Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
December-2017 Volume 38 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2017 Volume 38 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Deubiquitinase USP9X promotes cell migration, invasion and inhibits apoptosis of human pancreatic cancer

  • Authors:
    • Li Liu
    • Dan Yao
    • Pengbo Zhang
    • Weichao Ding
    • Xiuzhong Zhang
    • Chong Zhang
    • Shuai Gong
    • Yi Zhang
    • Jike Wang
    • Ting Sun
    • Zeqiang Ren
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, The Affiliated Hospital of Xuzhou Medical University, Xuzhou, Jiangsu 221002, P.R. China, Department of Gastrointestinal Surgery, Huai'an Second People's Hospital, Huaian, Jiangsu 223000, P.R. China
  • Pages: 3531-3537
    |
    Published online on: October 20, 2017
       https://doi.org/10.3892/or.2017.6050
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Ubiquitin specific peptidase 9, X-linked (USP9X), a significant regulatory protease in protein ubiquitination, has been proven to act as a proto-oncogene in several types of cancers, such as cervix, colon, breast, brain and lung cancers. The prognosis of patients with pancreatic ductal adenocarcinoma (PDAC) is extremely poor due to its high invasive and metastatic abilities. Nevertheless, whether USP9X acts as a proto-oncogene or a tumor-suppressor gene in PDAC is controversial and the mechanism of metastasis remains unknown. The present study focused on the effect of USP9X on the migration, invasion and apoptosis of PADC cells. We analyzed the expression of USP9X in pancreatic cancer tissues of different pathologic grades by immunohistochemical analysis. USP9X expression in the pancreatic cancer tissues was markedly increased in contrast to that noted in the adjacent non-tumor tissues. USP9X expression in PANC-1 cells was downregulated after transfection of shRNA-USP9X. Knockdown of endogenous USP9X expression evidently inhibited the migration and invasion of PANC-1 cells, and promoted cell apoptosis. Meanwhile, expression levels of Snail, Twist, N-cadherin and vimentin were downregulated. E-cadherin expression was negatively correlated with USP9X expression and the expression of survivin was also downregulated in the PANC-1 cells. In brief, USP9X promoted the migration and invasion of PANC-1 cells probably by provoking epithelial-mesenchymal transition, and also inhibited apoptosis. We believe that USP9X is a major oncogene that may play a significant role in the treatment and prognosis of PDAC.

Introduction

Pancreatic neoplasms are highly malignant tumors and a major cause of cancer-related mortality worldwide (1). The majority of pancreatic carcinomas are pancreatic ductal adenocarcinomas (PDACs). In recent years, the 5-year survival rate of PDAC patients has not significantly improved, and remains at ~6% (2). The prognosis of PDAC is extremely poor, which is mostly ascribed to the fast growth, high migration, invasiveness and recurrence rates (3). To improve the efficiency of pancreatic cancer treatment, researchers must aim to understand the mechanisms underlying the migration, invasion and apoptosis of PDAC.

Ubiquitin specific peptidase 9, X-linked (USP9X), a deubiquitination enzyme, is a multifunctional post-translational modifier that regulates many aspects of cell physiology (4,5), such as DNA repair, and regulation of cell cycle and several signaling pathways. USP9X expression constantly changes in tumor progression (6,7). Abnormal USP9X expression has been confirmed in several neoplasms, including lymphoma (8), colorectal cancer (9) and hepatocellular carcinoma (10). However, whether USP9X acts as a proto-oncogene or tumor-suppressor gene in pancreatic cancer cells is still controversial. Cox et al reported that USP9X possesses growth promotor functions in several established pancreatic cell lines (11), while Pérez-Mancera et al states that USP9X acts as a tumor-suppressor gene at the early stage of PDAC formation in mice (12). Thus, the concrete mechanism remains unclear as to how USP9X regulates PDAC development. In the present study, we discussed the effect of USP9X on epithelial-mesenchymal transition (EMT) in PANC-1 cells, aiming to understand its effect on cell migration and invasion. In terms of apoptosis, we observed the effect of USP9X downregulation on survivin expression.

EMT is a bio-process in which epithelial cells are transformed via specific procedures into a mesenchymal phenotype, and it is the molecular basis underlying the occurrence, invasion and metastasis of tumors (13). EMT plays an important role in the metastasis and invasion of neoplasms (14). It has been confirmed that EMT can be promoted by Snail and Twist genes, which induce the migration and invasion of tumor cells (15,16). However, the specific connection between USP9X and EMT in PDAC and the effect of USP9X on PDAC remain poorly understood.

Survivin, which is highly inhibitory against cell apoptosis, was first identified at Altieri Laboratory of Yale University in 1997 by screening a human genomic library using effector cell protease receptor-1 (17). The bio-functions of survivin mainly involve the regulation of the cell cycle and stress response, mitosis promotion, cell and vascular proliferation, apoptosis inhibition and cancer cell autophagy regulation (18). However, high survivin expression has been detected in several tumors (19). Liu et al found that survivin is degraded by the ubiquitin proteasome pathway (20). Yet, the relationship between survivin and USP9X in pancreatic cancer is also unknown.

In the present study, we demonstrated that USP9X acts as a tumor metastasis supporter in PANC-1 cells, and downregulation of USP9X expression inhibited the migration and invasion of PANC-1 cells, while high expression of USP9X inhibited the apoptosis of PANC-1 cells. Therefore, USP9X functioned as an oncogene in PANC-1 cells and is closely related with the expression of Snail, Twist and survivin.

Materials and methods

Patients and samples

Tumor and paired adjacent non-tumor tissues for immunohistochemical (IHC) analysis were obtained from 55 patients with malignant pancreatic tumors, who underwent surgical resection at The Affiliated Hospital of Xuzhou Medical University between 2009 and 2012 (Table I). None of the patients received chemotherapy or radiotherapy before surgery. Written informed consent was received from all patients or relevant family members. The present study was approved by the Ethics Committee of The Affiliated Hospital of Xuzhou Medical University.

Table I.

Clinicopathological association of USP9X expression in pancreatic cancer tissues.

Table I.

Clinicopathological association of USP9X expression in pancreatic cancer tissues.

USP9X expression

VariablesNo. of casesHigh n (%)Low n (%)P-value
  Age (years) 0.803
  <602515 (27.27)10 (18.18)
  ≥603017 (30.09)13 (23.63)
Sex 0.444
  Male3220 (36.36)12 (26.63)
  Female2312 (26.63)11 (20.00)
Tumor size (cm) 0.262
  <4.02416 (29.09)  8 (14.55)
  ≥4.03116 (29.09)15 (27.27)
Grade 0.019
  High  72 (3.64)5 (9.09)
  Middle3418 (32.73)16 (29.09)
  Low1412 (26.63)2 (3.64)
Lymph node status (metastasis) 0.002
  Yes2017 (30.90)3 (5.45)
  No3515 (27.27)20 (36.36)
TNM stagea 0.006
  I25  9 (16.36)16 (29.09)
  II2822 (40.00)  6 (10.91)
  IV  21 (1.82)1 (1.82)

a Cancer staging was carried out according to the International Union against Cancer (UIAC) tumor-node-metastasis (TNM) system.

Cell culture and treatment

PANC-1, a human pancreatic cancer cell line, was provided by Professor Changqing Su (Shanghai Oriental Hepatic Hospital of China). The cells were first cultured in Dulbecco's modified Eagles medium (DMEM) containing 10% fetal bovine serum (FBS) (both from HyClone, Shanghai, China), 100 µg/ml streptomycin and 100 U/ml penicillin. Then, the cells were routinely incubated in a humidified atmosphere at 37°C in 5% CO2. The medium was refreshed every two days. Cell digestion and passage were conducted using 0.25% trypsin.

IHC analysis

Paraffin-embedded specimens were stained according to the kit manual. The primary antibody was anti-USP9X [1:1,000; Cell Signaling Technology (CST), Beverly, MA, USA]. In the IHC analysis, the staining intensity was rated as follows: 0, 1, 2 and 3 points: negative, weak, moderate and strong intensity, respectively (21). The percentage of positively-stained cells was rated as follows: 0, 1, 2, 3 and 4 points: 0, 1–10, 11–50, 51–80 and >80%, respectively. Then, the total score of immunoreactivity for each case was determined by multiplying the two sub-scores above. The average score from all five random fields at a magnification of ×400 was used as the histological score. Tumors were categorized by the histological score into a negative group (≤4) and a positive group (>4). The results were analyzed using Chi-square test.

shRNA transfection

USP9X-treated cells were plated into 6-well plates (3.0×105 cells/well), for 24 h of adherence, and then transfected with shRNA (GenePharma, Shanghai, China; shRNA group) using SiLenFect (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The sequence of shRNA was: GCTGCT AGGTTCCTCTTTCAAGAGAAGTAAAGAGGAACCTAG CAGCTT. In the vector group, the cells were transfected with NC-shRNA in the same way following the manufacturer's instructions. After 24 h, the media were refreshed. After 48 h, the cells were harvested for subsequent experiments.

Wound-healing assay

For the wound-healing assays, PANC-1 cells transfected according to the above-mentioned method were seeded in 6-well plates at a density of 2×106/well. After 24 h, the monolayers were scratched with a sterile pipette tip, followed by addition of serum-free medium. The sizes of the wounds were photographed at 0, 12, and 24 h separately. Each experiment was performed in triplicate.

Protein isolation and western blotting

The cultured PANC-1 cells were lysed by a modified radio-immunoprecipitation assay (RIPA) buffer (Shanghai, China) containing 0.5 M pheylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Complete Mini; Mannheim, Germany). Then, the homogenates were lysed on ice for 30 min. The lysates were centrifuged at 4°C for 15 min and the supernatants were extracted. Total proteins were quantified with a bicinchoninic acid (BCA) protein assay kit (Pierce, Thermo Fisher Scientific, Inc., Waltham, MA, USA). For western blotting, protein samples (50 µg) were loaded onto 8 or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and were then transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA, USA). Then, the membranes were blocked with 5% non-fat milk at room temperature for 1 h, and incubated with primary antibodies overnight at 4°C, including anti-USP9X (1:1,000; CST), anti-survivin (1:200; Bioworld Technology, Nanjing, China), anti-Twist (1:1,000), anti-Snail (1:1,000), anti-N-cadherin (1:1,000), anti-vimentin (1:1,500), anti-E-cadherin (1:1,500) (all from ABclonal Inc., Cambridge, MA, USA) and anti-β-actin (1:1,000; Bioworld Technology). One day later, the membranes were washed with Tris-buffered saline and 0.05% Tween-20 (TBST), and then incubated with anti-rabbit or anti-mouse secondary antibody at room temperature for 1 h. The intensities of the protein bands were assessed using ImageJ [National Institutes of Health (NIH), Bethesda, MD, USA].

Cell migration and invasion assays

The migration and invasion abilities of PANC-1 cells were assessed by cell migration and Matrigel invasion assays, respectively. After 24 h of transfection, the cells were suspended with serum-free medium and counted. In the assays, we furnished the invasion/migration chambers with 6.5-mm diameter tissue culture inserts and 8.0-µm pore size polycarbonate membranes (Transwell; Corning, Corning, NY, USA USA). For invasion assays, Matrigel (1:6; BD Biosciences, Bedford, MA, USA) was blended with serum-free DMEM, and 50 µl of the mixture was added into the chamber. The chambers were set into 24-well tissue culture plates, and then put in a sterile ultra-clean bench overnight. On the next day, after the Matrigel was solidified, 5.0×104 PANC-1 cells were added to the upper chamber. The total volume was 200 µl, with adequate addition of the serum-free medium. For the migration assays, the operation method was the same as the invasion assays, except for the addition of Matrigel. In both trials, the lower chamber was filled with 600 µl of 20% FBS. After 24 h of incubation at 37°C with 5% CO2, 90% paraformaldehyde was used to fix the cells invading the lower surfaces of the polycarbonate membranes. Then, the cells were stained with crystal violet and counted under a microscope. The cells were washed with phosphate-buffered saline (PBS) two times. Then, the water on the surfaces was gently wiped off and five views were taken for each insert.

Cell apoptosis assay

Cell apoptosis was detected by flow cytometry via a double staining method using an Annexin V-fluorescein isothiocyanate (FITC)-conjugated propidium iodide (PI) apoptosis kit (KeyGen Biotech. Co, Ltd., Nanjing, China). We performed the apoptosis assay after 48 h of transfection. PANC-1 cells were inoculated in 6-well plates at a density of 3×105 cells/well. When the cells covered ~50% of the 6-well plates, the 6-well plates were divided into a normal control (NC group), a negative control (vector group) and a shRNA-transfected group (shRNA group; transfected similarly as the above method). After 48 h, the cells in the three groups were digested with 0.25% trypsin without ethylenediamine tetraacetic acid (EDTA; Invitrogen, Carlsbad, CA, USA). Then, the cells were washed with PBS for two times, (each 5 min) and centrifuged at a speed of 5,000 rpm for 5 min. Next, the cells were resuspended in 500 µl of binding buffer and stained with 5 µl Annexin V-FITC and 5 µl of PI, for 15 to 20 min of reaction in a darkroom. Finally, the three groups of cells were stained, counted and analyzed using a flow cytometer (FACSCalibur; BD Biosciences).

CCK-8 assay for cell viability

Cells which were transfected for 48 h were plated in 96-well plates with 5×103 cells/well. Six repetitive wells were prepared for each group. Control wells were created adding the same volume of culture medium. After 6, 24, 48, 72 and 96 h of incubation, the cells were then treated with 10 µl Cell Counting Kit-8 (CCK-8) (Dojindo, Kumamoto, Japan) for another 2 h in an incubator at 37°C. An automated microplate reader (Sunrise, Tecan, Switzerland) was applied to assess the OD values for each well at 450 nm.

Statistical analysis

Data are expressed as mean ± standard deviation (SD). Differences between groups were examined by Student's t-test or one-way analysis of variance (ANOVA). P<0.05 and P<0.01 were considered to indicate statistically significant results. All statistical analyses were performed using SPSS (version 13.0; SPSS, Inc., Chicago, IL, USA) and GraphPad Prism (version 5.0; GraphPad Software, Inc., La Jolla, CA, USA).

Results

USP9X is highly expressed in human pancreatic cancer tissues

IHC analysis revealed that USP9X expression was upregulated in 32 of 55 tumor tissues compared to the adjacent non-tumor tissues (Fig. 1A-C and Table I). Moreover, high expression of USP9X was markedly associated with stage, grade and lymph node metastasis (all P<0.05) (Table I). The results imply that USP9X is positively correlated with the degree of tumor malignancy and may be closely related with pathophysiological progression of PDAC.

Figure 1.

USP9X expression in tumor and adjacent non-tumor tissues (magnification, ×400). (A) High expression of USP9X in pancreatic cancer tissues. (B) Low expression of USP9X in pancreatic cancer tissues. (C) Negative expression of USP9X in adjacent non-tumor tissues.

USP9X expression after transfection

First, we confirmed the alteration of the expression of USP9X. Thus, four shRNA sequences (purchased from GenePharma Co.) directed against USP9X were evaluated. As a control, an empty plasmid vector was transduced into PANC-1 cells. After 48 h, the USP9X expression in PANC-1 cells was detected via western blotting. After filtration, we chose one group of plasmids with the best effect. The USP9X expression was significantly downregulated (P<0.01) (Fig. 2A and B).

Figure 2.

Decreased expression of USP9X after transfection of specific plasmids. Expression of protein levels of USP9X in PANC-1 cells after interference as detected by western blotting. (A) Western blotting. (B) Quantitative analysis of USP9X; **P<0.01.

Depletion of USP9X inhibits cell migration and invasion

The functional effects of USP9X on pancreatic cancer cell migration and invasion abilities were examined via Transwell and wound healing assays. The suppression of USP9X expression significantly inhibited cell migration (Fig. 3A) and invasion ability (Fig. 3B). Next, we monitored the wound healing assays and similar results were found. The migration ability of the PANC-1 cells was significantly decreased when USP9X was suppressed (Fig. 3C).

Figure 3.

Downregulation of USP9X inhibits PANC-1 cell migration and invasion. (A) Cell migration assay was implemented after USP9X knockdown in the PANC-1 cells. The ability to migrate by Boyden chamber was significantly decreased compared with the vector and NC groups. The relative numbers of migrated cells of the three groups are shown below the images. (B) The PANC-1 cells transfected with USP9X-shRNA demonstrated significantly decreased cell invasion ability as observed from the cell invasion assay. The relative numbers of invasive cells of the three groups are shown below the images. (C) The PANC-1 cells transfected with USP9X-shRNA demonstrated significantly inhibited cell migration ability as determined by wound healing assay. The relative percentage of the open wound of the three groups is shown at the right. All experiments were carried out in triplicate. Data are shown as mean ± SD; *P<0.05, **P<0.01.

Depletion of USP9X reverses EMT of PANC-1 cells

To explore the effects of USP9X on the EMT of PANC-1 cells, we examined the expression levels of mesenchymal cell markers (N-cadherin and vimentin) and epithelial cell marker (E-cadherin) by western blotting. The results showed that the downregulation of USP9X expression significantly reduced the expression of N-cadherin and vimentin compared with these levels in the control groups (P<0.05; Fig. 4A and B). In contrast, the E-cadherin expression was increased (P<0.05; Fig. 4A and B).

Figure 4.

Depletion of USP9X reverses epithelial-mesenchymal transition of PANC-1 cells. (A) Western blot analysis of the relative protein levels of N-cadherin, vimentin and E-cadherin in USP9X-downregulated and control groups of PANC-1 cells. (B) Quantitative analysis of relative protein levels of N-cadherin, vimentin and E-cadherin in PANC-1 cells. (C) Western blot analysis of the relative protein levels of Snail and Twist in USP9X-downregulated and control groups of PANC-1 cells. (D) Quantitative analysis of relative protein levels of Snail and Twist in PANC-1 cells. Experiments were carried out in triplicate. Data are shown as mean ± SD; *P<0.05.

To further confirm the effect of USP9X on the EMT of PANC-1 cells, we determined the expression levels of Snail and Twist, two upstream target proteins of N-cadherin, vimentin and E-cadherin by western blotting. The results revealed that expression of both proteins was significantly decreased (P<0.05; Fig. 4C and D), suggesting that USP9X may be involved in regulating the migration and invasion of PANC-1 cells. As Snail and Twist were activated in pancreatic cancer cells, USP9X may be highly associated with disease progression by regulating the expression of downstream target proteins, including N-cadherin, vimentin and E-cadherin.

Inhibition of USP9X induces apoptosis

The effect of USP9X on cell apoptosis was detected using flow cytometry. After the given plasmid was transfected into PANC-1 cells for 48 h, shRNA-USP9X effectively inhibited USP9X expression compared with that noted in the control groups (Fig. 1). Then, the cells were stained with Annexin V-FITC/PI for assaying cell apoptosis. The apoptotic rate of PANC-1 cells increased after inhibition of USP9X expression in comparison with the uninduced counterparts (Fig. 5A and B), indicating that depletion of USP9X induced the apoptosis of PANC-1 cells. To confirm the effects of USP9X on the protein expression of survivin in PANC-1 cells, we measured survivin by western blotting. The results indicated that survivin expression in PANC-1 cells was markedly reduced compared with that noted in the control groups (P<0.05, Fig. 5C and D).

Figure 5.

Inhibition of USP9X induces apoptosis. (A and B) After the PANC-1 cells were transfected with USP9X-shRNA and vector, cell apoptosis was detected using flow cytometry. The apoptotic rate was statistically significantly increased in the USP9X-silenced cells. (C) Western blot analysis of the relative protein level of survivin in the USP9X-silenced and control groups of PANC-1 cells. (D) Quantitative analysis of the relative protein level of survivin in PANC-1 cells. Experiments were carried out in triplicate. Data are shown as mean ± SD; *P<0.05.

Depletion of USP9X impacts cell viability

As revealed by the CCK-8 assay, depletion of USP9X in PANC-1 cells resulted in decreased cell viability compared to the cell viability of another two groups of cells (P<0.05; Fig. 6).

Figure 6.

Downregulation of USP9X decreases cell proliferation. CCK-8 assays were performed at each time point to quantify cell viability of the PANC-1 cells transfected with USP9X shRNA, empty plasmid control (vector group) and normal control groups (NC group). The graph shows the changing trends among the three groups. All experiments were carried out in triplicate. Data are shown as mean ± SD; *P<0.05.

Discussion

Pancreatic neoplasms are highly malignant tumors, and the prognosis of patients with PDAC is extremely poor, which is mostly ascribed to the high migration, invasiveness and high recurrence rate (22). Due to the broad range of its targets, the roles of USP9X are various and rely on different environments (8,9,12,23,24). Abnormal expression of USP9X in several types of cancers has been reported (8,11,23,24). Particularly, whether PDAC USP9X acts as a proto-oncogene or tumor-suppressor gene remains controversial (11), and the concrete effects of USP9X on migration, invasion and apoptosis of PDAC are still poorly understood.

Our experimental data support the role of USP9X as a growth promoter in tumor genesis and progression. As shown in Fig. 1A and B, the USP9X expression in human pancreatic cancer tissues was markedly increased compared with that noted in the adjacent non-tumor tissues. We believe that USP9X is positively correlated with the degree of tumor malignancy and may be closely related with pathophysiological progression of PDAC (Table I). Notably, downregulation of USP9X expression reduced the invasion and migration abilities of the PANC-1 cells (Fig. 3A-C). Depletion of USP9X reversed the EMT of PANC-1 cells, which is reflected in the changes of N-cadherin, vimentin and E-cadherin expression. Moreover, cell apoptosis was increased after the downregulation of USP9X (Fig. 5A and B). The survivin expression was positively correlated with the USP9X level. Furthermore, inhibition of USP9X expression effectively decreased the viability of the PANC-1 cells (Fig. 6).

Notably, Cox et al demonstrated that USP9X acted principally as an oncogene in five tested PDAC cell lines (11). However, Pérez-Mancera et al found that USP9X acted as a tumor-suppressor in a mouse model of pancreatic malignant tumors in which the USP9X expression was interfered at the early stage of tumor development by Sleeping Beauty transposon (12). In the present study, we believe that USP9X may be an oncogene in PANC-1 cells. Our results are similar to those of Cox et al. We suggest that downregulation of USP9X can inhibit the migration and invasion of pancreatic cancer PANC-1 cells and lead to a decrease in cell viability. The apoptosis rate of the PANC-1 cells was increased with the decrease in USP9X expression. The migratory ability of PANC-1 cells was weakened after downregulation of the expression of USP9X (Fig. 3A). We also found that our results differed from those of Perez-Mancera et al. The difference may be due to the pathological type of pancreatic cancer, the location of the pancreatic tumor or the difference in race. However, the specific reasons remain unclear and further research is needed.

Furthermore, we studied the specific proteins related to the migration and invasion functions of USP9X. We found that cell migration and invasion abilities were suppressed (Fig. 3A-C). Moreover, it is very possible that USP9X may affect the migration and invasion of PANC-1 cells by EMT. EMT is the process in which epithelial cells are transformed by specific procedures into a mesenchymal phenotype. Epithelial cells undergoing EMT lose polarity and some properties such as their connection to the basement membrane, which is an important process of tumor invasion and metastasis (3). It has also been confirmed that EMT is the molecular basis underlying the occurrence, invasion and metastasis of many tumors (25,26). Furthermore, we examined the expression levels of N-cadherin, vimentin and E-cadherin in PANC-1 cells by western blotting. However, the E-cadherin expression was significantly upregulated, while the expression of N-cadherin and vimentin was downregulated in PANC-1 cells. This finding is consistent with other studies (27–29). We also tested Snail and Twist, which are the upstream target proteins of N-cadherin, vimentin and E-cadherin. Twist belongs to the bHLH transcription factor family and plays an important role in tumor metastasis (15). Snail, a zinc finger transcription factor is combined with the promoter of the gene expression related to cell adhesion, and opens to regulate the transcription process (16). We found that the expression levels of both proteins were significantly downregulated (Fig. 4C and D). These results are consistent with previous research (13,14,30). We conclude that USP9X is highly linked with disease formation and progression by activating EMT.

Moreover, we studied PANC-1 cell apoptosis after the expression of USP9X was silenced. The apoptotic rate of PANC-1 cells increased after the inhibition of USP9X expression compared with the uninduced groups (Fig. 5A and B). As reported, survivin is degraded by the ubiquitin proteasome pathway (20). Theoretically, downregulated expression of survivin can cause cell apoptosis. Thus, we detected the expression of survivin, which is the strongest apoptosis inhibitor (15). Survivin may inhibit apoptosis mainly by the following two ways: one way by directly inhibiting the activities of caspase-3 and −7, the end effectors of apoptosis protein, and another way by interacting with CDK-2 and CDK-4 and blocking the apoptotic signal transduction pathway (31). In PDAC, survivin is involved in many biological processes, such as gene transcription regulation, cell differentiation, tumor formation and metastasis (32,33). We also found that the survivin expression in PANC-1 cells was markedly reduced after the inhibition of USP9X. The change in survivin expression was positively proportional to USP9X, but the concrete mechanism between them is still unclear and needs further study.

Taken together, USP9X participates in a variety of biological processes in pancreatic cancer cells. In the present study, we first demonstrated that USP9X activated the EMT pathway and altered cell migration and invasion abilities. We then explored the close relationship between USP9X and survivin in pancreatic cancer. Future studies are needed to reveal the specific mechanisms between Snail/Twist and USP9X, and between survivin and USP9X. Our findings may provide a novel strategy for the treatment of pancreatic cancer. Early inhibition of USP9X may delay the invasion and metastasis of PDAC, which makes it possible to improve the clinical outcomes of PDAC patients. However, our findings are not fully consistent with previous experts, thus deeper investigation is required to elucidate the significant role of USP9X in PDAC.

References

1 

Siegel R, Ma J, Zou Z and Jemal A: Cancer statistics, 2014. CA Cancer J Clin. 64:9–29. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Hidalgo M: Pancreatic cancer. N Engl J Med. 362:1605–1617. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Bonnomet A, Brysse A, Tachsidis A, Waltham M, Thompson EW, Polette M and Gilles C: Epithelial-to-mesenchymal transitions and circulating tumor cells. J Mammary Gland Biol Neoplasia. 15:261–273. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Kapuria V, Peterson LF, Fang D, Bornmann WG, Talpaz M and Donato NJ: Deubiquitinase inhibition by small-molecule WP1130 triggers aggresome formation and tumor cell apoptosis. Cancer Res. 70:9265–9276. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Kerscher O, Felberbaum R and Hochstrasser M: Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu Rev Cell Dev Biol. 22:159–180. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Hussain S, Zhang Y and Galardy PJ: DUBs and cancer: The role of deubiquitinating enzymes as oncogenes, non-oncogenes and tumor suppressors. Cell Cycle. 8:1688–1697. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Reyes-Turcu FE, Ventii KH and Wilkinson KD: Regulation and cellular roles of ubiquitin-specific deubiquitinating enzymes. Annu Rev Biochem. 78:363–397. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Schwickart M, Huang X, Lill JR, Liu J, Ferrando R, French DM, Maecker H, O'Rourke K, Bazan F, Eastham-Anderson J, et al: Deubiquitinase USP9X stabilizes MCL1 and promotes tumour cell survival. Nature. 463:103–107. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Harris DR, Mims A and Bunz F: Genetic disruption of USP9X sensitizes colorectal cancer cells to 5-fluorouracil. Cancer Biol Ther. 13:1319–1324. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Liu H, Chen W, Liang C, Chen BW, Zhi X, Zhang S, Zheng X, Bai X and Liang T: WP1130 increases doxorubicin sensitivity in hepatocellular carcinoma cells through usp9×-dependent p53 degradation. Cancer Lett. 361:218–225. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Cox JL, Wilder PJ, Wuebben EL, Ouellette MM, Hollingsworth MA and Rizzino A: Context-dependent function of the deubiquitinating enzyme USP9X in pancreatic ductal adenocarcinoma. Cancer Biol Ther. 15:1042–1052. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Pérez-Mancera PA, Rust AG, van der Weyden L, Kristiansen G, Li A, Sarver AL, Silverstein KA, Grützmann R, Aust D, Rümmele P, et al: Australian Pancreatic Cancer Genome Initiative: The deubiquitinase USP9X suppresses pancreatic ductal adenocarcinoma. Nature. 486:266–270. 2012.PubMed/NCBI

13 

De Craene B and Berx G: Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer. 13:97–110. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Yang J and Weinberg RA: Epithelial-mesenchymal transition: At the crossroads of development and tumor metastasis. Dev Cell. 14:818–829. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Khan MA, Chen HC, Zhang D and Fu J: Twist: A molecular target in cancer therapeutics. Tumour Biol. 34:2497–2506. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Smith BN and Odero-Marah VA: The role of Snail in prostate cancer. Cell Adhes Migr. 6:433–441. 2012. View Article : Google Scholar

17 

Ambrosini G, Adida C and Altieri DC: A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med. 3:917–921. 1997. View Article : Google Scholar : PubMed/NCBI

18 

Roca H, Varsos ZS, Mizutani K and Pienta KJ: CCL2, survivin and autophagy: New links with implications in human cancer. Autophagy. 4:969–971. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Farnebo L, Tiefenböck K, Ansell A, Thunell LK, Garvin S and Roberg K: Strong expression of survivin is associated with positive response to radiotherapy and improved overall survival in head and neck squamous cell carcinoma patients. Int J Cancer. 133:1994–2003. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Liu YB, Gao X, Deeb D, Brigolin C, Zhang Y, Shaw J, Pindolia K and Gautam SC: Ubiquitin-proteasomal degradation of antiapoptotic survivin facilitates induction of apoptosis in prostate cancer cells by pristimerin. Int J Oncol. 45:1735–1741. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Peng J, Hu Q, Liu W, He X, Cui L, Chen X, Yang M, Liu H, Wei W, Liu S, et al: USP9X expression correlates with tumor progression and poor prognosis in esophageal squamous cell carcinoma. Diagn Pathol. 8:177–185. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Ahmad R: Cheema, Eileen M. O'Reilly. Management of metastatic pancreatic adenocarcinoma. Surg Clin North Am. 7:1391–1414. 2016.

23 

Murtaza M, Jolly LA, Gecz J and Wood SA: La FAM fatale: USP9X in development and disease. Cell Mol Life Sci. 72:2075–2089. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Wang Y, Liu Y, Yang B, Cao H, Yang CX, Ouyang W, Zhang SM, Yang GF, Zhou FX, Zhou YF, et al: Elevated expression of USP9X correlates with poor prognosis in human non-small cell lung cancer. J Thorac Dis. 7:672–679. 2015.PubMed/NCBI

25 

Vermeulen L, Todaro M, de Sousa Mello F, Sprick MR, Kemper K, Alea Perez M, Richel DJ, Stassi G and Medema JP: Single-cell cloning of colon cancer stem cells reveals a multi-lineage differentiation capacity. Proc Natl Acad Sci USA. 105:13427–13432. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Findlay VJ, Wang C, Watson DK and Camp ER: Epithelial-to-mesenchymal transition and the cancer stem cell phenotype: Insights from cancer biology with therapeutic implications for colorectal cancer. Cancer Gene Ther. 21:181–187. 2014. View Article : Google Scholar : PubMed/NCBI

27 

von Burstin J, Eser S, Paul MC, Seidler B, Brandl M, Messer M, von Werder A, Schmidt A, Mages J, Pagel P, et al: E-cadherin regulates metastasis of pancreatic cancer in vivo and is suppressed by a SNAIL/HDAC1/HDAC2 repressor complex. Gastroentemlogy. 137:361–371. 2009. View Article : Google Scholar

28 

Lang SH, Hyde C, Reid IN, Hitchcock IS, Hart CA, Bryden AA, Villette JM, Stower MJ and Maitland NJ: Enhanced expression of vimentin in motile prostate cell lines and in poorly differentiated and metastatic prostate carcinoma. Prostate. 52:253–263. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Lee MY, Chou CY, Tang MJ and Shen MR: Epithelial-mesenchymal transition in cervical cancer: Correlation with tumor progression, epidermal growth factor receptor overexpression, and snail up-regulation. Clin Cancer Res. 14:4743–4750. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Francí C, Takkunen M, Dave N, Alameda F, Gómez S, Rodríguez R, Escrivà M, Montserrat-Sentís B, Baró T, Garrido M, et al: Expression of Snail protein in tumor-stroma interface. Oncogene. 25:5134–5144. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Xu JH, Wang AX, Huang HZ, Wang JG, Pan CB and Zhang B: Survivin shRNA induces caspase-3-dependent apoptosis and enhances cisplatin sensitivity in squamous cell carcinoma of the tongue. Oncol Res. 18:377–385. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Lopes RB, Gangeswaran R, McNeish IA, Wang Y and Lemoine NR: Expression of the IAP protein family is dysregulated in pancreatic cancer cells and is important for resistance to chemotherapy. Int J Cancer. 120:2344–2352. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Jhala N, Jhala D, Vickers SM, Eltoum I, Batra SK, Manne U, Eloubeidi M, Jones JJ and Grizzle WE: Biomarkers in diagnosis of pancreatic carcinoma in fine-needle aspirates. Am J Clin Pathol. 126:572–579. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu L, Yao D, Zhang P, Ding W, Zhang X, Zhang C, Gong S, Zhang Y, Wang J, Sun T, Sun T, et al: Deubiquitinase USP9X promotes cell migration, invasion and inhibits apoptosis of human pancreatic cancer. Oncol Rep 38: 3531-3537, 2017.
APA
Liu, L., Yao, D., Zhang, P., Ding, W., Zhang, X., Zhang, C. ... Ren, Z. (2017). Deubiquitinase USP9X promotes cell migration, invasion and inhibits apoptosis of human pancreatic cancer. Oncology Reports, 38, 3531-3537. https://doi.org/10.3892/or.2017.6050
MLA
Liu, L., Yao, D., Zhang, P., Ding, W., Zhang, X., Zhang, C., Gong, S., Zhang, Y., Wang, J., Sun, T., Ren, Z."Deubiquitinase USP9X promotes cell migration, invasion and inhibits apoptosis of human pancreatic cancer". Oncology Reports 38.6 (2017): 3531-3537.
Chicago
Liu, L., Yao, D., Zhang, P., Ding, W., Zhang, X., Zhang, C., Gong, S., Zhang, Y., Wang, J., Sun, T., Ren, Z."Deubiquitinase USP9X promotes cell migration, invasion and inhibits apoptosis of human pancreatic cancer". Oncology Reports 38, no. 6 (2017): 3531-3537. https://doi.org/10.3892/or.2017.6050
Copy and paste a formatted citation
x
Spandidos Publications style
Liu L, Yao D, Zhang P, Ding W, Zhang X, Zhang C, Gong S, Zhang Y, Wang J, Sun T, Sun T, et al: Deubiquitinase USP9X promotes cell migration, invasion and inhibits apoptosis of human pancreatic cancer. Oncol Rep 38: 3531-3537, 2017.
APA
Liu, L., Yao, D., Zhang, P., Ding, W., Zhang, X., Zhang, C. ... Ren, Z. (2017). Deubiquitinase USP9X promotes cell migration, invasion and inhibits apoptosis of human pancreatic cancer. Oncology Reports, 38, 3531-3537. https://doi.org/10.3892/or.2017.6050
MLA
Liu, L., Yao, D., Zhang, P., Ding, W., Zhang, X., Zhang, C., Gong, S., Zhang, Y., Wang, J., Sun, T., Ren, Z."Deubiquitinase USP9X promotes cell migration, invasion and inhibits apoptosis of human pancreatic cancer". Oncology Reports 38.6 (2017): 3531-3537.
Chicago
Liu, L., Yao, D., Zhang, P., Ding, W., Zhang, X., Zhang, C., Gong, S., Zhang, Y., Wang, J., Sun, T., Ren, Z."Deubiquitinase USP9X promotes cell migration, invasion and inhibits apoptosis of human pancreatic cancer". Oncology Reports 38, no. 6 (2017): 3531-3537. https://doi.org/10.3892/or.2017.6050
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team