This article is mentioned in:

Introduction

Breast cancer has a high rate of morbidity and mortality, which seriously threaten the health of women (1). To date, chemotherapy has been the most frequently used method for treating breast cancer and other cancers. Drug treatment has significantly prolonged survival time of breast cancer patients, and improved their prognosis. Of the limited number of clinically active anticancer chemotherapeutic compounds, alkylating agents are invaluable drugs which are electrophilic and trigger cell death by covalently binding to cellular nucleophiles such as DNA and proteins. Hundreds of alkylating compounds have been tested for anticancer activity. Despite their frequent use, the therapeutic efficacy of these agents is limited by the development of resistance.

Mitomycin c (MMC), isolated from streptomyces caespitosus, is an alkylating agent that results in damaged DNA cross-links and inhibition of the DNA replication apparatus, leading to cytotoxicity and cell death (2). The therapeutic value of MMC depends on the capability of the cells to repair DNA damage (3). A new and emerging concept designed to sensitize cancer cells to DNA-damaging agents (i.e., chemotherapy and/or radiation) is inhibition of various proteins in the DNA repair pathways. We are focusing on inhibition and manipulation of the Fanconi anemia/breast cancer susceptibility gene (FA/BRCA) pathway in breast cancer.

Fanconi anemia (FA) is an inherited chromosomal instability disorder manifesting a variety of congenital malformations, pancytopenia, and a predisposition to cancer (4). FA protein is a multifunctional protein composed of 15 FA complementation groups (FANC A–C, D1, D2, E, F, G, I, J, L, M, N, O and P) (5), and is involved in cell cycle, DNA damage and repair, apoptosis, gene transcription, and gene stability through common FA/BRCA cellular pathways (6). Following exposure to DNA-damaging agents or during the DNA synthesis (S) phase of the cell cycle, eight of the FA proteins (A, B, C, E, F, G, L and M) assemble into multisubunit nuclear complex that activates the monoubiquitination of the downstream FANCD2 (D2) protein at lysine 561. Monoubiquitination of the D2 protein targets its translocation to BRCA1-, FANCD1/BRCA2- and RAD51-containing nuclear DNA repair foci (7,8). Furthermore, this pathway has been shown to play an important role in the acquisition of drug resistance (9–11). Disruption of the FA/BRCA pathway results in chromosome instability and hypersensitivity to DNA alkylating agents such as MMC (12,13).

In particular, the FA complex plays a critical role in cell response to chemotherapy-induced DNA damage. As an adaptor protein, FANCF interacts with the FANCC/FANCE subunit through its N-terminal, and with the FANCA/FANCG subunit through its C-terminal. Thus, the FANCF subunit functions as the stabilizing component of the larger FA complex and maintains the biological functions of the FA/BRCA pathway (14). FANCF inhibition mediated by gene promoter methylation and small interfering (si) RNAs, which can promote drug sensitivity of tumor cells, such as ovarian cancer (15), multiple myeloma (9), cervical cancer (16) and glioma (10). More recently, we reported that gene silencing of FANCF induced dysfunction of FA/BRCA pathway and potentiated the sensitivity to mitoxantrone and MMC in breast cancer cells (17,18). However, despite major advances in the understanding of the biochemistry of FA/BRCA pathway, little is known about the mechanisms through which pathway lead to the increased sensitivity of alkylating agents including MMC when FA/BRCA pathway was disrupted. Recent studies have shown that MMC induces apoptosis by both activating caspase-3 and decreasing bcl-2 level (19,20). On the other hand, we have previously shown that disruption of FA/BRCA pathway mediated by FANCF-silencing induced apoptosis via the activation of the mitochondrial apoptosis pathway in breast cancer cells (17). Therefore, we hypothesize that apoptosis-related proteins might play a crucial role in FANCF-sensitizing the MMC in breast cancer cells.

In this context, we investigated the effect of FA/BRCA pathway dysfunction mediated by FANCF inhibition on MMC sensitivity and its underlying mechanisms. In this report, we demonstrate that specific short hairpin RNA (shRNA) decreases the levels of FANCF, mediates FA/ BRCA pathway dysfunction, and potentiates the sensitivity of breast cancer to the alkylating agent MMC. This may be due to the p53-dependent mitochondria-regulated intrinsic death-signaling pathway. We also demonstrated that FANCF inhibition enhanced chemotherapeutic-induced apoptosis in human breast cancer cells through JNK MAPK signaling pathway. To our knowledge, our results add new evidence for the potential application of FANCF as a chemosensitizer in breast cancer therapy.

Materials and methods

Cell culture

Estrogen receptor α (ERα)-positive human breast cancer cell lines MCF-7 and ERα-negative MDA-MB-231 cells were obtained from the American Type Culture Collection (ATCC). Adherent cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum, 100 U/ml penicillin, and 100 mg/ml streptomycin in a humidified atmosphere with 5% CO2 at 37°C

Antibodies and reagents

Antibodies against p53, phospho-p53, Bcl-2, Bax, survivin, X-linked inhibitor of apoptosis protein (XIAP), cytochrome c (cyt-c), second mitochondria-derived activator of caspases (smac) and β-actin were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies against FANCF, FANCD2, cleaved-caspase-6, cleaved-caspase-8, cleaved-caspase-9, poly(ADP ribose) polymerase (PARP) were from Abcam Inc. (Cambridge, MA, USA). MMC and p53 inhibitor pifithrin-α was purchased from Sigma Chemical Co. (St. Louis, MO, USA).

Construction of the FANCF shRNA expression vector

The FANCF shRNA expression vector was used to achieve specific downregulation of FANCF, as previously described (17). The sequences of the oligonucleotides to construct FANCF shRNA expressing vector was designed as follows: sense, 5′GATCCGCTTCCTGAAGGTGATAGCGTTCAAGAGAC GCTATCACCTTCAGGAAGTTTTTTGGAAA-3′ and anti-sense, 5′-AGCTTTTCCAAAAAACTTCCTGAAGGTGAT AGCGTCTCTTGAACGCTATCACCTTCAGGAAGCG-3′. A scrambled shRNA with no significant homology to human gene sequences was used as a negative control to detect non-specific effects.

FANCF shRNA transfection

Cells were seeded into 6-well plates (3×105 cells/well) or 100-mm dishes (2×106 cells) and were allowed to adhere for 24 h, and after 24 h, cells were transfected with the pSilencer™ 4.1-CMV Control shRNA vector (control shRNA) or pSilencer 4.1-CMV FANCF shRNA vector (FANCF shRNA) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After 4 h, the culture medium was replaced with fresh media supplemented with 10% FBS, and the cells were harvested at 24 and 48 h after transfection.

Western blot analysis

Western blot analysis for the presence of specific proteins or for phosphorylated forms of proteins was performed on whole-cell sonicates and lysates from MCF-7 and MDA-MB-231 cells. Protein (30–50 μg) was mixed 4:1 with 5X sample buffer (20% glycerol, 4% sodium dodecyl sulfate, 10% β-mercaptoethanol, 0.05% bromophenol blue and 1.25 M Tris-HCl, pH 6.8; all from Sigma). Equal amount of proteins was loaded onto a 10% sodium dodecyl sulfatepolyacrylamide gel. Cell proteins were transferred to PVDF membranes. The PVDF membranes were then blocked with 5% milk in Tris-buffered saline with 0.1% Tween-20 and then incubated with an appropriate dilution of antibodies (1:1,000 to 1:2,000) overnight at 4°C. The blots were washed and incubated for 1 h with horseradish peroxidase-conjugated anti-IgG antibody (Santa Cruz). Immunocomplexes were visualized by chemiluminescence using ECL (Santa Cruz).

Cell viability assay

The cell viability was assessed using Cell count kit-8 (Dojindo Molecular Technologies, Inc., Gaithersburg, MD, USA). Cells were seeded at 5×103 cells/well in 96-well plates and allowed to grow in the growth medium for 24 h. Cells were transfected with control or FANCF shRNA for 48 h, and then treated with MMC at different concentration (0. l, 0.3, 1, 3, 10, 30 and 100 μM of MMC, respectively) for 24 h. CCK-8 solution (10 μl) was added to 100 μl of media in each well and absorbance was determined at 450 nm after 1 h of incubation at 37°C.

Flow cytometry

Flow cytometry analysis was performed on a FACSCalibur (Becton-Dickinson). For determination of the cell cycle by exclusion of propidium iodide (PI), 500 μl of cell culture were incubated with 30 μg/ml PI for 1 h at room temperature prior to analysis. The cationic fluorescent carbocyanine dye, 5, 5’, 6, 6’-tetrachloro-1,1’,3,3’-tetraethylbenzimidazolyl carbocyanine iodide (JC-1) was used to assess changes in the mitochondrial membrane potential (ΔΨm) observed in apoptotic cells. Cells were incubated for 15 min at 37°C with 15 μg/ml JC-1 before analysis. For determination of apoptotic cells, cells were harvested, washed twice with phosphate-buffered saline (PBS), then incubated for 15 min at room temperature with a solution of fluorescence isothiocyanate (FITC) conjugated Annexin V (2.5 μg/ml) and PI (5 μg/ml) (all from Sigma), and analyzed for apoptosis.

Statistical analysis

Data are presented as the mean ± SD. The data are representative of the averages of at least three independent experiments. Data were analyzed using the one-way ANOVA with post-hoc analysis. P<0.05 was considered statistically significant.

Results

FANCF suppression by shRNA sensitizes breast cancer cells to the alkylating agent MMC

Firstly, we examined the effects of the alkylating agent MMC on the growth of MCF-7 and MDA-MB-231 breast cancer cells. Cellular growth, as determined by MTT assays, MMC dose-dependently inhibited the survival of MCF-7 and MDA-MB-231 with the IC50 of 8.67 and 11.73 μM, respectively (Fig. 1A).

Figure 1. FANCF shRNA enhances MMC-induced cytoxicity in breast cancer cells. (A) MCF-7 and MDA-MB-231 cells were seeded in 96-well plates at an initial density of 5×103 cells/well for 24 h, after which they were cultured with different concentrations of MMC for an additional 48-h. Cell survival was determined using a CCK8 kit. (B) Cells were transfected with FANCF shRNA and control shRNA (scrambled shRNA) for 24 and 48 h, then protein was extracted for western blotting with anti-FANCF. β-actin was simultaneously immunodetected to verify equal loading of cell lysates. (C) Cells were transfected with FANCF shRNA for 48 h and then treated with various concentrations of MMC for 48 h. Each point on the graph represents the means ± SD.

To identify the effect of FANCF expression on MMC-mediated cell proliferation. ShRNA was used to knock down FANCF expression in MCF-7 and MDA-MB-231 breast cancer cells. To verify the results of gene silencing, FANCF expression was detected by western blotting at 24 and 48 h post-transfection. We found that expression of FANCF in the two cell lines (MCF-7 and MDA-MB-231) was inhibited in a time-dependent manner, as compared with the control (cells treated with scrambled shRNA). The results confirmed that FANCF expression was inhibited by transfection with shRNA targeting FANCF (Fig. 1B). Then, the antiproliferative actions of MMC were evaluated in FANCF-silenced MCF-7 and MDA-MB-231 cells. Co-treatment of FANCF shRNA with MMC caused a much greater decrease in viability than MMC alone, the IC50 of MMC in FANCF-silenced MCF-7 and MDA-MB-231 cells reduced to 1.21 and 2.29 μM, respectively (Fig. 1C). These results suggested that FANCF silencing potentiated the cytotoxic effects of MMC on breast cancer cells.

Silencing of FANCF potentiates MMC-induced cell apoptosis

To determine whether increased cytotoxity of MMC in FANCF-silenced cells involved apoptosis, the percentage of apoptotic cells was assessed by Annexin V-FITC and PI double staining, followed by flow cytometric analysis. Apoptosis was detected using flow cytometry in both MCF-7 and MDA-MB-231 cell lines. It was observed that MMC increased the percentage of cells undergoing apoptosis. After FANCF shRNA/MMC combination, a significant increase in the population of cells undergoing apoptosis was recorded compared to the MMC-treated cells (P<0.05) (Fig. 2). The results indicated that FANCF shRNA potentiated MMC-induced cytoxicity in MCF-7 and MDA-MB-231 breast cancer cells by inducing apoptosis.

Figure 2. The effect of FANCF knockdown on the MMC-induced apoptosis in breast cancer cells. (A) Apoptosis of cells were measured using FACScan after staining with FITC-Annexin V and PI. Cells in the lower right-hand quadrant are early apoptotic cells with exposed phosphatidylserine (FITCAnnexin V-positive) but intact membrane (PI-negative). (B) The quantification of apoptosis in the indicated cell lines. Data shown are means ± SD from three independent experiments. Differences were considered statically significant at #P<0.05 when compared with MMC treatment alone or MMC plus control shRNA.

The activation of caspase-3 and -9, but not caspase-8 following MMC treatment was substantially enhanced by FANCF shRNA. In order to study the mechanism of apoptosis involved in FANCF silencing-potentiated MMC sensitivity, we evaluated the effects of FANCF knockdown on several molecules involved in apoptosis in MMC-treated cells. In immunoblot experiments, MMC elicited caspase-3, -9 activation, and cleavage of PARP (a substrate of caspase-3), which were enhanced after FANCF silencing (Fig. 3). Although MCF-7 cells are deficient in caspase-3, they remain susceptible to cell death induced by several stimuli (21). Consistent with a report that other executive caspases, such as caspase-6 and -7, are able to substitute for caspase-3 during apoptosis, the co-treatment with MMC and FANCF shRNA elicited caspase-6 activation in MCF-7 cells. These findings suggest that FANCF shRNA decreases the viability of MMC-treated MCF-7 breast cancer cells by inducing apoptosis through a mechanism mediated by caspase-3, -6, and -9 and involving the intrinsic mitochondrial apoptosis pathway.

Figure 3. Effects of FANCF knockdown on the expression of caspase family proteins in MMC-treated breast cancer cells. (A) Whole lysates from cells treated as indicated in the figure were subjected to western blot analysis with the indicated antibodies recognizing cleaved products of cleaved caspase-3, -6, -9 and PARP. Representative figures of three independent experiments carried out in triplicate are shown. (B) Densitometric analysis was done for proteins expression. P-values, #P<0.05 versus untreated cells, *P<0.05 versus MMC-treated cells.

Mitochondrial release of cyt-c and smac with loss of mitochondrial membrane potential by MMC treatment are increased by FANCF shRNA

Mitochondrial dysfunction induced apoptosis which is often the consequence of a decrease of ΔΨm. To assess whether FANCF silencing affects the function of mitochondria, ΔΨm changes were measured by employing the mitochondrial fluorescent dye JC-1. As shown in Fig. 4A and B, FANCF silencing in MMC-treated MCF-7 and MDA-MB-231 cells resulted in a decrease of ΔΨm, compared to controls or MMC-treated alone.

Figure 4. Effects of FANCF shRNA on mitochondrial membrane potential and cytochrome c release in MMC-treated breast cancer cells. (A) The cells were stained with JC-1 fluorescence dye and the change in ΔΨm was examined by fluorescence microscopy. (B) Densitometric analysis was done for fraction of cells. (C) Cytosolic lysates were prepared and subjected to SDS-PAGE followed by western blotting with cyt-c and smac antibody. Results are representative of three separate experiments. β-actin is shown as protein loading control. (D) Densitometric analysis was done for cyt-c and smac expression. P-values, #P<0.05 versus untreated cells, *P<0.05 versus MMC-treated cells.

We investigated the changes in expression of downstream molecules that occurred after the ΔΨm decreased. We analyzed the release of the proapoptotic mitochondrial intermembrane space proteins cyt-c and smac. Cyt-c was not expressed in the cytoplasm of FANCF-silenced MCF-7 or MDA-MB-231 cells. MMC treatment led to cyt-c and smac release (Fig. 4C and D). Compared with MMC treatment alone, FANCF shRNA and MMC co-treatment increased cyt-c and smac expression of MCF-7 and MDA-MB-231 cells. These findings indicated that the amount of cyt-c and smac in cytoplasm increased as a result of mitochondrial release in FANCF-silenced cells treated with MMC.

The changes in BCL-2 family by MMC treatment are potentiated by FANCF shRNA

To further characterize the molecular mechanisms of the induction of apoptosis by FANCF knockdown, the expression of the pro-apoptotic protein (Bax) and the anti-apoptotic proteins (XIAP, Bcl-2, survivin) of the Bcl-2 family were detected in MCF-7 and MDA-MB-231 cells treated with FANCF shRNA and/or MMC. We found that MMC decreased the expression of XIAP, survivin and Bcl-2, increased Bax expression (Fig. 3A), whereas co-treatment of FANCF shRNA with MMC resulted in enhanced inhibition of XIAP, survivin and Bcl-2. Similarly, MMC in combination with FANCF shRNA induced significant increases in Bax expression when compared with MMC or FANCF shRNA treatment alone (Fig. 5).

Figure 5. Effects of FANCF knockdown on the expression of Bcl-2 family and IAP family proteins in MMC-treated breast cancer cells. (A) Whole lysates from cells treated as indicated in the figure were subjected to western blot analysis with the indicated antibodies recognizing cleaved products of Bcl-2, Bax, survivin and XIAP. Data shown are representative of three independent experiments. (B) Densitometric analysis was done for proteins expression. P-values, #P<0.05 versus untreated cells, *P<0.05 versus MMC-treated cells.

p53 is required for FANCF shRNA -induced apoptosis in MMC-treated breast cancer cells

p53 mediates apoptosis in cells suffering from serious DNA damage. Previously, it was reported that MMC causes an increase in the cellular p53 level (22,23). Therefore, we further examined the role of p53 in FANCF shRNA and MMC induced apoptosis. Based on western blotting, an increased expression of p53 protein was seen in MMC-treated cells, and these effects were enhanced by FANCF shRNA to a large extent (Fig. 6A and B). To further confirm the role of p53 in mediating FANCF shRNA-induced apoptosis, we used a p53 inhibitor (pifithrin-α) and tested whether it would prevent FANCF shRNA-induced apoptosis. As shown in Fig. 6C and D, pifithrin α prevents FANCF-shRNA induced activation of caspase-3 and PARP cleavage. These results indicate that p53 is required for FANCF shRNA-induced apoptosis in MMC-treated breast cancer cells.

Figure 6. FANCF silencing increases MMC-induced apoptosis via p53 activation in breast cancer cells. (A) Total and phosphorylation of p53 were detected after FANCF shRNA and MMC treatment by western blot analysis. (C) Cells were pre-treated with the p53 inhibitor pifithrin-α for 2 h and then treated with MMC alone or in combination scrambled or FANCF shRNA, followed by immunoblotting assay performed with antibodies specific for cleaved caspase-3 and PARP. β-actin was used to ensure equal protein loading. (B and D) Densitometric analysis was done for proteins expression. P-values, #P<0.05 versus untreated cells, *P<0.05 versus MMC-treated cells.

Inhibitor of JNK protects MMC-treated cells from FANCF shRNA-induced p53 activation in MMC-treated cells

It was shown that MAPK signaling is involved in several events of cellular stress and stimuli-induced cell apoptosis (24). Silencing of the FANCF can cause activation of the MAPK signaling pathway, as reported by us previously (17). Therefore, we examined changes in the expression of proteins association with the MAPK pathway, including JNK, ERK, and p38 in breast cancer cells following FANCF shRNA and MMC treatment. The phosphorylation levels of p38 and JNK were apparently increased in response to the FANCF shRNA and MMC treatment; however, no significant changes of phosphorylation levels of ERK were observed (Fig. 7A and B). These results suggested that sustained activation of the p38 and JNK is involved in FANCF shRNA-induced apoptosis in MCF-7 and MDA-MB-231 cells.

Figure 7. The responsibility of MAPK pathway activation for FANCF shRNA-induced p53 expression in MMC-treated cells. (A) MCF-7 and MDA-MB-231 cells were transfected with FANCF shRNA for 48 h and then treated with MMC for 24 h. Cells were harvested and lysed. Total and phosphorylated MAPK members (JNK, p38 and ERK) were analyzed by western blot assay. Results are representative of three separate experiments. β-actin is shown as protein loading control. (C) Cells were pre-incubated in absence or presence of 20 μM p38 inhibitor (SB203580) or 10 μM JNK inhibitor (SP6001258) for 2 h, then treated with FANCF shRNA for 48 h, followed by MMC for 24 h. Immunoblotting assay performed with antibodies specific to p53 and p-p53. (B and D) Densitometric analysis was done for different protein expression. P-values, #P<0.05 versus untreated cells, *P<0.05 versus MMC-treated cells.

It is clear that activation of the MAPK pathway can induce p53-mediated apoptosis (25). To further test whether activation of JNK and p38 pathways was involved in the FANCF silencing-induced activation of p53 expression, MCF-7 and MDA-MB-231 cells were treated with the p38 inhibitor, SB203580, and the JNK inhibitor, SP600125. After treatment with SB203580, FANCF shRNA had no detectable inhibitory effect on p53 expression. However, p53 expression was still activated by FANCF shRNA in SP600125 treated cells (Fig. 7C and D). These results demonstrated that FANCF gene silencing increased the expression of p53 through activation of JNK pathway.

All the above strongly suggest that mitochondrial apoptosis pathway participates in the FA pathway sensitizing to DNA alkylating agents in human breast carcinoma cells. We characterize the probable mechanisms of FANCF silencing on MMC-induced apoptosis in Fig. 8.

Figure 8. Schematic representation of FANCF-induced JNK-p53-dependent mitochondrial apoptosis in MMC-treated cells.

Discussion

The FA/BRCA pathway may display promising chemosensitive potential in cancers (26). Some tumor cells depend on this pathway for the maintenance of chromosome integrity and for their resistance to cytotoxic agents (9). Inhibition of the DNA repair pathway would confer enhanced drug sensitivity to tumor cells and may be useful in conjunction with more traditional cytotoxic treatment, such as alkylating agents (10). In spite of its emerging significance as a new target for preventing acquired drug resistance, the molecular mechanisms underlying the FA/BRCA pathway reversed resistance have received limited attention.

In this study, we therefore evaluated the mechanisms of RNAi-mediated FANCF (a critical factor of FA/BRCA pathway) gene silencing using the sensitizing DNA alkylating agent MMC cytoxicity in vitro in MCF-7 and MDA-MB-231 human breast cancer cells. The present study shows that RNAi suppression of FANCF sensitizes to the DNA alkylating agent by inducing JNK-p53-dependent mitochondrial apoptosis in breast cancer cells.

Reversing cancer cell resistance to apoptosis may be an effective way to suppress cancer malignancies (27). Our previous studies demonstrated that FANCF inhibition induced apoptosis of cancer cells such as ovarian (28) and breast cancer cells (17). In this study, we found that FANCF silencing potentiated the sensitivity of MMC, the combination treatment inhibited cell proliferation, increased apoptosis compared with MMC treatment alone (Figs. 1 and 2). Our results are in agreement with previous findings that FA cells are hypersensitive towards DNA crosslinking agents (29). Thus, the current results warrant further evaluation of the MMC and FANCF shRNA combination as a potential therapeutic regimen against human breast cancer.

The progression of apoptosis involves the activation of a cascade of proteases called caspases. Theoretically, the extrinsic pathway is related to the activation of caspase-8 and the intrinsic pathway is associated with activation of caspase-9. Both pathways converge to a common pathway involving the activation of caspase-3 (30). In the present study, caspase-3 and -9 is activated in FANCF-silenced MCF-7 and MDA-MB-231 cells treated with MMC, and subsequent cleavage of PARP, but caspase-8 expression is unaffected (Fig. 3). These findings demonstrate that the FANCF silencing-induced apoptosis in MMC-treated cells is mediated by the intrinsic mitochondrial pathway, rather than the extrinsic death receptor pathway. Therefore, enhanced MMC sensitivity in FANCF-silenced MCF-7 and MDA-MB-231 cells may partly be due to the regulation of the mitochondrial apoptosis pathway.

The ratio of anti- and pro-apoptotic protein expression, such as Bcl-2/Bax, is crucial for the induction of apoptosis, and it decides the susceptibility of cells to undergo apoptosis (31). Mitochondria play an important role in the signal transduction of apoptosis (32). The translocalization of apoptotic proteins from the cytosol to the mitochondria leads to the release of cyt-c and smac by a decrease in mitochondrial membrane potential (33). In the present study, we showed that FANCF silencing downregulated the expression of and Bcl-2 and upregulated the expression of Bax, and caused the loss of mitochondrial membrane potential and release of cyt-c and smac in MMC-treated MCF-7 and MDA-MB-231 cells (Fig. 4B), further confirmed that FANCF silencing-induced apoptosis with mitochondria-dependent apoptosis.

The inhibitor of apoptosis (IAP) family members survivin and XIAP are potent inhibitors of caspase-3 and -9 activity and have previously been shown to confer resistance to MMC (34). Our results showed that FANCF shRNA decreases the expression of XIAP and surviving (Fig. 5). The enhanced caspase-3 and -9 activation observed in cells treated with FANCF shRNA plus MMC could also be due to reduced levels of XIAP and survivin. Taken together, our results indicated that FANCF shRNA regulates expression levels of apoptosis-related proteins, causes cyt-c and smac release (Fig. 4B) and triggers caspase-dependent cell apoptotic death.

The tumor suppressor p53 has been implicated in many important cellular processes, including regulation of apoptotic cell death. p53 activates several important genes that are crucial for the execution of the intrinsic pathway of apoptosis including pro-apoptotic genes such as Bax (35), Noxa (36) and Puma (37). When p53-dependent apoptosis is employed in cells, these cells typically undergo the intrinsic cell death pathway. So, we studied the involvement of p53 in the apoptosis induced by FANCF knockdown. Our study found that FANCF shRNA activated p53 and that this activation is indispensable for FANCF shRNA-induced apoptosis (Fig. 6), indicating that FANCF shRNA induces apoptosis via a p53-dependent mechanism in MMC-treated cells. Consistent with these findings, Lui et al demonstrated that a defect in Fancd2 in developing zebrafish tissue induced inappropriate activation of p53-mediated programmed cell death (38), highlighting the relationship between p53 and the FA pathway.

p53 induction by MMC was reported previously by other groups (39). However, how MMC upregulates p53 has not been fully elucidated. MAPK regulates diverse cellular programs including embryogenesis, proliferation, differentiation and apoptosis (40). The MAPK family proteins are composed of three protein kinases: ERK1/2 (extracellular signal-regulated kinases 1 and 2), JNK (c-Jun N-terminal kinase) and p38. p53 is a downstream factor of the MAPK pathway, and can be activated by JNK (41). In our study, we found that MMC increases the levels of p-JNK and p-38. SP600125, a specific inhibitor of JNK, effectively blocked MMC-induced p53 in FANCF-silenced MCF-7 and MDA-MB-231 cells (Fig. 7), suggesting the pro-apoptotic effects of FANCF and in MCF-7 and MDA-MB-231 cells are mediated by the JNK-medicated upregulation of p53.

Collectively, our results provide the first mechanistic evidence that FANCF shRNA and MMC co-treatment results in JNK-mediated upregulation of p53, regulates expression levels of apoptosis-related proteins, causes cyt-c release and triggers caspase-dependent cell apoptotic death, thus rendering cancer cells more sensitive to the cytotoxic activities of MMC. In addition, our studies also show that the combined treatment with MMC and FANCF shRNA induces apoptosis in breast cancer cells. Thus, these studies suggest that FANCF shRNA can be administered in combination with MMC, especially for those tumors that develop resistance to MMC.

Acknowledgements

This study was supported by grants from National Natural Science Foundation of China (nos. 30873097, 81173092 and 81202551) and Liaoning Province Scientific Research Foundation of China (nos. 2011415052 and 20111107), and by Specialized Research Fund for the Doctoral Program of Higher Education (no. 20122104120031).

References