulation, we compared the concentrations of transforming growth factor β-1 (TGF-β1), vascular endothelial growth factor (VEGF), interleukin-6 (IL-6), IL-8, IL-10, and tumor necrosis factor-α (TNF-α) using a sandwich ELISA method with the culture media in TLR agonist-triggered SK-OV-3 and Caov-3 cells. TGF-β1 and TNF-α, critical cytokines for EMT, were markedly increased in the culture media of SK-OV-3 cells after stimulation with various TLR agonists, whereas those cytokines were barely detectable in the Caov-3 culture media (Fig. 3C). Other cytokines (VEGF, IL-6, IL-8, and IL-10) associated with invasive activity were also ~3-5-fold higher than those in non-TLR stimulated SK-OV-3 (Fig. 3C). Although all p110 isoform inhibitors prevented the secretion of EMT-related cytokines, treatment with TGX-221 or Bay-80-6946 prevented the secretion of EMT-related cytokines most effectively, except for production of IL-10, which was affected by CAL-101 or Pictilisib (Fig. 3D). Our data suggest that TLR-mediated PI3K signaling influences the migratory capacity and secretion of EMT-related cytokines in metastatic ovarian cancer cells.

Figure 3.

TLR-induced PI3K activation promotes invasion and EMT-related cytokine production in SK-OV-3 cells. SK-OV-3 cells (1.5×105/well) were pretreated with p110α inhibitor A66 (50 µM), p110β inhibitor TGX-221 (50 µM), p110δ inhibitor CAL-101 (50 µM), Pan PI3K inhibitor LY294002 (50 µM), p110α/β inhibitor Bay80-6946 (200 nM), or p110α/δ inhibitor Pictilisib (200 nM) for 2 h. Then cells were treated with LPS (500 ng/ml) for 24 h. (A) Total cell lysates were immunoblotted with the indicated antibodies. β-actin served as the loading control. (B) The invasiveness of SK-OV-3 cells was inhibited by A66, TGX-221, CAL-101, LY294002, Bay80-6946, or Pictilisib as detected by BME cell invasion assay. Each value represents the mean ± SD of three measurements. *p<0.01 (SK-OV-3+LPS vs. the group treated with each inhibitor). (C) TLR agonists [poly (I:C), LPS, and MALP2] induced the secretion of IL-8, IL-10, VEGF, IL-6, TNF-α, or active TGF-β1. Cells were seeded onto 6-well plates (1.5×105/well) and incubated overnight. Culture supernatants were collected at 24 h after TLR agonist [poly (I:C), LPS, and MALP2] stimulation, and the amounts of IL-8, IL-10, VEGF, IL-6, TNF-α, or active TGF-β1 were determined by ELISA. Data are representative of two independent experiments and show the mean ± standard deviation of duplicate determinations. **p<0.001 (SK-OV-3 vs. Caov-3). (D) SK-OV-3 cells (1.5×105/well) were pretreated with p110α inhibitor A66 (50 µM), p110β inhibitor TGX-221 (50 µM), p110δ inhibitor CAL-101 (50 µM), Pan PI3K inhibitor LY294002 (50 µM), p110α/β inhibitor Bay80-6946 (200 nM), or p110α/δ inhibitor Pictilisib (200 nM) for 2 h, and then the cells were stimulated with LPS for 24 h. The amounts of IL-8, IL-10, VEGF, IL-6, TNF-α, or active TGF-β1 in culture supernatant were determined by ELISA. Data are representative of two independent experiments and show the mean ± standard deviation of duplicate measurements. #p<0.005 (SK-OV-3+LPS vs. the group treated with each inhibitor). Results are representative of three independent experiments.

TLR4-mediated PI3K activation promotes galectin-1 production in LPS-stimulated SK-OV-3

Galectin-1 is involved in cancer progression and is associated with a poor prognosis in ovarian cancers (19). We determined the effects of TLR agonists on the production of galectin-1 and investigated the association between activation of PI3K and galectin-1 in ovarian cancer cells. TLR activation using a specific ligand significantly increased the expression of galectin-1, MMP2, and MMP9 in SK-OV-3 cells compared to Caov-3 cells (Fig. 4A and B). Expression in LPS-stimulated SK-OV-3 was suppressed after treatment with an inhibitor of Src (PP1) or Syk (Bay-61-3606) tyrosine kinase (Fig. 4C). Pharmacological inhibition of various p110 isoforms also prevented the expression of galectin-1 (Fig. 4D). In particular, CAL-101 (p110δ inhibitor) and Pictilisib (p110α/δ inhibitor) markedly blocked the production of galectin-1 in LPS-activated SK-OV-3 cells compared to the level of other p110 inhibitors (Fig. 4E). Our data suggest that PI3K-dependent galectin-1 production is one of the main pathways of ovarian cancer metastasis after TLR stimulation.

Figure 4.

TLR-stimulated PI3K signaling regulates galectin-1 production in SK-OV-3 cells. (A) Cells (1.5×105/well) were cultured with or without TLR3 agonist poly (I:C) (10 µg/ml), TLR4 agonist LPS (500 ng/ml), or TLR2/6 agonist MALP2 (1 µg/ml) for 24 h. Total cell lysates were immunoblotted with antibody against galectin-1 (Gal-1), MMP2, or MMP9. (B) Culture supernatant was collected 24 h after TLR agonist (poly (I:C), LPS, and MALP2) stimulation, and the amounts of galectin-1 (Gal-1) were determined by ELISA. Data are representative of two independent experiments and show the mean ± standard deviation of duplicate measurements. *p<0.001 (SK-OV-3 vs. Caov-3). (C) Cells were pretreated with Src inhibitor PP1 (200 nM) or Syk inhibitor BAY-61-3606 (200 nM) and then treated with LPS (500 ng/ml) for 24 h. Total cell lysates were immunoblotted with antibody against galectin-1 (Gal-1). β-actin served as the loading control. (D) Cells were pretreated with p110α inhibitor A66 (50 µM), p110β inhibitor TGX-221 (50 µM), p110δ inhibitor CAL-101 (50 µM), Pan PI3K inhibitor LY294002 (50 µM), p110α/β inhibitor Bay80-6946 (200 nM), or p110α/δ inhibitor Pictilisib (200 nM) for 2 h and then treated with LPS (500 ng/ml) for 24 h. Total cell lysates were immunoblotted with antibody against galectin-1 (Gal-1). β-actin was used as the loading control. (E) Culture supernatant was collected 24 h after LPS stimulation, and the amount of galectin-1 (Gal-1) was determined by ELISA. Data are representative of two independent experiments and show the mean ± standard deviation of duplicate measurements. **p<0.005 (SK-OV-3+LPS vs. the group treated with CAL-101 or Pictilisib).

TLR4-mediated galectin-1 production induces EMT of ovarian cancer cells

Next, we investigated whether a TLR4-induced signaling pathway regulates galectin-1-mediated migration of ovarian cancer cells. Stimulation with LPS of TLR4-knockdown SK-OV-3 cells failed to increase the production of galectin-1 and the expression of MMP2, MMP9, and mesenchymal markers (Figs. 5A and B). Treatment with recombinant galectin-1 (r-Gal-1) enhanced the wound healing capacity of TLR4-knockdown SK-OV-3 cells regardless of TLR4 expression or LPS stimulation (Fig. 5C). In addition, targeted inhibition of TLR4 blocked the phosphorylation of Src/Syk kinase and the activation of PI3K in LPS-activated HCT116 cells (Fig. 5D). Finally, we investigated whether TLR4-mediated galectin-1 production affects migration and the expression of mesenchymal markers. Downregulation of galectin-1 with small interfering RNA attenuated the activation of MMP2 and MMP9, and the upregulation of mesenchymal markers in LPS-stimulated SK-OV-3 cells (Fig. 5E). Furthermore, the invasion capacity of galectin-1-knockdown SK-OV-3 cells was profoundly suppressed after stimulation with LPS (Fig. 5F). These results suggest that TLR4-mediated PI3K activation triggers the migratory and invasive capacity of ovarian cancer cells through the production of galectin-1.

Figure 5.

TLR4-mediated galectin-1 production regulates migration and invasion activity in SK-OV-3 cells. TLR4-knockdown SK-OV-3 cells and SK-OV-3 cells transfected with control-siRNA were stimulated with LPS (500 ng/ml) for 24 h. (A and D) Total cell lysates were collected and immunoblotted with the indicated antibodies. (B) Culture supernatant was collected 24 h after LPS stimulation, and the amounts of galectin-1 were determined by ELISA. Data are representative of two independent experiments and show the mean ± standard deviation of duplicate measurements. *p<0.005. (C) Comparison of migratory activity of control cells and TLR4-knockdown SK-OV-3 cells after stimulation with recombinant galectin-1 (r-Gal-1). Photographs were taken at ×100 magnification using a digital camera under an inverted phase-contrast microscope (Olympus). (E) After transfection with either galectin-1-siRNA or control-siRNA for 48 h, protein levels in SK-OV-3 cells were detected by western blotting with the indicated antibodies. (F) The invasiveness of SK-OV-3 cells was inhibited by galectin-1 silencing, as detected by BME cell invasion assay. Each value represents the mean ± SD of three determinations. **p<0.05. Results are representative of three independent experiments.

Discussion

TLR activation in leukocytes at the tumor site can stimulate immune cells that can actively fight tumors (20,21); however, their activation can also have tumor-promoting effects (22). Generally, high levels of different TLRs in cancer cells are associated with disease aggressiveness, drug resistance, and poor clinical outcomes (23,24). Administration of paclitaxel with a platinum regimen via an intravenous or intraperitoneal route is the standard chemotherapy for ovarian cancer (25). Unfortunately, paclitaxel stimulates the same signaling pathway via TLR4 to promote secretion of pro-inflammatory cytokines (26). LPS or paclitaxel binding to TLR4 in SK-OV-3 cells promotes IL-6, IL-8, and VEGF production and resistance to drug-induced apoptosis (27). In addition, our study showed that the expression of TLR4 was more prominent in SK-OV-3 than in Caov-3 cells and stimulation with various TLR ligands induced higher expression of mesenchymal markers and invasive activity in SK-OV-3 than in Caov-3 cells. These results suggest that remnant or resistant ovarian cancer cells could use this anticancer drug to promote survival and growth after chemotherapy. Based on these results, TLR levels and expression changes might be critical diagnostic markers in metastatic ovarian cancer.

Stimulation of TLR4 with LPS results in an immediate interaction between PI3K and MyD88, leading to the phosphorylation of AKT (28). Aberrant activation of this pathway has been widely reported in many human cancers, including ovarian cancer (29). Meanwhile, phosphatase and tensin homolog (PTEN), a negative regulator of the AKT signaling pathway, delays the time to progression in ovarian carcinomas and prolongs disease-free survival (30). We observed that Syk/Src-dependent class IA (p110α, p110β, and p110δ) PI3K activation and expression of mesenchymal markers were significantly increased in TLR-stimulated SK-OV-3 cells; however, the level of PTEN in Caov-3 cells was maintained at a high level after stimulation with TLR agonist. These results suggest that metastatic or invasive ovarian cancer cell lines including SK-OV-3 cells are sensitive to stimulation by TLR ligands, which could lead to the development of aggressive phenotypes.

Although p110α expression is frequently observed in ovarian cancer (13), the levels of p110β, but not p110α, in ovarian cancer cells are critical factors of drug resistance (14). Other studies also have shown that manifestation of p110α has no clear relationship with clinical outcome (31). SK-OV-3 cells secrete a higher level of VEGF than Caov-3 cells (32). TLR4-mediated class I PI3K activation in LPS-mediated SK-OV-3 cells is positively correlated with the secretion of EMT-related cytokines in SK-OV-3 cells. Interestingly, selective inhibitor of p110α or p110β significantly reduced EMT-related cytokines and targeted co-inhibition of p110α/β was the most effective method of reducing EMT-inducing cytokines (TGF-β1, TNF-α, VEGF, IL-6 and IL-8), except IL-10. IL-10 production was efficiently blocked by CAL-101, a p110δ-specific inhibitor, compared to that of LPS-activated SK-OV-3 cells treated with other inhibitors of the p110 isoform. These results suggest that co-administration of anticancer drugs with selective PI3K inhibitors during repeated chemotherapy cycles according to serum cytokine levels in patients could reduce the possibility of metastasis. Furthermore, we need to investigate the signaling pathway to identify precise targets of each condition and need to classify activated p110 isoform- and EMT-associated cytokines in metastatic cancer cells for clinical applications.

Galectin-1 is considered a prototypical galectin and is expressed in many tumor types such as astrocytoma, melanoma, and prostate, thyroid, colon, bladder, and ovarian cancers (33,34). Based on these results, galectin-1 might be a promising candidate for downstream targeting of the TLR/PI3K-mediated signaling pathway in metastatic ovarian cancer. Pharmacological inhibition of PI3K effectively blocked the secretion of galectin-1 in LPS-treated SK-OV-3 cells. Furthermore, knockdown of TLR4 or galectin-1 with siRNA not only suppressed the expression of mesenchymal markers MMP2, and MMP9, but also inhibited invasion activity of LPS-activated SK-OV-3 cells. These results suggest that TLR/PI3K-induced galectin-1 production in ovarian cancer cells is one of the key processes in further invasion and migration.

In conclusion, this study suggests that the TLR/PI3K signaling axis plays a crucial role in facilitating ovarian cancer cell metastasis, and the identification of new molecular targets after TLR engagement is critical for predicting disease progression and clinical outcome.

Acknowledgements

This study was supported by the Basic Science Research Program of Ministry of Education (NRF-2015R1D1A1A 01056672) and Ministry of Science, ICT and Future Planning (NRF-2015R1C1A2A01053732) through the National Research Foundation (NRF) of Korea.

References

1 

Thiery JP: Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2:442–454. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Sabe H: Cancer early dissemination: Cancerous epithelial-mesenchymal transdifferentiation and transforming growth factor β signalling. J Biochem. 149:633–639. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Vaughan S, Coward JI, Bast RC Jr, Berchuck A, Berek JS, Brenton JD, Coukos G, Crum CC, Drapkin R, Etemadmoghadam D, et al: Rethinking ovarian cancer: Recommendations for improving outcomes. Nat Rev Cancer. 11:719–725. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Akira S, Takeda K and Kaisho T: Toll-like receptors: Critical proteins linking innate and acquired immunity. Nat Immunol. 2:675–680. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Sato Y, Goto Y, Narita N and Hoon DS: Cancer cells expressing toll-like receptors and the tumor microenvironment. Cancer Microenviron. 2:(Suppl 1). 205–214. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Chochi K, Ichikura T, Kinoshita M, Majima T, Shinomiya N, Tsujimoto H, Kawabata T, Sugasawa H, Ono S, Seki S, et al: Helicobacter pylori augments growth of gastric cancers via the lipopolysaccharide-toll-like receptor 4 pathway whereas its lipopolysaccharide attenuates antitumor activities of human mononuclear cells. Clin Cancer Res. 14:2909–2917. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Fukata M, Chen A, Vamadevan AS, Cohen J, Breglio K, Krishnareddy S, Hsu D, Xu R, Harpaz N, Dannenberg AJ, et al: Toll-like receptor-4 promotes the development of colitis-associated colorectal tumors. Gastroenterology. 133:1869–1881. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Zhou M, McFarland-Mancini MM, Funk HM, Husseinzadeh N, Mounajjed T and Drew AF: Toll-like receptor expression in normal ovary and ovarian tumors. Cancer Immunol Immunother. 58:1375–1385. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Yu HG, Ai YW, Yu LL, Zhou XD, Liu J, Li JH, Xu XM, Liu S, Chen J, Liu F, et al: Phosphoinositide 3-kinase/Akt pathway plays an important role in chemoresistance of gastric cancer cells against etoposide and doxorubicin induced cell death. Int J Cancer. 122:433–443. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Cantley LC: The phosphoinositide 3-kinase pathway. Science. 296:1655–1657. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Hsu RY, Chan CH, Spicer JD, Rousseau MC, Giannias B, Rousseau S and Ferri LE: LPS-induced TLR4 signaling in human colorectal cancer cells increases beta1 integrin-mediated cell adhesion and liver metastasis. Cancer Res. 71:1989–1998. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Shayesteh L, Lu Y, Kuo WL, Baldocchi R, Godfrey T, Collins C, Pinkel D, Powell B, Mills GB and Gray JW: PIK3CA is implicated as an oncogene in ovarian cancer. Nat Genet. 21:99–102. 1999. View Article : Google Scholar : PubMed/NCBI

13 

Sham JS, Tang TC, Fang Y, Sun L, Qin LX, Wu QL, Xie D and Guan XY: Recurrent chromosome alterations in primary ovarian carcinoma in Chinese women. Cancer Genet Cytogenet. 133:39–44. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Jeong JY, Kim KS, Moon JS, Song JA, Choi SH, Kim KI, Kim TH and An HJ: Targeted inhibition of phosphatidyl inositol-3-kinase p110β, but not p110α, enhances apoptosis and sensitivity to paclitaxel in chemoresistant ovarian cancers. Apoptosis. 18:509–520. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Vergara D, Merlot B, Lucot JP, Collinet P, Vinatier D, Fournier I and Salzet M: Epithelial-mesenchymal transition in ovarian cancer. Cancer Lett. 291:59–66. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Kurosaki T, Takata M, Yamanashi Y, Inazu T, Taniguchi T, Yamamoto T and Yamamura H: Syk activation by the Src-family tyrosine kinase in the B cell receptor signaling. J Exp Med. 179:1725–1729. 1994. View Article : Google Scholar : PubMed/NCBI

17 

Beitz LO, Fruman DA, Kurosaki T, Cantley LC and Scharenberg AM: SYK is upstream of phosphoinositide 3-kinase in B cell receptor signaling. J Biol Chem. 274:32662–32666. 1999. View Article : Google Scholar : PubMed/NCBI

18 

Guarino M, Rubino B and Ballabio G: The role of epithelial-mesenchymal transition in cancer pathology. Pathology. 39:305–318. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Kim HJ, Jeon HK, Cho YJ, Park YA, Choi JJ, Do IG, Song SY, Lee YY, Choi CH, Kim TJ, et al: High galectin-1 expression correlates with poor prognosis and is involved in epithelial ovarian cancer proliferation and invasion. Eur J Cancer. 48:1914–1921. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Scarlett UK, Cubillos-Ruiz JR, Nesbeth YC, Martinez DG, Engle X, Gewirtz AT, Ahonen CL and Conejo-Garcia JR: In situ stimulation of CD40 and Toll-like receptor 3 transforms ovarian cancer-infiltrating dendritic cells from immunosuppressive to immunostimulatory cells. Cancer Res. 69:7329–7337. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Scarlett UK, Rutkowski MR, Rauwerdink AM, Fields J, Escovar-Fadul X, Baird J, Cubillos-Ruiz JR, Jacobs AC, Gonzalez JL, Weaver J, et al: Ovarian cancer progression is controlled by phenotypic changes in dendritic cells. J Exp Med. 209:495–506. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Liu WT, Jing YY, Yu GF, Han ZP, Yu DD, Fan QM, Ye F, Li R, Gao L, Zhao QD, et al: Toll like receptor 4 facilitates invasion and migration as a cancer stem cell marker in hepatocellular carcinoma. Cancer Lett. 358:136–143. 2015. View Article : Google Scholar : PubMed/NCBI

23 

He W, Liu Q, Wang L, Chen W, Li N and Cao X: TLR4 signaling promotes immune escape of human lung cancer cells by inducing immunosuppressive cytokines and apoptosis resistance. Mol Immunol. 44:2850–2859. 2007. View Article : Google Scholar : PubMed/NCBI

24 

Kelly MG, Alvero AB, Chen R, Silasi DA, Abrahams VM, Chan S, Visintin I, Rutherford T and Mor G: TLR-4 signaling promotes tumor growth and paclitaxel chemoresistance in ovarian cancer. Cancer Res. 66:3859–3868. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Alberts DS, Liu PY, Hannigan EV, O'Toole R, Williams SD, Young JA, Franklin EW, Clarke-Pearson DL, Malviya VK, DuBeshter B, et al: Intraperitoneal cisplatin plus intravenous cyclophosphamide versus intravenous cisplatin plus intravenous cyclophosphamide for stage III ovarian cancer. N Engl J Med. 335:1950–1955. 1996. View Article : Google Scholar : PubMed/NCBI

26 

Byrd-Leifer CA, Block EF, Takeda K, Akira S and Ding A: The role of MyD88 and TLR4 in the LPS-mimetic activity of Taxol. Eur J Immunol. 31:2448–2457. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Szajnik M, Szczepanski MJ, Czystowska M, Elishaev E, Mandapathil M, Nowak-Markwitz E, Spaczynski M and Whiteside TL: TLR4 signaling induced by lipopolysaccharide or paclitaxel regulates tumor survival and chemoresistance in ovarian cancer. Oncogene. 28:4353–4363. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Laird MH, Rhee SH, Perkins DJ, Medvedev AE, Piao W, Fenton MJ and Vogel SN: TLR4/MyD88/PI3K interactions regulate TLR4 signaling. J Leukoc Biol. 85:966–977. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Kang S, Bader AG and Vogt PK: Phosphatidylinositol 3-kinase mutations identified in human cancer are oncogenic. Proc Natl Acad Sci USA. 102:802–807. 2005. View Article : Google Scholar : PubMed/NCBI

30 

Schöndorf T, Göhring UJ, Roth G, Middel I, Becker M, Moser N, Valter MM and Hoopmann M: Time to progression is dependent on the expression of the tumour suppressor PTEN in ovarian cancer patients. Eur J Clin Invest. 33:256–260. 2003. View Article : Google Scholar : PubMed/NCBI

31 

Wang Y, Kristensen GB, Helland A, Nesland JM, Børresen-Dale AL and Holm R: Protein expression and prognostic value of genes in the erb-b signaling pathway in advanced ovarian carcinomas. Am J Clin Pathol. 124:392–401. 2005. View Article : Google Scholar : PubMed/NCBI

32 

Sher I, Adham SA, Petrik J and Coomber BL: Autocrine VEGF-A/KDR loop protects epithelial ovarian carcinoma cells from anoikis. Int J Cancer. 124:553–561. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Satelli A and Rao US: Galectin-1 is silenced by promoter hypermethylation and its re-expression induces apoptosis in human colorectal cancer cells. Cancer Lett. 301:38–46. 2011. View Article : Google Scholar : PubMed/NCBI

34 

Ito K and Ralph SJ: Inhibiting galectin-1 reduces murine lung metastasis with increased CD4(+) and CD8(+) T cells and reduced cancer cell adherence. Clin Exp Metastasis. 29:561–572. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Park GB, Chung YH and Kim D: Induction of galectin-1 by TLR-dependent PI3K activation enhances epithelial-mesenchymal transition of metastatic ovarian cancer cells. Oncol Rep 37: 3137-3145, 2017.
APA
Park, G.B., Chung, Y.H., & Kim, D. (2017). Induction of galectin-1 by TLR-dependent PI3K activation enhances epithelial-mesenchymal transition of metastatic ovarian cancer cells. Oncology Reports, 37, 3137-3145. https://doi.org/10.3892/or.2017.5533
MLA
Park, G. B., Chung, Y. H., Kim, D."Induction of galectin-1 by TLR-dependent PI3K activation enhances epithelial-mesenchymal transition of metastatic ovarian cancer cells". Oncology Reports 37.5 (2017): 3137-3145.
Chicago
Park, G. B., Chung, Y. H., Kim, D."Induction of galectin-1 by TLR-dependent PI3K activation enhances epithelial-mesenchymal transition of metastatic ovarian cancer cells". Oncology Reports 37, no. 5 (2017): 3137-3145. https://doi.org/10.3892/or.2017.5533
Copy and paste a formatted citation
x
Spandidos Publications style
Park GB, Chung YH and Kim D: Induction of galectin-1 by TLR-dependent PI3K activation enhances epithelial-mesenchymal transition of metastatic ovarian cancer cells. Oncol Rep 37: 3137-3145, 2017.
APA
Park, G.B., Chung, Y.H., & Kim, D. (2017). Induction of galectin-1 by TLR-dependent PI3K activation enhances epithelial-mesenchymal transition of metastatic ovarian cancer cells. Oncology Reports, 37, 3137-3145. https://doi.org/10.3892/or.2017.5533
MLA
Park, G. B., Chung, Y. H., Kim, D."Induction of galectin-1 by TLR-dependent PI3K activation enhances epithelial-mesenchymal transition of metastatic ovarian cancer cells". Oncology Reports 37.5 (2017): 3137-3145.
Chicago
Park, G. B., Chung, Y. H., Kim, D."Induction of galectin-1 by TLR-dependent PI3K activation enhances epithelial-mesenchymal transition of metastatic ovarian cancer cells". Oncology Reports 37, no. 5 (2017): 3137-3145. https://doi.org/10.3892/or.2017.5533
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team