Fumarate hydratase functions as a tumor suppressor in endometrial cancer by inactivating EGFR signaling
- Authors:
- Published online on: August 23, 2023 https://doi.org/10.3892/or.2023.8620
- Article Number: 183
Abstract
Introduction
Endometrial cancer is the most common type of cancer of the female genital tract in developed countries, including Taiwan (1). In the United States, endometrial cancer accounts for 6.9% of cancer diagnoses in women, with a predicted 61,180 new cases and 12,160 fatalities in 2019 (2). Different endometrial cancer histological subtypes and molecular traits have been reported. Type I endometrial cancer is associated with unopposed estrogen stimulation, consists of low-grade cells that are more prevalent and has an improved prognosis than type II endometrial cancer, which is not driven by estrogen and is comprised of high-grade cells (3). Unopposed estrogen therapy, early menarche, late menopause, tamoxifen therapy, infertility and chronic anovulation are risk factors connected to excessive unopposed exposure of the endometrium to estrogen (4). In addition, the metabolic combination of obesity, hypertension and diabetes, as well as other metabolic illnesses, are strongly associated with endometrial cancer (5). Endometrioid endometrial cancer has a well-established link to obesity, with relative risks of ~1.5 for overweight individuals, 2.5 for individuals with class 1 obesity [body mass index (BMI), 30.0–34.9 kg/m2], 4.5 for individuals with class 2 obesity (BMI, 35.0–39.9 kg/m2) and 7.1 for individuals with class 3 obesity (BMI, ≥40.0 kg/m2) (3,6).
Fumarate hydratase (FH), also known as fumarase, is a tricarboxylic acid (TCA) cycle enzyme that catalyzes the reversible hydration of fumarate to malate (7). The TCA cycle is the ultimate convergent pathway for the oxidation of lipids, carbohydrates and amino acids, in a series of metabolic processes that take place inside the mitochondria (8). According to a previous report, genetic mutations in the TCA cycle-related mitochondrial enzymes, including isocitrate dehydrogenase, succinate dehydrogenase and FH all cause tumor growth, suggesting that metabolic dysregulation can operate as a cancer driver in addition to being a result of oncogenic transformation (9). FH has dual localization in the cytosol or mitochondria, depending on the N-terminus peptide sequence (10).
A study has reported germline heterozygous mutations of FH in patients with multiple cutaneous and uterine leiomyomatosis (MCUL) and hereditary leiomyomatosis and renal cell cancer with or without renal cancer (HLRCC), demonstrating the allelic relationship between MCUL and HLRCC (11). In another study, 86% of FH-negative tumors determined by immunohistochemistry had FH mutations, half of which being germline mutations (12). Other than its mutational status in uterine leiomyosarcoma and uterine fibroids, the role of FH in endometrial cancer is mostly unclear.
In the present study, the role of FH in endometrial cancer was explored. It was demonstrated that FH functions as a tumor suppressor, with the potential to be developed as a prognostic biomarker and therapeutic target.
Materials and methods
Patient samples
Endometrial cancer tissues were obtained from patients (n=62, aged 26-82 years old) who had undergone surgical treatment at the Department of Surgery, Kaohsiung Medical University Hospital [Kaohsiung, Taiwan]. All participants in this study were recruited between March 2025 and March 2017. Ethical approval [IRB No.: KMUHIRB-E (1)-20150026] was obtained from the Ethics Committee of Kaohsiung Medical University Hospital. Informed patient consent was waived by the Institutional Review Board due to the retrospective nature of the study.
Immunohistochemistry
All tissues were procured from formalin-fixed and paraffin-embedded endometrial tissue blocks. Immunohistochemical (IHC) staining for FH in endometrial tissues was performed using the Bond-Max system (Leica Microsystems GmbH). Sections were deparaffinized using Bond Dewax Solution (Leica Microsystems GmbH) and rehydrated using graded alcohol. Heat-induced antigen retrieval was achieved using Bond Epitope Retrieval Solution 1 (Leica Microsystems GmbH) for 20 min at 98°C. After washing steps, peroxidase blocking was carried out for 10 min using Bond Polymer (Leica Microsystems GmbH). Tissues were again washed and then incubated with the primary antibody, FH (cat. no. GTX110128; 1:100), for 30 min at room temperature. Post-primary IgG linker reagent was applied for 8 min, and the slides were incubated with polymeric horseradish peroxidase IgG reagent for 8 min to localize the primary antibodies. Diaminobenzidine (DAB) was used as the substrate to detect antigen-antibody binding. Then, hematoxylin was used to counterstain nuclei for 5 min at room temperature. Images of immunohistochemically stained sections were captured using Nikon Eclipse E600 fluorescence microscope (Nikon Corporation). Relative expression of FH in the endometrial cancer specimens was quantified by two pathologists independently. For the endometrial cancer samples, each specimen was assigned to one of four groups based on the percentage of positively stained normal and tumor cells: 0 (0–4%), 1 (5–24%), 2 (25–49%), 3 (50–74%) or 4 (75–100%). In addition, the immunostaining intensity was graded as: 0 (negative), 1 (weak), 2 (moderate) or 3 (strong), with the total score calculated by multiplying the percentage of positively stained cells by the graded intensity of staining for every sample. Patients with a score <4.50 were categorized as the low FH expression group and those with a score ≥4.50 were categorized as the high FH expression group.
Cell culture
Ishikawa, RL95-2, HEC1A, AN3CA and KLE human endometrial cancer cell lines were obtained from the Bioresource Collection and Research Center (Hsinchu, Taiwan) and cultured in RPMI 1640 (Gibco; Thermo Fisher Scientific, Inc.) and Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc.). All cell lines were incubated in a humidified incubator at 37°C and 5% CO2. All culture media contained 10% fetal bovine serum (FBS; Biological Industries; Sartorius AG), 1% penicillin G and streptomycin.
Virus transfection for FH knockdown and overexpression
To knockdown FH expression in endometrial cancer cells, lentivirus carrying a pLKO.1_puro lentiviral vector (from National RNAi Core Facility, Academia Sinica, Taipei, Taiwan) that expressed double-stranded short hairpin (sh)RNA oligonucleotides targeting the sequences of human FH (three clones) were used: i) Clone 2: ID TRCN0000310398, target sequence: CAACGATCATGTTAATAAA, shRNA sequence: GCCCAACGATCATGTTAATAAACTCGAGTTTATTAACATGATCGTTGGGTTTTTG; ii) clone 5: ID TRCN0000052465, target sequence: CCCAACGATCATGTTAATAAA, shRNA sequence: CCGGCCCAACGATCATGTTAATAAACTCGAGTTTATTAACATGATCGTTGGGTTTTTG; and iii) clone 6 ID: TRCN0000299140, target sequence: GTGGTTATGTTCAACAAGTAA, shRNA sequence: CCGGGTGGTTATGTTCAACAAGTAACTCGAGTTACTTGTTGAACATAACCACTTTTTG (National RNAi Core Facility, Academia Sinica, Taipei, Taiwan).
A pLKO.1_puro lentiviral vector expressing shRNA targeting firefly luciferase, unrelated to the human genome sequence, was used as a negative control clone ID: TRCN0000052466, target sequence: GTGGTTATGTTCAACAAGTAA, shRNA sequence: GGGTGGTTATGTTCAACAAGTAACTCGAGTTACTTGTTGAACATAACCACTTTTTG (from National RNAi Core Facility, Academia Sinica, Taipei, Taiwan).
A ready-to-use lentivirus particle containing the pReceiver Lv105 lentiviral vector, which expressed the human FH gene, was purchased from GeneCopoeia, Inc. for overexpression of FH in endometrial cancer cells. Lentivirus particles containing an empty pReceiver Lv105 lentiviral vector (GeneCopoeia, Inc.) were used as a negative control.
Briefly, the cells were seeded at 5×105 cells/well in 6 cm plates (Corning, Inc.) and incubated overnight at 37°C in 5% CO2 atmosphere. Lentiviral infection was achieved by adding virus solution to cells in culture media containing 8 g/ml polybrene (TR-1003; Sigma-Aldrich; Merck KGaA). The number of viruses was added according to the recommended infection MOI for Ishikawa, RL95-2, KLE, and AN3CA cells (MOI=5). Following a 24 h incubation at 37°C in 5% CO2 atmosphere, 2 g/ml puromycin (cat. no. A11138-03; Gibco; Thermo Fisher Scientific, Inc.) was added for selection. Selected cells were cultured in 2 g/ml puromycin for 2 weeks to establish cells with stable overexpression or knockdown of FH.
2,3-Bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) colorimetric assay
The cell proliferation rate was determined using a XTT colorimetric assay (Roche Diagnostics GmbH) following the detailed procedure in accordance with a previous report (13).
Phosphokinase array
A human phosphokinase antibody array (ARY003C; R&D systems, Inc.) was applied to explore the kinases that are affected by FH in endometrial cancer cells. The site-specific phosphorylation of 43 kinases was determined in a single sample. Total cell lysates of RL95-2 cells with or without FH knockdown were harvested for phosphokinase array analysis according to the manufacturer's instruction.
Bioinformatic database analysis
FH and twist RNA Seq datasets of uterine corpus endometrial carcinoma (UCEC) in The Cancer Genome Atlas (TCGA) database were retrieved from TCGA website (Project ID: TCGA-UCEC; http://xena.ucsc.edu). The Pearson's correlation between interested proteins was analyzed using the data of patients from TCGA-UCEC.
FH, VIM and CLDN1 datasets of uterus in the Genotype-Tissue Expression (GTex) database were retrieved from the GTex website (https://gtexportal.org/home/). The correlation between FH and VIM and FH and CLDN1 was analyzed using the data of patients from GTex-Uterus.
Transwell migration and invasion assays
Cell migration assays were performed in 24-well plates with Transwell (Corning Inc.) membrane filter inserts (6.5 mm diameter, 8 µm pore size). Endometrial cancer cells, after FH overexpression or knockdown, were trypsinized, suspended in serum-free medium and seeded (1×105 cells) in the upper chamber of the Transwell filters. Medium containing 10% FBS was added to the lower chamber and the plates were incubated for 24 h at 37°C. Following incubation, cells were stained with crystal violet for 2 h at room temperature. Non-migrating cells were removed by wiping the upper surface of the filter. Migrated cells were imaged using an Olympus SZX10 stereo light microscope (Olympus Corporation) and analyzed using ImageJ software (ij153-win-java8; National Institutes of Health).
For invasion assays, BioCoat Matrigel (BD Biosciences) invasion chambers were rehydrated according to the manufacturer's instructions and subsequent steps were identical to the migration assay.
To study the effect of EGFR phosphorylation on endometrial cancer cell metastasis, Gefitinib, an EGFR phosphorylation inhibitor, was purchased from Sigma-Aldrich (Merck KGaA; cat. no. SML1657). RL95-2 endometrial cancer cells were treated with Gefitinib for 24 h before performing the migration and invasion assays.
Western blotting
Western blotting was performed to assess the knockdown efficiency following lentivirus infection and to assess the protein expression of other proteins. The detailed procedure according to a previous study was followed (13). In brief, the cells were lysed with RIPA buffer (20 mM Tris-HCL pH 7. 4, 150 mM NaCl, 1 mM EDTA, 1% Triton-X100, 1% sodium deoxycholate, 0.1% SDS) and cell lysates were collected. The BCA protein assay (cat. no. 23225; Sigma-Aldrich; Merck KGaA) was used to quantify total protein. The samples were electrophoresed on a SDS-PAGE gel (8–12%; 20 µg/lane). After protein transfer, the polyvinylidene fluoride (PVDF) membrane was blocked with 2% BSA in 1X TBST solution for 1 h at room temperature. The membranes were incubated overnight with primary antibodies at 4°C. Antibodies against FH (cat. no. GTX110128; 1:2,000), vimentin (cat. no. GTX100619; 1:1,000), twist (cat. no. GTX127310; 1:1,000), EGFR (cat. no. GTX100448; 1:1,000) and phosphorylated (p-)EGFR (cat. no. GTX133599; 1:1,000) were purchased from GeneTex Inc. Antibodies against JNK1/2/3 (cat. no. ab179461; 1:1,000) and p-JNK1/2/3 (cat. no. ab124956; 1:1,000) were purchased from Abcam. An antibody against β-actin (cat. no. A5441; 1:5,000; Sigma-Aldrich; Merck KGaA) was used as the internal control. After the incubation with primary antibodies and subsequent washing, PVDF membranes were incubated with rabbit (HRP conjugate; cat. no. GTX2131101; 1:5,000; GeneTex, Inc.) or mouse (HRP conjugate; cat. no. GTX213111; 1:5,000; GeneTex, Inc.) secondary antibodies for 1 h at room temperature. The protein bands on the PVDF membrane were visualized using enhanced chemiluminescence reagent (PerkinElmer, Inc.) and Image Lab software 6.0.1 (Bio-Rad Laboratories, Inc.).
Statistical analysis
All statistical analyses were performed using the SPSS 14.0 statistical package for PC (SPSS, Inc.). Comparisons between FH expression with various variables, including stage, tumor size, grade lymph node metastasis and myometrium invasion, were investigated by χ2 test. Student's t-test (unpaired) was used to compare the difference between two groups. One-way analysis of variance with post-hoc Tukey's test was used for multiple group comparisons. P<0.05 was considered to indicate a statistically significant difference.
Results
FH expression in endometrial cancer tissues is negatively associated with tumor size and lymph node metastasis
To evaluate FH expression in normal endometrium and endometrial cancer tissues, IHC staining of 59 normal endometrial and 62 endometrial cancer tissue samples was performed. It was demonstrated that endometrial cancer tissue had low FH expression compared with normal endometrial tissue (Fig. 1A and B). FH expression was further correlated with the clinicopathological characteristics of patients with endometrial cancer and it was found that FH had a negative correlation with tumor size (P=0.028) and lymph node metastasis (P=0.044; Table I). Moreover, the patients were classified into an FH-low group (<4.50%) and an FH-high group (≥4.50%; Table I) using receiver operating characteristic (ROC) curve.
Downregulation of FH expression enhances, while overexpression of FH reduces, endometrial cancer cell migration and invasion abilities
The endogenous expression of FH was further assessed in five endometrial cancer cell lines. The result demonstrated that the HEC1A, Ishikawa and RL95-2 cell lines (which are relatively more invasive cell lines) had low FH protein expression, while the AN3CA and KLE cell lines (which are relatively less invasive cell lines) had high FH protein expressions (Fig. 2A). FH was subsequently recombinantly overexpressed in Ishikawa cells (which had low endogenous FH expression) and knocked down in RL95-2 cells (which had high endogenous FH expression), to evaluate the effect of FH expression on the proliferation, migration and invasion abilities of endometrial cancer cells. A total of three shRNAs for FH expression knockdown were assessed. It was discovered that KD6 had the best knockdown efficiency and KD6 was therefore used in further experiments.
The cell proliferation assay results revealed that the proliferation of FH-overexpressing Ishikawa cells was decreased, while the proliferation of FH-knockdown RL95-2 cells was increased (Fig. 2B and C). Furthermore, the migration and invasion abilities of FH-overexpressing Ishikawa cells were also decreased. By contrast, the migration and invasion abilities of FH-knockdown RL95-2 cells were increased. The migration ability of cells transfected with KD2 and KD5 clones was also assessed and it was found that cell migration was also increased significantly compared with the control group (Fig. S1B).
Expression of mesenchymal markers, vimentin and twist, are upregulated in FH-knockdown endometrial cancer cells
It is shown in Table I that FH expression was negatively correlated with lymph node metastasis. Therefore, the protein expression of various epithelial-mesenchymal transition (EMT) markers, which play critical role in cancer cell metastasis (14), in FH-knockdown RL95-2, KLE and AN3CA cells was further evaluated. It was demonstrated that expression of the mesenchymal markers, vimentin and twist, was upregulated in FH-knockdown cells; by contrast, expression of the epithelial marker, claudin 1, was downregulated significantly compared with the control group (Fig. 3A-C). To access whether FH mRNA expression is correlated with the mRNA expression of EMT markers, the expression levels in the TCGA (https://xena.ucsc.edu/) and GTex (https://gtexportal.org/home/datasets) datasets were analyzed. A negative correlation was observed between FH and two mesenchymal markers, vimentin (r=−0.33; P=0.003) and twist (r=−0.206; P=0.003), whereas a positive, but not statistically significant, correlation was observed between FH and the epithelial marker, claudin-1 (r=0.18, P=0.12), as shown in Fig. 3D and E.
EGFR phosphorylation is upregulated in FH-knockdown endometrial cancer cells
Next, a human phosphokinase array was used to identify the possible kinases regulating FH-mediated endometrial cancer cell behavior. The results demonstrated that the levels of p-JNK1/2/3 and p-EGFR were increased in FH-knockdown RL95-2 cells compared with control cells (Figs. 4A and S2A), which was further validated by western blotting (Fig. 4B-D). The p-EGFR protein level was significantly increased in FH-knockdown endometrial cancer cell lines including RL95-2 (Fig. 4B), KLE (Fig. 4C) and AN3CA (Fig. 4D), while p-JNK1/2/3 expression did not change in FH-knockdown RL95-2 cells (Fig. S2B). In addition, a connection between FH and EGFR, mediated by TP53, was observed using the STRING online database (https://string-db.org/) (Fig. S3).
Further analysis was performed using the p-EGFR inhibitor, gefitinib (1 µM), to treat FH-knockdown RL95-2 cells. The results demonstrated that gefitinib inhibited p-EGFR protein expression (Fig. S2C), while the migration and invasion abilities of FH-knockdown cells were significantly decreased after gefitinib treatment, compared with the vehicle treatment group (Fig. 4C and D). These results suggested that FH knockdown promoted EGFR phosphorylation and hence upregulated the migration and invasion of endometrial cancer cells.
Discussion
The role of FH in endometrial cancer is mostly unclear. The present study, to the best of the authors' knowledge, is the first study reporting that FH acts as a tumor suppressor in endometrial cancer, as demonstrated by the negative correlation observed between FH and tumor size or metastasis using clinical data. In addition, the results of the present study demonstrated that FH knockdown led to an increase in endometrial cancer cell proliferation and metastasis and, since FH catalyzes the reversible hydration of fumarate to malate (7), fumarate may have a role in this process. Consistent with these findings, Sciacovelli et al (15) reported that fumarate, which may accumulate when FH is inactivated, promotes EMT through activation of the transcription factors, snail1 and zeb1/2, by silencing miR200 cluster expression. A negative correlation of FH and mesenchymal marker vimentin, determined by immunohistochemistry, has also been reported. In chromophobe renal cell carcinoma and low-grade oncocytic renal tumor, there is a positive staining for FH but a negative staining for vimentin (16,17), while in FH-negative renal cell carcinoma, 6 out of 8 cases are positive for vimentin expression (18).
The present study demonstrated the upregulation of the mesenchymal markers, vimentin and twist and the downregulation of the epithelial marker, claudin-1, in FH-knockdown endometrial cancer cells. In agreement with these findings, vimentin and twist have been reported to be upregulated in endometrial cancer (19,20) and associated with the poor survival of patients with endometrial cancer (21). In addition, the high expression of claudin-1 protein in endometrial cancer has been reported in a previous study (22). Notably, the subcellular localization of claudin-1 may determine its role as a tumor suppressor or a promoter (23), with nuclear or cytoplasmic-localized claudin-1 acting as an oncogene and cell membrane-localized claudin-1 acting as a tumor suppressor (24). Whether regulation of FH definitively influences subcellular localization of claudin-1 remains to be determined.
FH mutations have been reported in renal cancer and malignant paraganglioma (25,26). Loss-of-function FH mutations cause an increase in fumarate and a decrease in malate and citrate (27). Furthermore, FH deficiency promotes renal tumor growth by inducing glucose uptake and angiogenesis (28,29) and FH exerts oncogenic effects in renal cell carcinoma through its ability to activate hypoxia-inducible factor (HIF) by directly inhibiting prolyl hydroxylases (30). Crosstalk between HIF and EGFR has been described as a tumor-promoting mechanism and EGFR signaling enhanced HIF activity through the PI3K/AKT pathway (31). Moreover, accumulation of fumarate, caused by FH mutations, promotes EMT and increases cell migration (32). In agreement with the aforementioned reports, especially for renal cell carcinoma, FH knockdown resulted in an increase in endometrial cancer cell proliferation and metastasis in the present study.
A previous study demonstrated that FH deficiency resulted in diminished p53 levels in kidney cancer (33). p53 exerts tumor suppressor function by upregulating tumor suppressor genes, the products of which display an array of tumor suppression activities (33). Once activated, p53 enhances the conversion of pyruvate to acetyl-CoA, allowing acetyl-CoA to enter the TCA cycle and enhance mitochondrial respiration (34). However, the activity of p53 is inhibited in the majority of cancer types (35) and a recent study demonstrated that EGFR knockdown increased wild type p53 transcriptional activity (36), which highlighted the role of TP53 mutations in influencing prognosis and responsiveness to EGFR-targeted therapy in non-small-cell lung cancer (37).
The results of the human phosphokinase array analysis conducted in the present study suggested that p-EGFR expression was upregulated in FH-knockdown cells and might mediate malignant endometrial cancer cell behavior. EGFR is a receptor tyrosine kinase that regulates cellular processes, including proliferation, migration and survival and upregulation of EGFR has been found to promote cancer cell metastasis in a variety of types of cancer, including breast, pancreatic (38), gastric (39) and head and neck (40) cancer. Tamoxifen treatment activates EGFR to promote endometrial cancer cell proliferation (41). In addition, another study found that EGFR functions as a downstream effector of MUC20 to promote endometrial cancer cell metastasis (42). In the present study, a novel discovery linking EGFR activation to malignant endometrial cancer cell behaviors when FH expression is suppressed was reported. EGFR-tyrosine kinase inhibitors (EGFR-TKIs) are widely used for the treatment of non-small cell lung cancer harboring EGFR-activating mutations (43). Gefitinib arrests PC-9 non-small cell lung cancer cells at the G0/G1 phase (44) and induced apoptosis and autophagy in A431 skin epidermoid carcinoma cells (45). The use of EGFR-TKIs is therefore promising for the targeted treatment of EGFR-activated cancer types, including endometrial cancer. Although overexpression of FH is also a potential approach for the treatment of endometrial cancer cells with downregulated FH expression, it is more practical to target EGFR activation since several EGFR-TKIs are already clinically available.
The clinical and translational significance of the present study is two-fold. First, FH can be considered as a new diagnostic and prognostic marker for endometrial cancer. Second, novel therapeutic strategies targeting FH are worthy of further investigation for personalized treatment management. However, the present study has the limitation of not including an in vivo animal study for validation. To provide a more complete picture for the role of FH in endometrial cancer initiation and progression, an in vivo model should be established to validate the in vitro and clinical findings of the present study and to explore the therapeutic potential of targeting FH for endometrial cancer treatment.
In conclusion, the present study suggested that FH functions as a tumor suppressor in endometrial cancer and presents the potential of FH to be developed as a prognostic marker and therapeutic target, after more extensive and multi-center clinical studies.
Supplementary Material
Supporting Data
Acknowledgements
Not applicable.
Funding
The present study was supported by grants from the Ministry of Science and Technology (grant nos. MOST 111-2314-B-037-011-, MOST 111-2314-B-037-020- and MOST 111-2314-B-037-046-) and the Center for Intelligent Drug Systems and Smart Bio-devices (IDS2B) from the Featured Areas Research Center Program within the framework of the Higher Education Sprout Project by the Ministry of Education, Taiwan. The present study was also supported by grants from Kaohsiung Medical University Hospital (grant nos. KMUH110-0R43, KMUH111-1R37 and KMUH-DK(A)112001) and Kaohsiung Medical University (grant nos. KMU-DK(A)111005, NYCUKMU-111-P17 and NSYSU-KMU-112-P04), Taiwan.
Availability of data and materials
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Authors' contributions
Concept and design of the experiments was by Y-Y Wang, A Vadhan, C-H Wu, C-Y Hsu, Y-C Chen, Y-K Chen, P-Y Chen, Y-C Chang and S-S Yuan. The experiments were performed by Y-Y Wang, A Vadhan, C-H Wu, C-Y Hsu, Y-C Chen and S-S Yuan. Y-Y Wang and S-S Yuan confirm the authenticity of all the raw data. Data analysis and discussion was performed by Y-Y Wang, A Vadhan, Y-K Chen, P-Y Chen, H.D.H.N. and S-S Yuan. Y-Y Wang, Y-C Chang and S-S Yuan contributed reagents, materials and analysis tools. Y-Y Wang, A Vadhan, C-H Wu, C-Y Hsu, Y-C Chen, Y-K Chen, P-Y Chen, H.D.H.N., Y-C Chang and S-S Yuan prepared the manuscript. All authors read and approved the final manuscript.
Ethics approval and consent to participate
Ethical approval was obtained from the Ethics Committee of Kaohsiung Medical University Hospital.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that there are no conflicts of interest.
References
|
Plataniotis G and Castiglione M; ESMO Guidelines Working Group, : Endometrial cancer: ESMO clinical practice guidelines for diagnosis, treatment and follow-up. Ann Oncol. 21 (Suppl 5):v41–v45. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Siegel RL, Miller KD and Jemal A: Cancer statistics, 2019. CA Cancer J Clin. 69:7–34. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Setiawan VW, Yang HP, Pike MC, McCann SE, Yu H, Xiang YB, Wolk A, Wentzensen N, Weiss NS, Webb PM, et al: Type I and II endometrial cancers: Have they different risk factors? J Clin Oncol. 31:2607–2618. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Braun MM, Overbeek-Wager EA and Grumbo RJ: Diagnosis and management of endometrial cancer. Am Fam Physician. 93:468–474. 2016.PubMed/NCBI | |
|
Kyo S and Nakayama K: Endometrial cancer as a metabolic disease with dysregulated PI3K signaling: Shedding light on novel therapeutic strategies. Int J Mol Sci. 21:60732020. View Article : Google Scholar : PubMed/NCBI | |
|
Lauby-Secretan B, Scoccianti C, Loomis D, Grosse Y, Bianchini F and Straif K; International Agency for Research on Cancer Handbook Working Group, : Body fatness and cancer-viewpoint of the IARC Working Group. N Engl J Med. 375:794–798. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Frezza C: Mitochondrial metabolites: Undercover signalling molecules. Interface Focus. 7:201601002017. View Article : Google Scholar : PubMed/NCBI | |
|
Akram M: Citric acid cycle and role of its intermediates in metabolism. Cell Biochem Biophys. 68:475–478. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Raimundo N, Baysal BE and Shadel GS: Revisiting the TCA cycle: Signaling to tumor formation. Trends Mol Med. 17:641–649. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Picaud S, Kavanagh KL, Yue WW, Lee WH, Muller-Knapp S, Gileadi O, Sacchettini J and Oppermann U: Structural basis of fumarate hydratase deficiency. J Inherit Metab Dis. 34:671–676. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Tomlinson IPM, Alam NA, Rowan AJ, Barclay E, Jaeger EE, Kelsell D, Leigh I, Gorman P, Lamlum H, Rahman S, et al: Germline mutations in FH predispose to dominantly inherited uterine fibroids, skin leiomyomata and papillary renal cell cancer. Nat Genet. 30:406–610. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Liu C, Dillon J, Beavis AL, Liu Y, Lombardo K, Fader AN, Hung CF, Wu TC, Vang R, Garcia JE and Xing D: Prevalence of somatic and germline mutations of fumarate hydratase in uterine leiomyomas from young patients. Histopathology. 76:354–365. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
Yuan SSF, Hou MF, Hsieh YC, Huang CY, Lee YC, Chen YJ and Lo S: Role of MRE11 in cell proliferation, tumor invasion, and DNA repair in breast cancer. J Natl Cancer Inst. 104:1485–1502. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Yeung KT and Yang J: Epithelial-mesenchymal transition in tumor metastasis. Mol Oncol. 11:28–39. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Sciacovelli M, Gonçalves E, Johnson TI, Zecchini VR, da Costa AS, Gaude E, Drubbel AV, Theobald SJ, Abbo SR, Tran MG, et al: Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition. Nature. 537:544–547. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Michalova K, Tretiakova M, Pivovarcikova K, Alaghehbandan R, Perez Montiel D, Ulamec M, Osunkoya A, Trpkov K, Yuan G, Grossmann P, et al: Expanding the morphologic spectrum of chromophobe renal cell carcinoma: A study of 8 cases with papillary architecture. Ann Diagn Pathol. 44:1514482020. View Article : Google Scholar : PubMed/NCBI | |
|
Chen T, Peng Y, Lei T, Wu C, Wang H and Shi Y: Low-grade oncocytic tumour (LOT) of the kidney is characterised by GATA3 positivity, FOXI1 negativity and mTOR pathway mutations. Pathol Oncol Res. 29:16108522023. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang W, Chu J, Zou YW, Jiang YX, Wei ZM, Zhong DC, Liu Y, Li YJ and Yu WJ: Clinicopathological characteristics of fumarate hydratase-deficient renal cell carcinoma. Zhonghua Bing Li Xue Za Zhi. 48:120–126. 2019.(In Chinese). PubMed/NCBI | |
|
Kyo S, Sakaguchi J, Ohno S, Mizumoto Y, Maida Y, Hashimoto M, Nakamura M, Takakura M, Nakajima M, Masutomi K and Inoue M: High twist expression is involved in infiltrative endometrial cancer and affects patient survival. Hum Pathol. 37:431–438. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Ihira K, Dong P, Xiong Y, Watari H, Konno Y, Hanley SJ, Noguchi M, Hirata N, Suizu F, Yamada T, et al: EZH2 inhibition suppresses endometrial cancer progression via miR-361/Twist axis. Oncotarget. 8:13509–13520. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Wu HM, Huang HY, Schally AV, Chao A, Chou HH, Leung PC and Wang HS: Growth hormone-releasing hormone antagonist inhibits the invasiveness of human endometrial cancer cells by down-regulating twist and N-cadherin expression. Oncotarget. 8:4410–4421. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Sobel G, Németh J, Kiss A, Lotz G, Szabó I, Udvarhelyi N, Schaff Z and Páska C: Claudin 1 differentiates endometrioid and serous papillary endometrial adenocarcinoma. Gynecol Oncol. 103:591–598. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Dhawan P, Singh AB, Deane NG, No Y, Shiou SR, Schmidt C, Neff J, Washington MK and Beauchamp RD: Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer. J Clin Invest. 115:1765–1776. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Bhat AA, Syed N, Therachiyil L, Nisar S, Hashem S, Macha MA, Yadav SK, Krishnankutty R, Muralitharan S, Al-Naemi H, et al: Claudin-1, a double-edged sword in cancer. Int J Mol Sci. 21:5692020. View Article : Google Scholar : PubMed/NCBI | |
|
Hol JA, Jongmans MCJ, Littooij AS, de Krijger RR, Kuiper RP, van Harssel JJT, Mensenkamp A, Simons M, Tytgat GAM, van den Heuvel-Eibrink MM and van Grotel M: Renal cell carcinoma in young FH mutation carriers: Case series and review of the literature. Fam Cancer. 19:55–63. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
Castro-Vega LJ, Buffet A, De Cubas AA, Cascón A, Menara M, Khalifa E, Amar L, Azriel S, Bourdeau I, Chabre O, et al: Germline mutations in FH confer predisposition to malignant pheochromocytomas and paragangliomas. Hum Mol Genet. 23:2440–2446. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Hvinden IC, Cadoux-Hudson T, Schofield CJ and McCullagh JSO: Metabolic adaptations in cancers expressing isocitrate dehydrogenase mutations. Cell Rep Med. 2:10046922021. View Article : Google Scholar : PubMed/NCBI | |
|
Isaacs JS, Jung YJ, Mole DR, Lee S, Torres-Cabala C, Chung YL, Merino M, Trepel J, Zbar B, Toro J, et al: HIF overexpression correlates with biallelic loss of fumarate hydratase in renal cancer: Novel role of fumarate in regulation of HIF stability. Cancer Cell. 8:143–153. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Pollard PJ, Brière JJ, Alam NA, Barwell J, Barclay E, Wortham NC, Hunt T, Mitchell M, Olpin S, Moat SJ, et al: Accumulation of Krebs cycle intermediates and over-expression of HIF1alpha in tumours which result from germline FH and SDH mutations. Hum Mol Genet. 14:2231–2239. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Lindner AK, Tulchiner G, Seeber A, Siska PJ, Thurnher M and Pichler R: Targeting strategies in the treatment of fumarate hydratase deficient renal cell carcinoma. Front Oncol. 12:9060142022. View Article : Google Scholar : PubMed/NCBI | |
|
Peng XH, Karna P, Cao Z, Jiang B-H, Zhou M and Yang L: Cross-talk between epidermal growth factor receptor and hypoxia-inducible factor-1alpha signal pathways increases resistance to apoptosis by up-regulating survivin gene expression. J Biol Chem. 281:25903–25914. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Bhattacharya D and Scimè A: Metabolic regulation of epithelial to mesenchymal transition: Implications for endocrine cancer. Front Endocrinol (Lausanne). 10:7732019. View Article : Google Scholar : PubMed/NCBI | |
|
Kruiswijk F, Labuschagne CF and Vousden KH: p53 in survival, death and metabolic health: A lifeguard with a licence to kill. Nat Rev Mol Cell Biol. 16:393–405. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Contractor T and Harris CR: p53 negatively regulates transcription of the pyruvate dehydrogenase kinase Pdk2. Cancer Res. 72:560–567. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Muller PA and Vousden KH: p53 mutations in cancer. Nat Cell Biol. 15:2–8. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Ding J, Li X, Khan S, Zhang C, Gao F, Sen S, Wasylishen AR, Zhao Y, Lozano G, Koul D and Alfred Yung WK: EGFR suppresses p53 function by promoting p53 binding to DNA-PKcs: A noncanonical regulatory axis between EGFR and wild-type p53 in glioblastoma. Neuro Oncol. 24:1712–1725. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Canale M, Andrikou K, Priano I, Cravero P, Pasini L, Urbini M, Delmonte A, Crinò L, Bronte G and Ulivi P: The role of TP53 mutations in EGFR-mutated non-small-cell lung cancer: Clinical significance and implications for therapy. Cancers (Basel). 14:11432022. View Article : Google Scholar : PubMed/NCBI | |
|
Lee J and Kim JH: Kaempferol inhibits pancreatic cancer cell growth and migration through the blockade of EGFR-related pathway in vitro. PLoS One. 11:e01552642016. View Article : Google Scholar : PubMed/NCBI | |
|
Jiang L, Lan T, Chen Y, Sang J, Li Y, Wu M, Tao Y, Wang Y, Qian H and Gu L: PKG II inhibits EGF/EGFR-induced migration of gastric cancer cells. PLoS One. 8:e616742013. View Article : Google Scholar : PubMed/NCBI | |
|
Holz C, Niehr F, Boyko M, Hristozova T, Distel L, Budach V and Tinhofer I: Epithelial-mesenchymal-transition induced by EGFR activation interferes with cell migration and response to irradiation and cetuximab in head and neck cancer cells. Radiother Oncol. 101:158–164. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang L, Li Y, Lan L, Liu R, Wu Y, Qu Q and Wen K: Tamoxifen has a proliferative effect in endometrial carcinoma mediated via the GPER/EGFR/ERK/cyclin D1 pathway: A retrospective study and an in vitro study. Mol Cell Endocrinol. 437:51–61. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Chen CH, Wang SW, Chen CW, Huang MR, Hung JS, Huang HC, Lin HH, Chen RJ, Shyu MK and Huang MC: MUC20 overexpression predicts poor prognosis and enhances EGF-induced malignant phenotypes via activation of the EGFR-STAT3 pathway in endometrial cancer. Gynecol Oncol. 128:560–567. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Singh M and Jadhav HR: Targeting non-small cell lung cancer with small-molecule EGFR tyrosine kinase inhibitors. Drug Discov Today. 23:745–753. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang L, Qi Y, Xing K, Qian S, Zhang P and Wu X: A novel strategy of EGFR-TKI combined chemotherapy in the treatment of human lung cancer with EGFR-sensitive mutation. Oncol Rep. 40:1046–1054. 2018.PubMed/NCBI | |
|
Wang J, Wang C, Hu X, Yu C, Zhou L, Ding Z and Zhou M: Gefitinib-mediated apoptosis is enhanced via inhibition of autophagy by chloroquine diphosphate in cutaneous squamous cell carcinoma cells. Oncol Lett. 18:368–374. 2019.PubMed/NCBI |
