Open Access

Application of multiplex ligation-dependent probe amplification, and identification of a heterozygous Alu-associated deletion and a uniparental disomy of chromosome 1 in two patients with 3-hydroxy-3-methylglutaryl-CoA lyase deficiency

  • Authors:
    • Yuka Aoyama
    • Toshiyuki Yamamoto
    • Naomi Sakaguchi
    • Mika Ishige
    • Toju Tanaka
    • Tomoko Ichihara
    • Katsuaki Ohara
    • Hiroko Kouzan
    • Yasutomi Kinosada
    • Toshiyuki Fukao
  • View Affiliations

  • Published online on: April 14, 2015     https://doi.org/10.3892/ijmm.2015.2184
  • Pages: 1554-1560
  • Copyright: © Aoyama et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Mitochondrial 3-hydroxy-3-methylglutaryl-CoA lyase (HMGCL) deficiency is an autosomal recessive disorder affecting the leucine catabolic pathway and ketone body synthesis, and is clinically characterized by metabolic crises with hypoketotic hypoglycemia, metabolic acidosis and hyperammonemia. In the present study, we initially used PCR with genomic followed by direct sequencing to investigate the molecular genetic basis of HMGCL deficiency in two patients clinically diagnosed with the condition. Although we identified a mutation in each patient, the inheritance patterns of these mutations were not consistent with disease causation. Therefore, we investigated HMGCL using multiplex ligation‑dependent probe amplification (MLPA) to determine the copy numbers of all exons. A heterozygous deletion that included exons 2-4 was identified in one of the patients. MLPA revealed that the other patient had two copies for all HMGCL exons. Paternal uniparental isodisomy of chromosome 1 was confirmed in this patient by microarray analysis. These findings indicate that MLPA is useful for the identification of genomic aberrations and mutations other than small-scale nucleotide alterations. To the best of our knowledge, this is the first study describing HMGCL deficiency caused by uniparental disomy.

Introduction

Mitochondrial 3-hydroxy-3-methylglutaryl-CoA lyase (HMGCL; EC 4.1.3.4) deficiency is an autosomal recessive disorder that affects leucine catabolism and ketogenesis. The HMGCL gene, located on chromosome 1p36.1, contains nine exons and spans approximately 25 kb (1). In the majority of HMGCL-deficient patients, the first hypoglycemic crisis occurs before the age of one, while one-third of all cases may have neonatal onset. In acute episodes, laboratory data have shown patients with non- or hypoketotic hypoglycemia with high levels of free fatty acids and severe metabolic acidosis with liver dysfunction and hyperammonemia (2). In Japan, HMGCL deficiency is one of the inborn errors of metabolism screened for in newborns by tandem mass spectrometry. Six Japanese HMGCL-deficient patients, including those previously reported (3) were re-evaluated (2). Among them, three had neonatal onset. Follow-up data showed that two patients experienced hypoglycemic crises even after ten years of age. Developmental delay and epilepsy were noted in two and three patients, respectively (2).

We recently encountered two Japanese HMGCL-deficient patients, whose inheritance patterns of single nucleotide mutations were not consistent with transmission within their families. HMGCL has 23 Alu elements in introns. Recombination between Alu elements results in genomic deletions associated with a number of human genetic disorders (4). Hence, we hypothesized that these patients may have an intragenic deletion by non-equal homologous recombination between Alu elements (57). Large homozygous deletions can be suspected by the absence of the deleted exons detected by PCR amplification. However, the detection of heterozygous deletions is difficult using routine PCR amplification of genomic DNA and direct sequencing. Multiplex ligation-dependent probe amplification (MLPA) has been proven to be an efficient and reliable technique for the copy number analysis of each exon in a gene (5,810). In the present study, we applied MLPA for the analysis of copy numbers in exons of HMGCL and confirmed mutations in the two patients with HMGCL deficiency.

Patients and methods

Patients

Patient 1 was of the female gender, born to non-consanguineous parents, who presented with hypoglycemia at the age of 2 days. She also experienced hypoketotic hypoglycemic crises at the age of 6, 8 and 13 months. She was diagnosed as having HMGCL deficiency at the age of 13 months by urine organic acid analysis, which detected 3-hydroxymethylgluta-rate, 3-methylglutaconate and 3-hydroxy-3-methylglutarate. The patient is currenlty 13 years old. She has epilepsy and developmental delay.

Patient 2 was of the male gender, born to non-consanguineous parents, who presented with vomiting and unconsciousness at the age of 3 months. He was diagnosed as having HMGCL deficiency at the age of 3 months by urine organic acid analysis and blood acylcarnitine analysis. He has experienced ten or more hypoketotic hypoglycemic crises, the last of which was at the age of 4 years. He is currently 8 years old and has achieved normal development. A case report for this patient has been previously published in Japanese (11).

Mutation analysis at the genomic DNA level

The present study was approved by the Ethics Committee of the Graduate School of Medicine, Gifu University, Gifu, Japan. Genomic DNA was purified from peripheral blood samples using Sepa Gene kits (Sanko Junyaku Co., Ltd., Tokyo, Japan). Mutation screening was performed at the genomic level by PCR and direct sequencing, using a set of primer pairs that amplify fragments, including exons and their intron boundaries. The primer sequences are presented in Table I.

Table I

Amplification primer for HMGCL exons.

Table I

Amplification primer for HMGCL exons.

ExonFoward primerSequenceReverse primerSequenceProduct size (bp)
1HL1s 5′-GTGGAGCCAGCTTCGGAAGT-3′HL1as 5′-GGGAGGGTCCAGGACTCCAACG-3′324
2HL2s 5′-ATGAATTCGGTCTCCCTGGGAATTG-3′HL2as 5′-TAACTTGTGCAGAGGAATCACATC-3′275
3HL3s 5′-ATGAATTCTGCATTTTGAGGCTGTTT-3′HL3as 5′-TTTGCTGCAACACAGTGCTATG-3′325
4HL4s 5′-ATGAATTCCTGCTCTTGGTGATGACT-3′HL4as 5′-GATCACAGAGCAGTGAGTGGCA-3′314
5HL5s 5′-GAACCCAGGAGGTGGAGGTTGCA-3′HL5a 5′-ATAAGCTTGAACGGTACAGAGGAAAGGA-3′329
6HL6s 5′-CTGGCACTGAATTGTACCAT-3′HL6as 5′-GGGTGAATGAATGAAGTCAGGA-3′336
7HL7s 5′-AACTGAGTGCGTCATACCCAGA-3′HL7as 5′-CAGAGCTGTACACTTCACATCTG-3′473
8HL8s 5′-ATGAATTCGGCAACAGACGATTGGG-3′HL8as 5′-GAGCCACTGCGCCTGGCTAACC-3′366
9HL9s 5′-CCTGGTGTTGAGGGCATACC-3′HL9as 5′-TGCCAGGAGAGACCTCTGTGTA-3′300
Establishment of MLPA for the analysis of HMGCL

The MLPA reaction is an efficient and reliable technique for the analysis of exon copy numbers. We designed a pair of MLPA probes for each HMGCL exon, using the human MLPA probe design program (H-MAPD), as previously described (12). The MLPA probe sets for the HMGCL exon are listed in Table II. MLPA reactions were performed according to the manufacturer’s instructions (MRC-Holland BV, Amsterdam, The Netherlands) using 100 ng of genomic DNA, the EK1 MLPA reagent kit and the P200-A1 Human DNA reference kit, which includes reference probes and MLPA control fragments (MRC-Holland BV). The PCR products were separated by capillary electrophoresis on an ABI 3130×l genetic analyzer (Applied Biosystems, Warrington, UK). GeneMapper v4.0 software (Applied Biosystems) was used to analyze the separated products and to retrieve peak intensities corresponding to each probe in the different samples. Integrated peak areas were exported to an Excel 2003 spreadsheet. Data generated from a combination of the HMGCL synthetic probe mix and the P200-A1 probe mix were intra-normalized by dividing the peak area of the amplification product of each probe by the total area of only the reference probes in P200-A1. Secondly, normalization was achieved by dividing this intra-normalized probe ratio in a sample by the average intra-normalized probe ratio of all reference samples.

Table II

MLPA probes for the HMGCL gene.

Table II

MLPA probes for the HMGCL gene.

ExonProduct length (base)Primer nameLengthProbe sequence
1104MLPA-HMGCLEX1L50 GGGTTCCCTAAGGGTTGGA5016TGGACTGCCGCGGGGGATTCTGGGCCAAGAT
MLPA-HMGCLEX1R54 5047GGCAGCAATGAGGAAGGCGCTTCCGCGGCGATCTAGATTGGATCTTGCTGGCAC
2108MLPA-HMGCLEX2L52 GGGTTCCCTAAGGGTTGGA9872CACCTCATCTATGGGCACTTTACCAAAGCGGGT
MLPA-HMGCLEX2R56 9905GAAAATTGTGGAAGTTGGTCCCCGAGATGGACTTCTAGATTGGATCTTGCTGGCAC
3112MLPA-HMGCLEX3L54 GGGTTCCCTAAGGGTTGGA12925GAAGCAGGACTCTCTGTTATAGAAACCACCAGCTT
MLPA-HMGCLEX3R58 12960TGTGTCTCCTAAGTGGGTTCCCCAGGTGAGCCCTATCTAGATTGGATCTTGCTGGCAC
4116MLPA-HMGCLEX4L56 GGGTTCCCTAAGGGTTGGA13730TTCCTGGCATCAACTACCCAGTCCTGACCCCAAATTT
MLPA-HMGCLEX4R60 13767GAAAGGCTTCGAGGCAGCGGTAAGAGGATAGCTTGTTTCTAGATTGGATCTTGCTGGCAC
5120MLPA-HMGCLEX5L58 GGGTTCCCTAAGGGTTGGA16193TTGTTCCATAGAGGAGAGTTTTCAGAGGTTTGACGCAAT
MLPA-HMGCLEX5R62 16232CCTGAAGGCAGCGCAGTCAGCCAATATTTCTGTGCGGGGTCTAGATTGGATCTTGCTGGCAC
6124MLPA-HMGCLEX6L60 GGGTTCCCTAAGGGTTGGA19636TCATTCCTCCCCTGTCTTCCCACAGGTACGTCTCCTGTGCT
MLPA-HMGCLEX6R64 19677CTTGGCTGCCCTTATGAAGGGAAGATCTCCCCAGCTAAAGTTCTAGATTGGATCTTGCTGGCAC
7128MLPA-HMGCLEX7L62 GGGTTCCCTAAGGGTTGGA22152TACTCAATGGGCTGCTACGAGATCTCCCTGGGGGACACCATTG
MLPA-HMGCLEX7R66 22195GTGTGGGCACCCCAGGGATCATGAAAGACATGCTATCTGCTGTTCTAGATTGGATCTTGCTGGCAC
8132MLPA-HMGCLEX8L64 GGGTTCCCTAAGGGTTGGA25930TCTAGATGGGAGTGAGTGTCGTGGACTCTTCTGTGGCAGGACTTG
MLPA-HMGCLEX8R68 25975GAGGCTGTCCCTACGCACAGGGGGCATCAGGAAACTTGGCCACAGTCTAGATTGGATCTTGCTGGCAC
9136MLPA-HMGCLEX9L66 GGGTTCCCTAAGGGTTGGA27975CTCAGGCTACCTGTAAACTCTGAGCCCCTTGCCCACCTGAAGCCCTG
MLPA-HMGCLEX9R70 28022GGGATGATGTGGAAATAGGGGCACACACAGATGATTCATGGATGGGGTCTAGATTGGATCTTGCTGGCAC

[i] Left primer sequence (5′→3′), GGGTTCCCTAAGGGTTGGA; right primer sequence (5′→3′), TCTAGATTGGATCTTGCTGGCAC. Hybridization sequences are shown in italics. MPLA, multiplex ligation-dependent probe amplification.

Deletion breakpoint characterization

The region surrounding the deletion from intron 1 to intron 4 in patient 1 was amplified using three primer pairs as follows: fragment A: sense primer (In1s1, 5′-ACGAACGGTGGTAAAGAGGCAACAG-3′) located at position g.6421–6445 in intron 1 and antisense primer (Ex5as, 5′-TTGGCTGACTGCGCTGCCTTCAGGA-3′) located at position g.16255–16231 in exon 5; fragment B: sense primer (In1s3, 5′-GTGATGATTCCAGGAGGTCAGA GGA-3′) located at position g.8701–8725 in intron 1 and antisense primer Ex5as; and fragment C: sense primer In1s3 and antisense primer (In4as1: 5′-GAGAGGCATAGGACAGATTCTCC-3′) located at position g.15110–15088 in intron 4 (GenBank accession no. NG_013061).

PCR was carried out for 40 cycles at 94°C for 1 min, 64°C for 2 min, 72°C for 2 min followed by a 5-min extension at 72°C using Takara r-Taq (Takara Shuzo Co., Ltd., Shiga, Japan) and a Takara PCR thermal cycler. After subcloning into the pGEM-T Easy vector (Promega, Madison, WI, USA), the fragments were sequenced.

Comparative genomic hybridization (CGH) and single nucleotide polymorphism (SNP) microarray analysis

Whole genomic copy number analysis was performed for patient 2 using an Agilent SurePrint G3 Hmn CGH + SNP 180K Microarray kit (Agilent Technologies, Santa Clara, CA, USA), according to the manufacturer’s instructions. Genomic DNA extracted from peripheral blood was used as a template. Data were extracted using Feature Extraction version 9 (Agilent Technologies) and the results were visualized using Agilent Genomic Workbench version 6.5 (Agilent Technologies).

Results

Mutation analysis

Mutations were screened at the genomic level using PCR amplification followed by direct sequencing. Patient 1 had a heterozygous c. 31C>T (p.R11*) mutation in exon 1, and her mother did not have this mutation (Fig. 1). No mutation in the maternal allele was identified. The DNA of the father was not available. Patient 2 had a homozygous c.242G>A (p.W81*) mutation in exon 3. Genomic analyses of his patients revealed that the father was heterozygous for the p.W81* mutation; however, the mother did not have the p.W81* mutation (Fig. 2). Hence, we hypothesized the following: i) the maternal allele may have a large deletion not including exon 1 in patient 1; and ii) the maternal allele in patient 2 may have a deletion including exon 3.

MLPA analysis of HMGCL

We successfully performed MLPA for HMGCL. Similar patterns of amplification were obtained in three controls, enabling copy number to be evaluated in the patient samples (Fig. 3). In patient 1 and his mother, only one copy of exons 2–4 was present, whereas two copies of all other exons were present, suggesting a large deletion including exons 2–4 in the maternal allele (Fig. 3). Patient 2 and his parents all had two copies of all HMGCL exons (Fig. 3). This means that both copies of exon 3 in patient 2 were from the father. We, therefore, suspected that patient 2 has a paternal uniparental disomy of the HMGCL region.

Determination of breakpoints in patient 1

Long-range PCR amplification using DNA from patient 1 yielded fragments that included an approximate 4-kb deletion (Fig. 4A). A large deletion from g.9326 to g.13806 (4481 bp; NG_013061) was identified. We confirmed that one breakpoint was within an Alu element in intron 1 and the other was in a non-Alu element in intron 4 (Fig. 4B).

CGH and SNP arrays in patient 2

To confirm the copy number and SNP haplotype of the HMGCL region, microarray analysis using CGH + SNP array was performed for patient 2. In the CGH array, no copy number aberration was detected in the whole of chromosome 1 including the HMGCL region, which confirmed the homozygous status of the HMGCL mutation (Fig. 5).

Furthermore, a loss of heterozygosity (LOH) for almost all of chromosome 1, where HMGCL is located, was revealed. This indicated paternal uniparental disomy of chromosome 1. In conclusion, a homozygous mutation in HMGCL was determined to be caused by non-Mendelian inheritance due to paternal uniparental isodisomy of the whole chromosome 1, including the 1p36.1 region.

Discussion

In the present study, we investigated the molecular genetic basis of two Japanese HMGCL-deficient patients using standard Sanger sequencing. Although we identified a mutation in each patient, inheritance patterns were not consistent in their families. Human HMGCL is an Alu element-rich gene, having 23 Alu elements within 23 kb. We first hypothesized that a heterozygous intragene deletion caused by non-equal homologous recombination between Alu elements was a possible cause of HMGCL mutation in these patients. Therefore, we used the MLPA method to detect the copy numbers of each exon in HMGCL.

Patient 1 had a heterozygous p.R11* mutation from the father, but a mutation from the mother was not identified by conventional sequence analysis. MLPA revealed that patient 1 and her mother had only one copy of exons 2–4, which was consistent with our hypothesis. However, this large deletion that included exons 2–4 was not caused by non-equal Alu-mediated homologous recombination. One breakpoint was within an Alu element in intron 1 and the other was in a non-Alu element in intron 4. There were no homologous sequences around the breakpoint. The genesis of this deletion is unknown.

Patient 2 had an apparent homozygous p.W81* mutation and his father was heterozygous for this mutation; however, his mother did not have this mutation. MLPA revealed that patient 2 had two copies of each HMGCL exon. Hence, our new hypothesis was that LOH of the HMGCL region may be the molecular basis for HMGCL deficiency in this patient. We successfully identified a paternal uniparental isodisomy of almost the entire chromosome 1 by microarray analysis using a CGH + SNP array. To the best of our knowledge, this is the first case of HMGCL deficiency shown to be caused by uniparental disomy.

There are two types of uniparental disomy, heterodisomy and isodisomy. In heterodisomy, a pair of non-identical chromosomes is inherited from one parent and in isodisomy a single chromosome from one parent is duplicated. Isodisomy is potentially dangerous as it may lead to the duplication of lethal recessive genes, while heterodisomy is essentially benign. Uniparental disomy in humans is mainly caused by meiotic non-disjunction events followed by i) gamete complementation; ii) trisomy rescue; iii) monosomy duplication; and iv) somatic crossing over (13). Our present results from HMGCL gene analysis, MLPA and CGH + SNP arrays indicate that patient 2 had a monosomic duplication of paternal chromosome 1. Partial and whole uniparental disomy of chromosome 1 has been reported in autism, fumarase deficiency, Stargardt disease, Pelizaeus- Merzbacher-like disease, leptin receptor deficiency, rhizomelic chondrodysplasia punctata type 2 and CD45-deficient severe combined immunodeficiency (1420). This study demonstrates the advantage of using MLPA method for the analysis and identification of such heterozygous gene alterations. The identification of such mutations may facilitate mutation analysis in newly diagnosed patients.

Acknowledgments

We are grateful to the patients for their participation in this study. The present study was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (26114708, 24591505) and Health and Labor Science Research Grants for Research on Intractable Diseases from the Ministry of Health, Labor and Welfare of Japan to T.F.

Abbreviations:

HMGCL

3-hydroxy-3-methylglutaryl-CoA lyase

MLPA

multiplex ligation-dependent probe amplification

CGH

comparative genomic hybridization

SNP

single nucleotide polymorphism

LOH

loss of heterozygosity

References

1 

Wang SP, Robert MF, Gibson KM, Wanders RJ and Mitchell GA: 3-Hydroxy-3-methylglutaryl CoA lyase (HL): mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients. Genomics. 33:99–104. 1996. View Article : Google Scholar : PubMed/NCBI

2 

Fukao T, Mitchell G, Sass JO, Hori T, Orii K and Aoyama Y: Ketone body metabolism and its defects. J Inherit Metab Dis. 37:541–551. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Muroi J, Yorifuji T, Uematsu A, Shigematsu Y, Onigata K, Maruyama H, Nobutoki T, Kitamura A and Nakahata T: Molecular and clinical analysis of Japanese patients with 3-hydroxy-3-methylglutaryl CoA lyase (HL) deficiency. Hum Genet. 107:320–326. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Sen SK, Han K, Wang J, Lee J, Wang H, Callinan PA, Dyer M, Cordaux R, Liang P and Batzer MA: Human genomic deletions mediated by recombination between Alu elements. Am J Hum Genet. 79:41–53. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Fukao T, Aoyama Y, Murase K, Hori T, Harijan RK, Wierenga RK, Boneh A and Kondo N: Development of MLPA for human ACAT1 gene and identification of a heterozygous Alu-mediated deletion of exons 3 and 4 in a patient with mitochondrial acetoacetyl-CoA thiolase (T2) deficiency. Mol Genet Metab. 110:184–187. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Fukao T, Zhang G, Rolland MO, Zabot MT, Guffon N, Aoki Y and Kondo N: Identification of an Alu-mediated tandem duplication of exons 8 and 9 in a patient with mitochondrial acetoacetyl-CoA thiolase (T2) deficiency. Mol Genet Metab. 92:375–378. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Zhang G, Fukao T, Sakurai S, Yamada K, Michael Gibson K and Kondo N: Identification of Alu-mediated, large deletion-spanning exons 2–4 in a patient with mitochondrial acetoacetyl-CoA thiolase deficiency. Mol Genet Metab. 89:222–226. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Gatta V1, Scarciolla O, Gaspari AR, Palka C, De Angelis MV, Di Muzio A, Guanciali-Franchi P, Calabrese G, Uncini A and Stuppia L: Identification of deletions and duplications of the DMD gene in affected males and carrier females by multiple ligation probe amplification (MLPA). Hum Genet. 117:92–98. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Janssen B, Hartmann C, Scholz V, Jauch A and Zschocke J: MLPA analysis for the detection of deletions, duplications and complex rearrangements in the dystrophin gene: potential and pitfalls. Neurogenetics. 6:29–35. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Lalic T, Vossen RH, Coffa J, Schouten JP, Guc-Scekic M, Radivojevic D, Djurisic M, Breuning MH, White SJ and den Dunnen JT: Deletion and duplication screening in the DMD gene using MLPA. Eur J Hum Genet. 13:1231–1234. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Tomoko T, Takanori S, Kazumi O, et al: A case of 3-Hydroxy-3-methylglutaryl CoA lyase deficiency. J Jpn Pediatr Soc. 112:1249–1254. 2008.In Japanese.

12 

Zhi J and Hatchwell E: Human MLPA Probe Design (H-MAPD): a probe design tool for both electrophoresis-based and bead-coupled human multiplex ligation-dependent probe amplification assays. BMC Genomics. 9:4072008. View Article : Google Scholar : PubMed/NCBI

13 

Ledbetter DH and Engel E: Uniparental disomy in humans: development of an imprinting map and its implications for prenatal diagnosis. Hum Mol Genet. 4:Spec No. 1757–1764. 1995.PubMed/NCBI

14 

Riveiro-Alvarez R, Valverde D, Lorda-Sanchez I, Trujillo-Tiebas MJ, Cantalapiedra D, Vallespin E, Aguirre-Lamban J, Ramos C and Ayuso C: Partial paternal uniparental disomy (UPD) of chromosome 1 in a patient with Stargardt disease. Mol Vis. 13:96–101. 2007.PubMed/NCBI

15 

Shimojima K, Tanaka R, Shimada S, Sangu N, Nakayama J, Iwasaki N and Yamamoto T: A novel homozygous mutation of GJC2 derived from maternal uniparental disomy in a female patient with Pelizaeus-Merzbacher-like disease. J Neurol Sci. 330:123–126. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Wassink TH, Losh M, Frantz RS, Vieland VJ, Goedken R, Piven J and Sheffield VC: A case of autism and uniparental disomy of chromosome 1. Hum Genet. 117:200–206. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Zeng WQ, Gao H, Brueton L, Hutchin T, Gray G, Chakrapani A, Olpin S and Shih VE: Fumarase deficiency caused by homozygous P131R mutation and paternal partial isodisomy of chromosome 1. Am J Med Genet A. 140:1004–1009. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Nimmo G, Monsonego S, Descartes M, Franklin J, Steinberg S and Braverman N: Rhizomelic chrondrodysplasia punctata type 2 resulting from paternal isodisomy of chromosome 1. Am J Med Genet A. 152A:1812–1817. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Roberts JL1, Buckley RH, Luo B, Pei J, Lapidus A, Peri S, Wei Q, Shin J, Parrott RE and Dunbrack RL Jr: CD45-deficient severe combined immunodeficiency caused by uniparental disomy. Proc Natl Acad Sci USA. 109:10456–10461. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Le Beyec J, Cugnet-Anceau C, Pépin D, Alili R, Cotillard A, Lacorte JM, Basdevant A and Laville Mand Clément K: Homozygous leptin receptor mutation due to uniparental disomy of chromosome 1: response to bariatric surgery. J Clin Endocrinol Metab. 98:E397–E402. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

June-2015
Volume 35 Issue 6

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Aoyama Y, Yamamoto T, Sakaguchi N, Ishige M, Tanaka T, Ichihara T, Ohara K, Kouzan H, Kinosada Y, Fukao T, Fukao T, et al: Application of multiplex ligation-dependent probe amplification, and identification of a heterozygous Alu-associated deletion and a uniparental disomy of chromosome 1 in two patients with 3-hydroxy-3-methylglutaryl-CoA lyase deficiency. Int J Mol Med 35: 1554-1560, 2015.
APA
Aoyama, Y., Yamamoto, T., Sakaguchi, N., Ishige, M., Tanaka, T., Ichihara, T. ... Fukao, T. (2015). Application of multiplex ligation-dependent probe amplification, and identification of a heterozygous Alu-associated deletion and a uniparental disomy of chromosome 1 in two patients with 3-hydroxy-3-methylglutaryl-CoA lyase deficiency. International Journal of Molecular Medicine, 35, 1554-1560. https://doi.org/10.3892/ijmm.2015.2184
MLA
Aoyama, Y., Yamamoto, T., Sakaguchi, N., Ishige, M., Tanaka, T., Ichihara, T., Ohara, K., Kouzan, H., Kinosada, Y., Fukao, T."Application of multiplex ligation-dependent probe amplification, and identification of a heterozygous Alu-associated deletion and a uniparental disomy of chromosome 1 in two patients with 3-hydroxy-3-methylglutaryl-CoA lyase deficiency". International Journal of Molecular Medicine 35.6 (2015): 1554-1560.
Chicago
Aoyama, Y., Yamamoto, T., Sakaguchi, N., Ishige, M., Tanaka, T., Ichihara, T., Ohara, K., Kouzan, H., Kinosada, Y., Fukao, T."Application of multiplex ligation-dependent probe amplification, and identification of a heterozygous Alu-associated deletion and a uniparental disomy of chromosome 1 in two patients with 3-hydroxy-3-methylglutaryl-CoA lyase deficiency". International Journal of Molecular Medicine 35, no. 6 (2015): 1554-1560. https://doi.org/10.3892/ijmm.2015.2184