Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
January-2016 Volume 37 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2016 Volume 37 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway

  • Authors:
    • Lihua Wang
    • Guixian Song
    • Ming Liu
    • Bin Chen
    • Yumei Chen
    • Yahui Shen
    • Jingai Zhu
    • Xiaoyu Zhou
  • View Affiliations / Copyright

    Affiliations: Department of Neonatology, Nanjing Children's Hospital, Affiliated to Nanjing Medical University, Nanjing, Jiangsu 210029, P.R. China, Department of Cardiology, Taizhou People's Hospital, Taizhou, Jiangsu 225300, P.R. China, Department of Cardiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029, P.R. China, Department of Children Health Care, Nanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing, Jiangsu 210029, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 47-55
    |
    Published online on: November 2, 2015
       https://doi.org/10.3892/ijmm.2015.2399
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Our previous study reported that microRNA-375 (miR-375) is significantly upregulated in ventricular septal myocardial tissues from 22‑week‑old fetuses with ventricular septal defect as compared with normal controls. In the present study, the specific effects of miR‑375 on P19 cell differentiation into cardiomyocyte‑like cells were investigated. Stable P19 cell lines overexpressing miR‑375 or containing empty vector were established, which could be efficiently induced into cardiomyocyte‑like cells in the presence of dimethyl sulfoxide in vitro. miR‑375 overexpression was verified using reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR). Cell proliferation was determined according to total cell counts; cell cycle distribution and apoptosis levels were examined using flow cytometry. Apoptosis‑related morphological changes were observed using Hoechst staining and fluorescence microscopy. During P19 cell differentiation, the cardiomyogenesis‑related mRNAs (cardiac troponin T, GATA binding protein 4, myocyte‑specific enhancer factor 2C) and mRNAs involved in the Notch signaling pathway (Notch2, Delta‑like 1 and hes family bHLH transcription factor 1) were detected at days 0, 4, 6 and 10. Their differential expression was examined using RT‑qPCR; the apoptosis‑related genes BAX and Bcl‑2 were also detected using this method. The corresponding proteins were evaluated by western blotting. Compared with the control group, miR‑375 overexpression inhibited proliferation but promoted apoptosis in P19 cells, and the associated mRNAs and proteins were decreased during differentiation. miR‑375 has an important role in cardiomyocyte differentiation, and can disrupt this process via the Notch signaling pathway. The present findings contribute to the understanding of the mechanisms of congenital heart disease and facilitate the development of new gene therapies.

Introduction

The heart is one of the most frequently studied human organs and is the organ most susceptible to disease. Congenital heart defects (CHD), the most common of the human birth defects, occur in nearly 1% of the population worldwide (1,2). Significant progress in CHD treatment has occurred over the years; consequently, more patients with CHD live to adulthood, creating a new and steadily growing patient population. These patients require long-term expert medical care and healthcare, which is expensive (3,4). Correspondingly, the global health burden resulting from CHD has rapidly increased. However, CHD progresses to degenerative conditions that subsequently afflict CHD survivors. The developmental process of the heart is complicated, involving a series of genes and multiple signaling pathways (Notch, bone morphogenetic protein and transforming growth factor-β) (5,6); a small mutation in any of these genes or pathways will result in embryonic heart defects.

MicroRNAs (miRNAs or miRs) are endogenous 18–22-nucleotide RNAs that have important regulatory roles in animals and plants by targeting mRNAs for cleavage or translational repression (7,8). Currently, numerous aspects of miRNA function in animals, including their involvement in cell proliferation, apoptotic events, differentiation, fat and lipid metabolism, cancer, diabetes, and other diseases, have been researched and established (9,10). It is becoming evident that miRNAs are involved in different aspects of cardiomyogenesis (11,12), and have recently been demonstrated to serve as diagnostic biomarkers (13,14). Based on these findings, prenatal detection of fetal CHD was performed in our previous studies, identifying that miRNA-375 (miR-375) is significantly upregulated in maternal serum at 18–22 weeks of gestation with fetal CHD (15,16), indicating that it may be involved in the occurrence or development of CHD. Using bioinformatics analysis, the downstream target genes of miR-375 were predicted, which predicted mediation of Notch2, a key protein in the Notch signaling pathway.

Notch signaling is an evolutionarily conserved pathway that controls cell fate in metazoans through local cell-cell interactions. In canonical Notch signaling, transmembrane receptors (Notch1–4) bind with transmembrane ligands [Jagged1, Jagged2, Delta-like 1 (Dll1), Dll3 and Dll4] through their extracellular domains on adjacent cells, initiating proteolysis of the receptors and subsequent release of the signal-transducing Notch intracellular domain (NICD). NICD subsequently translocates to the nucleus and associates with the nuclear proteins of the recombination signal binding protein for the immunoglobulin kappa J region (RBP-Jk) family [also known as CSL or CBF1/Su (H)/Lag-1] to assemble a transcription complex, which activates the expression of the target genes of Notch signaling, such as the HES and homocysteine-induced endoplasmic reticulum protein families (17–19). Notch signaling has an essential role in cardiac cell differentiation (20,21). We hypothesized that miR-375 may influence heart development through the Notch signaling pathway, however, the detailed mechanism requires elucidation. The present study explored the role of miR-375 in cardiogenesis in vitro, which may occur via the Notch signaling pathway.

Materials and methods

P19 cell culture and induction of differentiation

P19 cells were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultivated as aggregates for 4 days in Minimum Essential Medium α-modification (α-MEM) containing 10% fetal bovine serum (FBS) (Gibco-BRL; Thermo Fisher Scientific, Grand Island, NY, USA) and 1% dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO, USA) in bacteriological dishes in 5% CO2 at 37°C. After 4 days of aggregation, the cell clusters were transferred to culture flasks in α-MEM with 10% FBS. The medium was replaced every 2 days. Cells were harvested at differentiation days 0, 4, 6 and 10. The cell morphological changes were observed and images were captured using an inverted microscope (Nikon, Tochigi, Japan).

Establishment of miR-375-overexpressing P19 cell lines

Plasmids overexpressing miR-375 and negative control vectors contained enhancing green fluorescence protein (GFP) and were constructed by GenePharma (Shanghai, China). Briefly, partial primary transcript sequences for the mouse miR-375 genes were amplified from embryonic telencephalon cDNA and cloned into pcDNA™6.2-GW/EmGFPmiR (Promega, Madison, WI, USA). miRNA transfection was performed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Fluorescence microscopy was used to observe the transfection efficiency via GFP expression of the miR-375 expression vector and control vector in P19 cells. miR-375 expression was verified using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). All the data were normalized to the internal standard (U6). Sequences for RT-qPCR primer pairs are listed as follows: mmu-miR-375 forward, AGCCGTTTGTTCGTT CGGCT and reverse primer, GTGCAGGGTCCGAGGT; and U6 forward, CGCTTCGGCAGCACATATAC and reverse primer, TTCACGAATTTGCGTGTCAT.

Cell proliferation assays
Cell counting kit-8 (CCK-8) assay

To analyze the proliferation of the stable cell lines bearing miR-375 expression plasmids or vector, 2,000 cells/well in 100 µl medium were seeded in 96-well plates subsequent to obtaining total cell counts using a hemocytometer, and were cultured in α-MEM supplemented with 10% FBS at 37°C with 5% CO2. Cell viability was monitored at 0, 24, 36, 48 and 72 h. At each time-point, each well was treated with 10 µl CCK-8 (Dojindo, Kumamoto, Japan) solution, and the optical density was measured 2 h later with a microplate reader at 450 and 650 nm.

Cell cycle assay

Flow cytometry was used to evaluate the distribution of cells in different phases of the cell cycle following transfection, basing the evaluation on the DNA content of propidium iodide (PI)-stained nuclei (22). The cells were synchronized by culturing with serum-free α-MEM for 24 h. Subsequently, all the cells were digested with EDTA-free trypsin (Invitrogen), washed in phosphate-buffered saline (PBS), and centrifuged at 1,000 rpm for 5 min. The supernatant was discarded and the pellets were fixed overnight at 4°C in cold 70% ethanol. Following this, the cells were washed with PBS and incubated with 100 mg/ml RNase A (Sigma-Aldrich) at 37°C for 1 h, and incubated at 4°C in the dark for 30 min with 100 µg/ml PI (Sigma-Aldrich). Disposed cells were analyzed using a BD FACScan system and CellQuest software (BD Biosciences, San Jose, CA, USA).

Analysis of apoptosis
Hoechst staining

The apoptosis rate in the transfected cells was first evaluated by Hoechst staining. Briefly, cells were seeded on sterile cover glasses in 6-well plates the day before treatment. Subsequently, the cells were fixed, washed twice with PBS, and stained with Hoechst 33258 (apoptosis Hoechst staining kit; Beyotime Institute of Biotechnology, Jiangsu, China) according to the manufacturer's protocol. The stained cells were examined and immediately images were captured under a fluorescence microscope (Nikon).

Flow cytometry

Cells were cultured in FBS-free α-MEM (serum-free) for 24 h to induce apoptosis, and were harvested with EDTA-free trypsin, washed in PBS, resuspended in 500 µl binding buffer, and stained with 5 µl Annexin V-allophycocyanine (Annexin V-APC) and 5 µl 7-amino-actinomycin D (7-AAD) at room temperature for 10 min (Annexin V-APC/7-AAD Apoptosis Detection kit; KeyGen Biotech, Jiangsu, China). Disposed cells were analyzed using a BD FACScan system and CellQuest software (BD Biosciences).

RT-qPCR

Total RNA was isolated from cultured P19 cells using the TRIzol method (Invitrogen) with an miRNeasy mini kit (Qiagen, Limburg, The Netherlands). Complementary DNA was synthesized from 1 µg total RNA using an AMV reverse transcriptase kit (Promega). RT-qPCR using the SYBR-Green method was performed using an ABI 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's protocols. The PCR conditions involved a denaturation step (95°C for 10 min), and amplification and quantification were repeated 40 times (95°C for 15 sec and 60°C for 1 min, respectively). The relative gene expression levels were quantified based on the threshold cycle (Ct) and normalized to the reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Table I lists the primer sequences used.

Table I

Sequences of the primer sets used in the reverse transcription-quantitative polymerase chain reaction.

Table I

Sequences of the primer sets used in the reverse transcription-quantitative polymerase chain reaction.

GeneForward primer (5′-3′)Reverse primer (3′-5′)
cTnT GGAGTACGAGGAGGAACAGG GTCCACTCTCTCTCCATCGG
GATA4 CCAACTGCCAGACTACCAC GGACCAGGCTGTTCCAAGA
MEF2C CAGCACTGACATGGATAAGG CTGCCAGGTGGGATAAGAACG
NOTCH2 GGTCGCTGTTGTCATCATCC TGACACTTGCACGGAGAGAT
DLL1 CGATGAGTGTGCTAGCAACC GCAGTGGTCTTTCAGGTGTG
HES1 CAGTGCCTTTGAGAAGCAGG CAGATAACGGGCAACTTCGG
BAX CCAGCCCATGATGGTTCTGAT CCGGCGAATTGGAGATGAACT
BCL-2 CAGACATGCACCTACCCAGC GTCGCTACCGTCGTGACTTC
GAPDH CCAACTGCCAGACTACCAC GGACCAGGCTGTTCCAAGA

[i] cTnT, cardiac troponin T; GATA4, GATA binding protein 4; MEF2C, myocyte enhancer factor 2C; DLL1, Delta-like 1; HES1, hes family bHLH transcription factor 1; BCL-2, B-cell chronic lymphocytic leukemia/lymphoma 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Antibodies and western blotting

Anti-Notch2 (5732s), anti-Dll1 (2588s), anti-hes family bHLH transcription factor 1 (Hes1; 11988s), and anti-GAPDH antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). GATA binding protein 4 (GATA4; BS1747), myocyte enhancer factor 2C (Mef2c; BS6401), and cardiac troponin T (cTnT/TNNT2; BS6013) were purchased from Bioworld Technology Inc. (St. Louis Park, MN, USA). The antibodies used were all specific monoclonal antibodies. GAPDH was used as the internal reference. Lysis buffer [1% Triton X-100, 50 mmol/l Tris-HCl, 0.2% sodium dodecyl sulfate, 0.2% sodium deoxycholate, 1 mmol/l EDTA (pH 7.4)] was directly added to the cultured cells, which were subsequently transferred into tubes and vortexed briefly. The supernatant was collected after centrifugation at 15,200 × g for 15 min at 4°C. Protein concentrations were detected using a Bicinchoninic Acid Protein assay kit (Beyotime Institute of Biotechnology).

Luciferase reporter gene assay

The 3′ untranslated region (3′UTR) sequences of the Notch2 gene containing the predicted miR-375 binding site or a mutant seed sequence were termed W.T.Notch2–3′UTR and M.T.Notch2–3′UTR, respectively. In the luciferase assays, P19 cells cultured in 96-well plates were transiently transfected with either the W.T.Notch2–3′UTR or M.T.Notch2–3′UTR vector, along with the miR-375 overexpression plasmid using Lipofectamine 2000, according to the manufacturer's protocol. A Dual-Luciferase Reporter assay system (Promega) was used to analyze the luciferase activity after 48-h transfection.

Statistical analysis

Each experiment was performed at least three times. All the results are presented as the mean ± standard deviation. Data were analyzed using t- or t′-test with correction for multiple comparisons as appropriate. P<0.05 was considered to indicate a statistically significant difference.

Results

miR-375 expression in P19 cells

Plasmids overexpressing miR-375 and the negative vectors were transfected into P19 cells that were 70–80% confluent. Transfection efficiency was observed after 24 and 48 h via the expression of GFP under a fluorescence microscope (Fig. 1A). miR-375 expression in the two groups was confirmed by RT-qPCR (P<0.01) (Fig. 1B). At day 7 during differentiation, spontaneous contraction of the myocardium-like cell clusters was observed occasionally. Cluster contraction increased over the subsequent days, and peaked at around day 12 (data not shown).

Figure 1

miR-375 expression in P19 cells. (A) Fluorescence microscopy images of transfection efficiency of the miR-375 overexpression vector and control vector in P19 cells determined via green fluorescence protein expression. (B) Reverse transcription-quantitative polymerase chain reaction verification of miR-375 expression. Data were normalized to the level of U6 RNA in each sample. Data are the mean ± standard deviation of three experiments, **P<0.01.

miR-375 overexpression inhibits cell proliferation

The proliferation rate of P19 cells overexpressing miR-375 was evaluated using the CCK-8 assay. Compared with the control group, continuous 72-h monitoring determined that proliferation was reduced in the miR-375 overexpression group (P<0.05 and P<0.01) (Fig. 2A). miR-375 also influenced the cell cycle: Flow cytometry revealed a decreased percentage of S phase cells in the miR-375 overexpression group in contrast to the control group (P<0.05) (Fig. 2B).

Figure 2

miR-375 overexpression inhibits cell proliferation. (A) Cell proliferation was continuously monitored for 72 h using the cell counting kit-8 (CCK-8). (B) Flow cytometry assessment of differential cell cycle stages. CCK-8 and flow cytometry showed that miR-375 overexpression inhibited P19 cell proliferation. Data are the mean ± standard deviation of three experiments, *P<0.05 and **P<0.01.

miR-375 overexpression promotes apoptosis

Hoechst staining is a classic, quick and easy method for distinguishing apoptotic cells from normal cells. As the chromatin condenses during apoptosis, Hoechst staining would have rendered it clearly visible in the nuclei of cells overexpressing miR-375, where it was visible as condensed, brighter spots under fluorescence microscopy, whereas normal cells appeared more homogenously stained (Fig. 3A). By contrast, flow cytometry assessment of apoptosis revealed higher apoptotic rates in cells overexpressing miR-375 compared to the controls (P<0.01; UL, upper left; UR, upper right; LL, lower left; LR, lower right. The apoptotic rate was calculated by UR+LR (Fig. 3B-a). In addition, RT-qPCR detected the apoptosis-related genes Bax and B-cell chronic lymphocytic leukemia/lymphoma 2 (Bcl-2) following 24-h culture in serum-free α-MEM for inducing apoptosis. By calculating the Bax/Bcl-2 ratio, the apoptosis rate was observed to be increased following miR-375 overexpression; the Bax and Bcl-2 protein levels were consistent with their mRNA expression levels (P<0.01) (Fig. 3C).

Figure 3

miR-375 overexpression promotes apoptosis. (A) The effect of miR-375 on cellular morphology was detected using Hoechst staining under fluorescence microscopy (magnification, ×200). (B) (a) Cells were cultured in serum-free of Minimum Essential Medium α-modification for 24 h to induce apoptosis. Apoptosis was assayed by binding of Annexin V-allophycocyanine (AV-APC). Flow cytometry was used to assess the apoptotic rate. (B) (b) Representative data from three independent experiments are shown. (C) Effects of miR-375 on Bax and Bcl-2 protein and mRNA expression levels in P19 cells. The Bax/Bcl-2 ratio represents the apoptotic rate. Data are normalized to U6 and presented as the mean ± standard deviation of three experiments, *P<0.05 and **P<0.01.

Effect of miR-375 on P19 cell differentiation

The process by which P19 cells were induced into cardiomyocytes was observed using an inverted microscope. P19 cells underwent a series of morphological changes (Fig. 4A). At day 4, the generated cell bodies in the control group were larger and rounder than those in the miR-375 overexpression group. Similarly, at day 10, the condition of cells in the control group was improved compared to that in the miR-375 overexpression group. At days 0, 4, 6 and 10 of differentiation, the differential mRNA expression of the myocardial-specific marker genes cTnT, GATA4 and MEF2C was determined using RT-qPCR. The corresponding mRNA levels were barely detectable in the undifferentiated P19 cells, but their expression was rapidly upregulated following DMSO induction. However, there was a negative effect on P19 cell differentiation into cardiomyocytes in the miR-375 overexpression group compared to the control group (P<0.05 and P<0.01) (Fig. 4B). The relative protein levels detected by western blotting verified the trend (P<0.05 and P<0.01) (Fig. 4C and D).

Figure 4

Effect of miR-375 on P19 cell differentiation. (A) P19 cell differentiation induced by 1% dimethyl sulfoxide. Micrographs show the morphological characteristics at days (d) 0, 4, 6 and 10 (magnification, x100). (B) Reverse transcription-quantitative polymerase chain reaction analysis of relative cardiac troponin T (cTnT), GATA binding protein 4 (GATA4) and myocyte enhancer factor 2C (MEF2C) mRNA expression during differentiation. There were clear differences in the expression levels of these marker genes between the miR-375 overexpression and control groups. Data are normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and presented as the mean ± standard deviation (SD) of three experiments, **P<0.01. (C) Western blotting detection of the protein levels of the marker genes during differentiation. (D) Relative protein expression levels. Data are normalized to GAPDH and presented as the mean ± SD of three experiments, *P<0.05 and **P<0.01.

Effect of miR-375 on the Notch signaling pathway

As NOTCH2 was a predicted downstream target gene of miR-375, further verification and discussion was necessary. The 3′UTR of NOTCH2 was confirmed as a target of miR-375. As expected, miR-375 inhibited the luciferase activity of the W.T.Notch2–3′UTR reporter efficiently, but not that of the M.T.Notch2–3′UTR (P<0.01) (Fig. 5A). The mRNA expression levels of the pivotal Notch signaling pathway regulators NOTCH2, DLL1 and HES1 were detected by RT-qPCR, and were significantly decreased in the miR-375 overexpression group at the examined time-points compared to that of the control group (P<0.05 and P<0.01) (Fig. 5B). The associated protein levels were detected using western blotting (Fig. 5C) and their relative levels were calculated (P<0.05 and P<0.01) (Fig. 5D). All data indicated an inhibitory effect of miR-375 on the Notch signaling pathway.

Figure 5

Effect of miR-375 on the Notch signaling pathway. (A) Luciferase reporter gene assay verification of the bioinformatics analysis-predicted NOTCH2 as a target gene of miR-375, **P<0.01. (B) NOTCH2, Delta-like 1 (DLL1) and hes family bHLH transcription factor 1 (HES1) mRNA expression levels detected by reverse transcription-quantitative polymerase chain reaction and normalized to GAPDH. Data are the mean ± standard deviation (SD) of three experiments, *P<0.05 and **P<0.01. (C) Western blotting demonstrating the inhibitory effect of miR-375 on the Notch signaling pathway. (D) Relative protein expression levels. Data are the mean ± SD of three experiments, *P<0.05 and **P<0.01.

Discussion

The present study observed that miR-375 promoted apoptosis and inhibited cell proliferation and differentiation. Notch2 was also confirmed as a target gene of miR-375, and miR-375 overexpression significantly influenced other vital members of the Notch signaling pathway. As miR-375 has been identified from the ventricular septal myocardial tissues from fetuses with ventricular septal defects, the present findings may shed light on novel therapeutic methods for CHD.

As the number of adults who have survived CHD is gradually increasing, CHD is currently becoming a significant health issue worldwide. Despite various treatments, the high incidence and serious resultant complications render CHD one of the leading causes of morbidity and mortality (23,24). Therefore, determining its pathogenesis and devising useful therapies is urgent. In recent years, it was determined that miRNAs are responsible for CHD (25), providing insight into how they may be exploited to understand and study the mechanism of this disease, as well as identifying them as promising candidates for potential novel treatment strategies.

miR-375 regulates insulin secretion, pancreatic islet development and alveolar epithelial cell transdifferentiation (26–28). Our previous study determined that miR-375 is abundantly expressed in the developing heart with consistent fold changes (29). In addition, miR-375 is significantly upregulated in maternal serum at 18–22 weeks of gestation with fetal CHD (15). These results demonstrate that miR-375 is associated with heart development and is involved in the occurrence of CHD. However, the specific mechanism remains unknown.

The present results show that miR-375 overexpression promotes apoptosis and inhibits cell proliferation and differentiation. The CCK-8 assay and decreased percentage of S phase cells confirmed the negative effect of miR-375 on cell proliferation. Simultaneously, Hoechst staining illustrating clear morphological diversity accompanied by flow cytometry was used to assess the apoptosis rate, and indicated the promoting effect of miR-375 on apoptosis. In contrast to necrocytosis, apoptosis is a process that involves cellular gene expression. Subsequently, the apoptosis-related genes BAX and BCL-2 were examined, and the Bax/Bcl-2 ratio in the miR-375 overexpression group was increased, which did not contradict our previous findings. Bax and Bcl-2 are members of the Bcl-2 family, which is a pivotal regulator of apoptosis (30). The Bcl-2 family contains pro-apoptotic (Bax, Bak, Bad and Bcl-xS) and anti-apoptotic (Bcl-2 and Bcl-xL) members. It is believed that the BCL-2 gene product inhibits cell death and contributes to the prolongation of cell survival, while Bax, an important homologue of Bcl-2, is a promoter of apoptosis (31,32). Evidently, the Bax/Bcl-2 ratio has a decisive role in cell fate. As aforementioned, the increased Bax/Bcl-2 ratio and relative protein levels in the present study demonstrate that miR-375 overexpression promotes apoptosis. Cell proliferation and apoptosis are basic features of living organisms; homeostasis of the two is an important biological activity for maintaining structural stability and environmental functional balance in multicellular organisms. Therefore, the inhibition of proliferation and promotion of apoptosis in miR-375 overexpression P19 cells shows that miR-375 influences P19 cell differentiation into cardiomyocytes and has a critical role during this process.

In addition, the effects of miR-375 were examined on P19 cell differentiation into cardiomyocytes. Murine P19 embryonal carcinoma cells, which can be induced by DMSO to differentiate into spontaneously beating cardiomyocytes in vitro (33,34), are the classic model for investigating heart development and are a valuable means of studying cardiomyocyte differentiation. Over the years, several influencing factors associated with cardiac disease have been explored (35–37), which is an essential part of the present study. The RT-qPCR and western blotting data also demonstrate the reliability of this cell model. The relative expression levels of cTnT, GATA4 and Mef2c mRNA and protein exhibited an increase during differentiation.

Evolutionarily, the embryonic heart undergoes a series of complicated morphogenetic and differentiation processes prior to forming the mature cardiac structures during development. Notably, these processes are controlled by a conserved network of genes and signaling pathways (38–40), including the Notch signaling pathway. During mammalian cardiogenesis, Notch signaling is involved in the development of the aortic valve, ventricles, atrioventricular canal and outflow tract (41). Mutations in the Notch signaling components affect heart development and are eventually involved in several types of CHD (42). Jagged1 and Notch2 are involved in Alagille syndrome, an autosomal dominant genetic disorder that results in pulmonary artery stenosis and tetralogy of Fallot (43,44). Notch1 is associated with aortic valve disease (45). Notably Notch signaling facilitates repair following myocardial injury by promoting myocardial regeneration, protecting the myocardium from ischemia, inducing angiogenesis, and inhibiting the transformation of cardiac fibroblasts to myofibroblasts (46). The present study used luciferase reporter gene assays to verify the downstream target genes predicted by bioinformatics analysis, and identified that miR-375 combined with the 3′UTR of NOTCH2, a key gene in the Notch signaling pathway. Furthermore, NOTCH2, DLL1 and HES1 mRNA levels were increased significantly during P19 cell differentiation in the control group, whereas this was not the case in the miR-375 overexpression group; the same trend was observed for the associated protein levels. The present study demonstrates that the Notch signaling pathway is involved in P19 cell differentiation and that miR-375 overexpression leads to abnormal expression of downstream Notch signaling pathway genes.

In conclusion, miR-375 overexpression promotes cell apoptosis and inhibits proliferation and differentiation through the Notch signaling pathway, which may provide potential targets for therapeutic intervention in CHD.

Acknowledgments

The present study was supported by grants from the Jiangsu Province Natural Science Foundation of China (no. BK20130076) and the Natural Science Foundation of China (no. 81501262).

References

1 

Hoffman JI and Kaplan S: The incidence of congenital heart disease. J Am Coll Cardiol. 39:1890–1900. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Srivastava D: Making or breaking the heart: From lineage determination to morphogenesis. Cell. 126:1037–1048. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Somerville J: Grown-up congenital heart disease - medical demands look back, look forward 2000. Thorac Cardiovasc Surg. 49:21–26. 2001. View Article : Google Scholar : PubMed/NCBI

4 

van der Linde D, Konings EE, Slager MA, Witsenburg M, Helbing WA, Takkenberg JJ and Roos-Hesselink JW: Birth prevalence of congenital heart disease worldwide: A systematic review and meta-analysis. J Am Coll Cardiol. 58:2241–2247. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Garside VC, Chang AC, Karsan A and Hoodless PA: Co-ordinating Notch, BMP, and TGF-β signaling during heart valve development. Cell Mol Life Sci. 70:2899–2917. 2013. View Article : Google Scholar

6 

High FA and Epstein JA: The multifaceted role of Notch in cardiac development and disease. Nat Rev Genet. 9:49–61. 2008. View Article : Google Scholar

7 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Yates LA, Norbury CJ and Gilbert RJ: The long and short of microRNA. Cell. 153:516–519. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Gangaraju VK and Lin H: MicroRNAs: Key regulators of stem cells. Nat Rev Mol Cell Biol. 10:116–125. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Ambros V: The functions of animal microRNAs. Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Feng Y and Yu X: Cardinal roles of miRNA in cardiac development and disease. Sci China Life Sci. 54:1113–1120. 2011. View Article : Google Scholar

12 

Thum T, Catalucci D and Bauersachs J: MicroRNAs: Novel regulators in cardiac development and disease. Cardiovasc Res. 79:562–570. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Kasinski AL and Slack FJ: Epigenetics and genetics MicroRNAs en route to the clinic: Progress in validating and targeting microRNAs for cancer therapy. Nat Rev Cancer. 11:849–864. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Callegari E, Gramantieri L, Domenicali M, D'Abundo L, Sabbioni S and Negrini M: MicroRNAs in liver cancer: A model for investigating pathogenesis and novel therapeutic approaches. Cell Death Differ. 22:46–57. 2015. View Article : Google Scholar

15 

Zhu S, Cao L, Zhu J, Kong L, Jin J, Qian L, Zhu C, Hu X, Li M and Guo X: et al Identification of maternal serum microRNAs as novel non-invasive biomarkers for prenatal detection of fetal congenital heart defects. Clin Chim Acta. 424:66–72. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Yu Z, Han S, Hu P, Zhu C, Wang X, Qian L and Guo X: Potential role of maternal serum microRNAs as a biomarker for fetal congenital heart defects. Med Hypotheses. 76:424–426. 2011. View Article : Google Scholar

17 

Andersson ER, Sandberg R and Lendahl U: Notch signaling: Simplicity in design, versatility in function. Development. 138:3593–3612. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Kopan R and Ilagan MXG: The canonical Notch signaling pathway: Unfolding the activation mechanism. Cell. 137:216–233. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Iso T, Kedes L and Hamamori Y: HES and HERP families: Multiple effectors of the Notch signaling pathway. J Cell Physiol. 194:237–255. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Chang ACY, Fu Y, Garside VC, Niessen K, Chang L, Fuller M, Setiadi A, Smrz J, Kyle A and Minchinton A: et al Notch initiates the endothelial-to-mesenchymal transition in the atrioventricular canal through autocrine activation of soluble guanylyl cyclase. Dev Cell. 21:288–300. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Chau MDL, Tuft R, Fogarty K and Bao ZZ: Notch signaling plays a key role in cardiac cell differentiation. Mech Dev. 123:626–640. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Bishayee K, Ghosh S, Mukherjee A, Sadhukhan R, Mondal J and Khuda-Bukhsh AR: Quercetin induces cytochrome-c release and ROS accumulation to promote apoptosis and arrest the cell cycle in G2/M, in cervical carcinoma: Signal cascade and drug-DNA interaction. Cell Prolif. 46:153–163. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Verheugt CL, Uiterwaal CS, Grobbee DE and Mulder BJ: Long-term prognosis of congenital heart defects: A systematic review. Int J Cardiol. 131:25–32. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Zomer AC, Vaartjes I, van der Velde ET, de Jong HM, Konings TC, Wagenaar LJ, Heesen WF, Eerens F, Baur LH and Grobbee DE: et al Heart failure admissions in adults with congenital heart disease; risk factors and prognosis. Int J Cardiol. 168:2487–2493. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Sayed AS, Xia K, Salma U, Yang T and Peng J: Diagnosis, prognosis and therapeutic role of circulating miRNAs in cardiovascular diseases. Heart Lung Circ. 23:503–510. 2014. View Article : Google Scholar : PubMed/NCBI

26 

El Ouaamari A, Baroukh N, Martens GA, Lebrun P, Pipeleers D and van Obberghen E: miR-375 targets 3′-phosphoinositide-dependent protein kinase-1 and regulates glucose-induced biological responses in pancreatic beta-cells. Diabetes. 57:2708–2717. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Kloosterman WP, Lagendijk AK, Ketting RF, Moulton JD and Plasterk RH: Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development. PLoS Biol. 5:e2032007. View Article : Google Scholar : PubMed/NCBI

28 

Zhang H, Mishra A, Chintagari NR, Gou D and Liu L: Micro-RNA-375 inhibits lung surfactant secretion by altering cytoskeleton reorganization. IUBMB Life. 62:78–83. 2010.

29 

Cao L, Kong LP, Yu ZB, Han SP, Bai YF, Zhu J, Hu X, Zhu C, Zhu S and Guo XR: microRNA expression profiling of the developing mouse heart. Int J Mol Med. 30:1095–1104. 2012.PubMed/NCBI

30 

Adams JM and Cory S: The Bcl-2 protein family: Arbiters of cell survival. Science. 281:1322–1326. 1998. View Article : Google Scholar : PubMed/NCBI

31 

Golestani Eimani B, Sanati MH, Houshmand M, Ataei M, Akbarian F and Shakhssalim N: Expression and prognostic significance of bcl-2 and bax in the progression and clinical outcome of transitional bladder cell carcinoma. Cell J. 15:356–363. 2014.PubMed/NCBI

32 

Oltvai ZN, Milliman CL and Korsmeyer SJ: Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell. 74:609–619. 1993. View Article : Google Scholar : PubMed/NCBI

33 

van der Heyden MA and Defize LH: Twenty one years of P19 cells: What an embryonal carcinoma cell line taught us about cardiomyocyte differentiation. Cardiovasc Res. 58:292–302. 2003. View Article : Google Scholar : PubMed/NCBI

34 

van der Heyden MA, van Kempen MJ, Tsuji Y, Rook MB, Jongsma HJ and Opthof T: P19 embryonal carcinoma cells: A suitable model system for cardiac electrophysiological differentiation at the molecular and functional level. Cardiovasc Res. 58:410–422. 2003. View Article : Google Scholar : PubMed/NCBI

35 

Qin DN, Qian L, Hu DL, Yu ZB, Han SP, Zhu C, Wang X and Hu X: Effects of miR-19b overexpression on proliferation, differentiation, apoptosis and Wnt/β-catenin signaling pathway in P19 cell model of cardiac differentiation in vitro. Cell Biochem Biophys. 66:709–722. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Zhu C, Hu DL, Liu YQ, Zhang QJ, Chen FK, Kong XQ, Cao KJ, Zhang JS and Qian LM: Fabp3 inhibits proliferation and promotes apoptosis of embryonic myocardial cells. Cell Biochem Biophys. 60:259–266. 2011. View Article : Google Scholar : PubMed/NCBI

37 

Zhu S, Hu X, Han S, Yu Z, Peng Y, Zhu J, Liu X, Qian L, Zhu C and Li M: et al Differential expression profile of long non-coding RNAs during differentiation of cardiomyocytes. Int J Med Sci. 11:500–507. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Yuan S, Zaidi S and Brueckner M: Congenital heart disease: Emerging themes linking genetics and development. Curr Opin Genet Dev. 23:352–359. 2013. View Article : Google Scholar : PubMed/NCBI

39 

Staudt D and Stainier D: Uncovering the molecular and cellular mechanisms of heart development using the zebrafish. Annu Rev Genet. 46:397–418. 2012. View Article : Google Scholar : PubMed/NCBI

40 

Olson EN: Gene regulatory networks in the evolution and development of the heart. Science. 313:1922–1927. 2006. View Article : Google Scholar : PubMed/NCBI

41 

Penton AL, Leonard LD and Spinner NB: Notch signaling in human development and disease. Semin Cell Dev Biol. 23:450–457. 2012. View Article : Google Scholar : PubMed/NCBI

42 

de la Pompa JL: Notch signaling in cardiac development and disease. Pediatr Cardiol. 30:643–650. 2009. View Article : Google Scholar : PubMed/NCBI

43 

McDaniell R, Warthen DM, Sanchez-Lara PA, Pai A, Krantz ID, Piccoli DA and Spinner NB: NOTCH2 mutations cause Alagille syndrome, a heterogeneous disorder of the notch signaling pathway. Am J Hum Genet. 79:169–173. 2006. View Article : Google Scholar : PubMed/NCBI

44 

Kamath BM, Spinner NB, Emerick KM, Chudley AE, Booth C, Piccoli DA and Krantz ID: Vascular anomalies in Alagille syndrome: A significant cause of morbidity and mortality. Circulation. 109:1354–1358. 2004. View Article : Google Scholar : PubMed/NCBI

45 

Garg V, Muth AN, Ransom JF, Schluterman MK, Barnes R, King IN, Grossfeld PD and Srivastava D: Mutations in NOTCH1 cause aortic valve disease. Nature. 437:270–274. 2005. View Article : Google Scholar : PubMed/NCBI

46 

Zhou XL and Liu JC: Role of Notch signaling in the mammalian heart. Braz J Med Biol Res. 47:1–10. 2014. View Article : Google Scholar :

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang L, Song G, Liu M, Chen B, Chen Y, Shen Y, Zhu J and Zhou X: MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway. Int J Mol Med 37: 47-55, 2016.
APA
Wang, L., Song, G., Liu, M., Chen, B., Chen, Y., Shen, Y. ... Zhou, X. (2016). MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway. International Journal of Molecular Medicine, 37, 47-55. https://doi.org/10.3892/ijmm.2015.2399
MLA
Wang, L., Song, G., Liu, M., Chen, B., Chen, Y., Shen, Y., Zhu, J., Zhou, X."MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway". International Journal of Molecular Medicine 37.1 (2016): 47-55.
Chicago
Wang, L., Song, G., Liu, M., Chen, B., Chen, Y., Shen, Y., Zhu, J., Zhou, X."MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway". International Journal of Molecular Medicine 37, no. 1 (2016): 47-55. https://doi.org/10.3892/ijmm.2015.2399
Copy and paste a formatted citation
x
Spandidos Publications style
Wang L, Song G, Liu M, Chen B, Chen Y, Shen Y, Zhu J and Zhou X: MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway. Int J Mol Med 37: 47-55, 2016.
APA
Wang, L., Song, G., Liu, M., Chen, B., Chen, Y., Shen, Y. ... Zhou, X. (2016). MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway. International Journal of Molecular Medicine, 37, 47-55. https://doi.org/10.3892/ijmm.2015.2399
MLA
Wang, L., Song, G., Liu, M., Chen, B., Chen, Y., Shen, Y., Zhu, J., Zhou, X."MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway". International Journal of Molecular Medicine 37.1 (2016): 47-55.
Chicago
Wang, L., Song, G., Liu, M., Chen, B., Chen, Y., Shen, Y., Zhu, J., Zhou, X."MicroRNA-375 overexpression influences P19 cell proliferation, apoptosis and differentiation through the Notch signaling pathway". International Journal of Molecular Medicine 37, no. 1 (2016): 47-55. https://doi.org/10.3892/ijmm.2015.2399
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team