Increased urothelial cancer associated 1 is associated with tumor proliferation and metastasis and predicts poor prognosis in colorectal cancer

  • Authors:
    • Beibei Ni
    • Xihu Yu
    • Xiaoyan Guo
    • Xinjuan Fan
    • Zihuan Yang
    • Peihuang Wu
    • Zixu Yuan
    • Yanhong Deng
    • Jianping Wang
    • Dianke Chen
    • Lei Wang
  • View Affiliations

  • Published online on: July 29, 2015     https://doi.org/10.3892/ijo.2015.3109
  • Pages:1329-1338
Metrics: HTML 0 views | PDF 0 views
0

Abstract

Long non-coding RNA, urothelial cancer associated 1 (UCA1), is reported to play a critical role in progression of carcinogenesis. In the present study, we identified differential expression of UCA1 in colorectal cancer (CRC) and paired peritumoral tissues using gene expression microarray analyses. qPCR analysis confirmed that UCA1 was upregulated in CRC (p<0.001) and the expression of UCA1 was statistically correlated with lymph node metastasis (P=0.040), distant metastasis (P=0.043) and tumor stage (P=0.010). Kaplan-Meier analysis indicated that patients with high UCA1 expression had a poor prognosis. Moreover, multivariate analysis identified UCA1 overexpression as an independent predictor for CRC. We also found that knockdown of UCA1 significantly suppressed cell proliferation and metastasis in CRC cells. Flow cytometry assays showed UCA1 silencing induced G0/G1 growth arrest and apoptosis of CRC cells. To further investigate the regulatory mechanisms of UCA1, we identified that Ets-2 bound to the UCA1 core promoter using luciferase assays. Collectively, our findings suggested that UCA1 might be an important prognostic indicator in CRC and may be a potential target for diagnosis and gene therapy.

Introduction

Colorectal cancer (CRC) is the third most frequently diagnosed cancer in males and the second most frequently diagnosed cancer in females (1). Although current radio-chemical therapies and surgery have shown great progress, the morbidity and mortality rate of CRC has still increased over the years (2). Therefore, there is an urgent need to understand the molecular mechanisms underlying CRC tumorigenesis and to identify new therapeutic targets for CRC.

With advances in sequencing technologies, non-coding RNAs, which account for 70% of the human genome, have shown great potential in biological research and clinical diagnostics. Non-coding RNAs (3) are divided into two major classes: small non-coding RNAs (sncRNAs) and long non-coding RNAs (lncRNAs), based on the transcript size. Although many studies proved that sncRNAs, especially microRNAs (miRNAs) (4,5), played important roles in the pathogenesis of many diseases, little is known about lncRNAs. LncRNAs (>200 nucleotides), which were once regarded as ‘transcriptional noise’ in the genomic RNA, have been proved to play important roles in regulating gene expression at the epigenetic, transcriptional and post-transcriptional levels (6,7). In the last few decades, a large number of lncRNAs [e.g., H19 (8,9), MALAT1 (10,11) and HOTAIR (12)] have been identified and studied in a variety of diseases. It is expected that lncRNAs could be used in clinical applications as prognostic or predictors of cancer. In CRC, emerging evidence (1315) revealed that aberrant expression of particular lncRNAs could represent novel cancer biomarkers. PVT-1 (16), generates anti-apoptotic activity in CRC, was a prognostic indicator for CRC patients. LncRNA 91H (17) was considered as a prognosis indicator that contributed to tumor metastasis and predicted patient survival in CRC. However, the relationship between lncRNA expression level and progression of CRC is still elusive.

To screen tumor initiation and progression-associated lncRNAs in CRC, we profiled the expression of lncRNAs in six pairs of CRC tissues and peritumoral tissues using microarray analysis. We found that the levels of UCA1 in CRC tissues were 7.104 times higher than peritumoral tissues. UCA1, which was identified as a novel bladder transitional cell carcinoma (TCC) transcript (18), played a key role in cellular proliferation, metastasis and oncogenesis, and was identified as a novel therapeutic target (19,20). However, the role of UCA1 in CRC is not well studied, therefore, we focused our attention on UCA1 and investigated the clinical values and biological roles of UCA1 in CRC.

Materials and methods

Study subjects and sample collection

The Institutional Review Board of Sun Yat-Sen University approved the study protocol. In the present study, 54 CRC samples and paired peritumoral samples, deposited between 2010 March to 2010 July in Tissue bank of the Sixth Affiliated Hospital, Sun Yat-Sen University, were used. Informed consent was obtained from participants for the use of their tissues in the present study. All the diagnoses of CRC were histopathologically confirmed. The data of clinicopathological characteristics (include age, gender, tumor size, tumor location, differentiation, histological stage, tumor invasion and lymph node metastasis) were collected from medical records and pathology reports. The stage of CRC was evaluated based on the American Joint Committee on Cancer staging Manual. Follow-up was performed according to the National Comprehensive Cancer Network (NCCN) guidelines.

Cell lines and cell culture

All the human CRC cell lines (HCT116, SW480, RKO, HCT8, LoVo, T84, HT29, DLD1, HCT15, Colo205 and Caco2) were purchased in March 2013 from the Culture Collection of Chinese Academy of Science, Shanghai, China. They were routinely cultured in Dulbecco's modified Eagle's medium (DMEM) or RPMI-1640 medium, supplemented with 1% penicillin/streptomycin and 10% fetal bovine serum (FBS; Life Technologies, Carlsbad, CA, USA). The cells were grown at 37°C with 5% CO2 in a humidified incubator.

Microarray and computational analysis

Six CRC tissues and paired peritumoral tissues were used to investigate the expression of both protein coding mRNAs (~26109) and lncRNAs (~30586) using the Human 8×60K LncRNA Microarray V3.0 (Arraystar, Rockville, MD, USA). The raw signal intensities were normalized and hierarchical clustering of differentially expressed lncRNAs was performed using GeneSpring GX v11.5.1 software (Agilent Technologies, Santa Clara, CA, USA). Kangcheng Biology Engineering Co., Ltd., (Shanghai, China) performed the microarray analysis.

siRNA transfection

HCT116 and DLD1 cells were transfected with siRNA oligonucleotides using the Lipofectamine RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA) for 48 h in 6-well plates. Both the UCA1 siRNA and the scrambled control siRNA were synthesized by Guangzhou RiboBio Co., Ltd. (Guangzhou, China). Each well contained 3×105 cells, 5 μl siRNA, 5 μl Lipofectamine RNAiMAX and 500 μl Opti-MEM (Invitrogen). Both the UCA1 siRNA and the scrambled control siRNA were synthesized by Guangzhou Ribobio. We selected one of the siRNA sequences from three candidates based on the highest knockdown efficiency, as confirmed by qPCR. The sequences of these siRNAs are listed in Table I.

Table I

Primers used in the present study.

Table I

Primers used in the present study.

GeneSequence (5′-3′)Experimental use
UCA1 siRNA GCAUCCAGGACAACACAAAdTdT
dTdTCGUAGGUCCUGUUGUGUUU
siRNA
UCA1 mRNA CTCTCCATTGGGTTCACCATTC
GCGGCAGGTCTTAAGAGATGAG
qRCR/RT-PCR
GAPDH mRNA GACAGTCAGCCGCATCTTCTT
AATCCGTTGACTCCGACCTTC
qRCR/RT-PCR
UCA1 promoter CGGGGTACCTCCTAAGGGGTTTCCTTT
CCCAAGCTTGGCTGTTAATTCACTTGGG
PCR
Ets-2 binding site AGATCTAAATGACCCAGGAGCTGATA
AGAGGACAGCCTGAGATGTGCCTGTGG
Site-directed mutagenesis
CEBP binding site CTCAAGTTAGGGAACTGTCAGGCCTCTGA
CGTTACAGGGTGATGTGACCTCAGCCCAC
Site-directed mutagenesis
C-myb binding site CGCCTGAAACCCAGGACCAGGAAAAGA
TGCCTGGGGCTCATCTGAGATGCCCAC
Site-directed mutagenesis
GATA1 binding site AGCGAGAGGGTGGGCTGAGGTCACATC
TTTTCCTGGTCCTGGGTTTCAGAACTG
Site-directed mutagenesis
CREB/α binding site GAGCTCCACATCACCCTGTAACGTTTCC
GCCCACCCTCTTATCTTTTCCTGGTCCT
Site-directed mutagenesis
Reverse transcription and quantitative real-time PCR (qPCR)

RNAs from cells and tissues were extracted by using the TRIzol reagent (Invitrogen), according to the manufacturer's instructions. Reverse transcription was carried out with ReverTra Ace qPCR RT Master Mix with gDNA remover (Toyobo Co., Ltd., Osaka, Japan). qPCR was conducted using SYBR-Green real-time PCR Master Mixes (Applied Biosystems, Foster City, CA, USA), using the following conditions: 95°C for 10 min; and 40 cycles of 95°C for 15 sec; 60°C for 1 min. The PCR products were subjected to 1% agarose gel and the relative UCA1 expression levels were quantified by using Quantity One software (Bio-Rad Laboratories, Hercules, CA, USA). In each qPCR assay, amplification of the housekeeping gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was performed as the internal control. qPCR was performed in triplicate, including no-template controls. The amplification of the appropriate product was confirmed by melting curve analysis following amplification. The relative expression of UCA1 was calculated using the comparative cycle threshold (CT) (2−ΔΔCT) method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the endogenous control to normalize the data. The PCR primers used in the present study are listed in Table I.

Cell proliferation assays

Cell proliferation was performed on the xCELLigence real-time cellular analysis DP device (ACEA Biosciences, San Diego, CA, USA). Cells were seeded in cell culture E-plates at a density of 6000 cells/well and incubated at 37°C and 5% CO2. The plate was automatically monitored and recorded every 15 min for a total of 120 h. Three replicate cells were used and three independent experiments were conducted. The results were expressed as the parameter ‘Cell Index’.

Cell migration and invasion assays

Cell invasion assays were performed using a 24-Multiwell insert plate with an 8.0-micron pore size membrane (BD Biosciences, Bedford, MA, USA) chamber containing a Matrigel-coated membrane. Cells were prepared by suspending them in serum-free DMEM and adding them to apical chambers whose reverse sides had been covered by fibronectin (BD Biosciences). Cells at a density of 40,000 cells/100 μl of DMEM media were placed into the upper chamber of the Transwell plate and 700 μl of DMEM medium containing 20% FBS was to the basal chambers for better cell access. After incubating the plate for 48 h at 37°C, 5% CO2 atmosphere, invasive cells were stained with DAPI and counted using a fluorescence microscope. The cell migration assay was the same but without Matrigel. Experiments were repeated independently three times.

Cell cycle and apoptosis assays

Cells were stained by using cell cycle staining solution (Lianke, Hangzhou, China) and analyzed by flow cytometry. Approximately 2×105 cells were pelleted by centrifugation and washed with PBS. Cold 75% ethanol (1 ml) was added to the cells at −20°C overnight. The ethanol was discarded and PBS was added to rehydrate the cells for 15 min. The cells were incubated with 1 ml DNA staining solution at room temperature, then sorted by FACSCalibur (BD Biosciences, Flanklin Lakes, NJ, USA). The results were analyzed using ModFit 3.0 software (Verity Software House, Topsham, ME, USA). Cell apoptosis was detected using an Annexin V/PI apoptosis kit (Lianke). Cells (2×105) were collected by centrifugation and resuspended in 500 μl of 1X binding buffer. Annexin V-FITC (5 μl) and 10 μl propidium iodide were added and the cells were incubated for 5 min in the dark, at room temperature before being examined using flow cytometry.

Plasmid constructs and site-directed mutagenesis

The UCA1 promoter (−500 to +200 bp) was obtained by PCR (PrimeSTAR Max DNA polymerase; Takara, Shiga, Japan). The PCR products were subjected to 1% agarose gel and isolated from the gel using a Gel/PCR Extraction kit (Biomiga, San Diego, CA, USA). The pGL3-UCA1-promoter vector was constructed from the pGL3 basic vector and the purified UCA1 promoter using Ligation high (Toyobo). Site-directed mutagenesis was performed using a KOD-plus-mutagenesis kit (Toyobo), according to the manufacturer's instructions. The pGL3-UCA1-promoter vector was used as the template. The mutation sites were designed at the 3′ region of the primers. All the primers are listed in Table I.

Luciferase assays

Lipofectamine 3000 (Invitrogen) was used to co-transfect CRC cells with the pGL3-UCA1-promoter (mutation), in combination with the pRL Renilla luciferase reporter vectors (Promega, Madison, WI, USA) as an internal control reporter. After incubating cells for 48 h at 37°C, luciferase activities were detected using a Dual-luciferase reporter assay (Promega), according to the manufacturer's instructions. Firefly luciferase luminescence was measured using Varioskan Flash (Thermo Fisher Scientific, Waltham, MA, USA).

Statistical analysis

Statistical analyses were performed with the SPSS statistical package (version 16.0; SPSS, Inc., Chicago, IL, USA). Data are presented as means ± standard deviation (SD). Differences between groups were compared using paired t-tests, unpaired Student's t-tests or the Mann-Whitney U test. Overall survival curves were plotted according to the Kaplan-Meier method, with the log-rank test applied for comparison. A Cox proportional hazards model univariate and multivariate analysis were performed to evaluate the association between UCA1 expression and clinicopathological parameters on the overall survival. In all analyses, a probability (P) of ≤0.05 was considered statistically significant.

Results

UCA1 is highly expressed in CRC tissues and cell lines

To determine the effects of lncRNAs on CRC, we profiled the expression of lncRNAs in six CRC tissues and paired peritumoral tissues using microarray analysis. Hierarchical clustering showed systematic variations in the expression of lncRNAs (fold-change ≥4) between CRC and paired peritumoral tissues (Fig. 1A). We noted that UCA1 was remarkably upregulated (fold-change, 7.104, P=0.0066) in CRC according to microarray data. To validate the microarray analysis findings, the expression of UCA1 was detected by qPCR from 54 pairs of CRC tissues compared with paired peritumoral tissues. The results showed that UCA1 expression was significantly higher in the tumor tissues than in the paired peritumoral tissues (P<0.001) (Fig. 1B and C). PCR assays were further developed to quantify the UCA1 expression in 11 CRC cell lines (HCT116, SW480, RKO, HCT8, LoVo, T84, HT29, DLD1, HCT15, Colo205 and Caco2 cells). Almost all the cell lines showed positive, high expression, except RKO (Fig. 1D). These results revealed that the expression of UCA1 is upregulated in CRC tissues.

UCA1 is a predictor of poor outcome in patients with CRC

To assess the correlation of UCA1 expression with clinicopathological characteristics, the expression levels of UCA1 in CRC tissues were categorized as low or high in relation to the median value. The clinicopathological characteristics are summarized in Table II. UCA1 expression in CRC was significantly correlated with lymphatic metastasis (P=0.040), distant metastasis (P=0.043) and tumor stage (P=0.010). However, there was no significant association between UCA1 expression and age, gender, differentiation, lymphatic invasion or venous invasion (all P>0.05). With regard to overall survival, patients with high UCA1 expression had a significantly poorer prognosis than those with low UCA1 expression (Log-rank P=0.021) (Fig. 1E). Unvariate analysis of overall survival revealed that the relative level of UCA1 expression (P=0.038), lymphatic invasion (P=0.001), lymph node metastasis (P=0.015), distant metastasis (P=0.001) and tumor stage (P=0.002) were prognostic indicators (Table III). The other clinicopathological characteristics, such as age, gender, histological grade, venous invasion, were not statistically significant prognosis factors (P>0.05; Table III). Multivariate analysis showed that UCA1 expression was an independent prognostic indicator of poor survival in CRC (P=0.023) in addition to the presence of lymphatic invasion (P=0.016) (Table III).

Table II

UCA1 expression and clinicopathological factors in 54 CRC cases.

Table II

UCA1 expression and clinicopathological factors in 54 CRC cases.

High expression (N=27)Low expression (N=27)


FactorsN (%)N (%)P-value
Age (years)
 ≤609 (33.3)10 (37.0)0.776
 >6018 (66.7)17 (63.0)
Gender
 Male17 (63.0)22 (81.5)0.129
 Female10 (37.0)5 (18.5)
Histological grade
 Well and moderately15 (55.6)17 (63.0)0.580
 Poorly and other12 (44.4)10 (37.0)
Lymphatic invasion
 Absent22 (81.5)24 (88.9)0.440
 Present5 (18.5)3 (11.1)
Venous invasion
 Absent22 (81.5)22 (81.5)1.00
 Present5 (18.5)5 (18.5)
Lymph node metastasis
 N015 (55.6)22 (81.5)0.040
 N1–212 (44.4)5 (18.5)
Distant metastasis
 Absent21 (22.2)26 (96.3)0.043
 Present6 (77.8)1 (3.7)
AJCC stage
 I, II13 (48.1)22 (81.5)0.010
 III, IV14 (51.9)5 (18.5)

Table III

Univariate and multivariate analysis for overall survival (Cox proportional hazards regression model).

Table III

Univariate and multivariate analysis for overall survival (Cox proportional hazards regression model).

Univariate analysisMultivariate analysis


FactorsRRP-valueRRP-value
Age (years)0.6500.477
Gender0.5490.443
Histological grade0.4970.302
Lymphatic invasion (absent/present)13.710.001a11.910.016a
Venous invasion (absent/present)1.6780.445
Lymph node metastasis (N0/N1–2)4.5740.015a1.1190.926
Distant metastasis (absent/present)25.650.001a3.9840.157
AJCC stage11.170.002a3.620.443
UCA1 expression (low/high)5.0680.038a3.1370.023a

{ label (or @symbol) needed for fn[@id='tfn1-ijo-47-04-1329'] } RR, relative risk;

a P<0.05.

Knockdown of UCA1 suppresses cell proliferation and prevents the G0/G1 progression of CRC cells

To investigate the biological function of UCA1, we conducted UCA1 knockdown assays using RNA interference in CRC cells. Firstly, we confirmed that UCA1 expression in HCT116 and DLD1 cells transfected with UCA1-specific siRNA was significantly lower than that in cells transfected with the negative control siRNA: the expression levels of UCA1 were reduced by 90% and 80%, as detected by qPCR. Real-time cellular analysis (RTCA) indicated that cell proliferation was reduced in CRC cells when UCA1 was knocked down. For HCT116 cells, we observed a 42.8% reduction in the cell proliferation rate when UCA1 was silenced (0.28 ±0.07 for the siRNA-UCA1 group vs. 0.49±0.08 for the siControl group, P=0.028) (Fig. 2A). For DLD1 cells, we observed a 21.9% reduction in the cell proliferation rate when UCA1 was silenced (0.25±0.03 for the siRNA-UCA1 group vs. 0.32±0.02 for the siControl group, P=0.033) (Fig. 2B). In addition, fluorescence-activated cell sorting (FACS) analysis was conducted to analyze the effect of UCA1 on cell cycle progression. Knockdown of UCA1 increased the proportion of cells in G0/G1 phases (HCT116 cell line: 73.9±8.57% for the siRNA-UCA1 group vs. 52.1±10.3% for the siControl group, P=0.0074; DLD1 cell line: 70.1±8.92% for the siRNA-UCA1 group vs. 54.7±10.0% for the siControl group, P=0.029, respectively) (Fig. 2C and D). Collectively, these data suggested that silencing of UCA1 contributed to proliferation inhibition via cell cycle arrest.

Silencing UCA1 promotes apoptosis, inhibits migration and invasion in CRC cells

Consistent with decreased cell proliferation, there was a significant increase in the apoptosis of UCA1 knockdown cells relative to that of the negative control cells (HCT116 cell line: 25.7±8.8% for the siRNA-UCA1 group vs. 15.2±7.0% for the siControl group, P=0.020; DLD1 cell line: 28.9±3.0% for the siRNA-UCA1 group vs. 21.7±3.3% for the siControl group, P=0.009, respectively) (Fig. 3A). Therefore, the data suggested that UCA1 could inhibit apoptosis of CRC cells. We further analyzed whether UCA1 knockdown affected cell migration and invasion of CRC cells using Transwell migration assays. The results indicated that UCA1-silenced HCT116 and DLD1 cells showed less potential of migration and invasion ability compared with the negative control cell lines (all P<0.01) (Fig. 3B and C). These data suggested that UCA1 induced migration and invasion in CRC cells.

Ets-2 is critical for UCA1 promoter activity

To obtain insight into the potential regulators of UCA1, we analyzed the core promoter of UCA1 (from nucleotides −500 to 200) using several bioinformatics software programs and predicted five potential transcription factor binding sites (Ets-2, C/EBPα, c-myb, GATA-1 and CREB) (Fig. 4A and B). To investigate which transcription factor is critical for UCA1 promoter activity, we replaced the five transcription factor binding sites to mutated sites in pGL3-UCA1-700-mut and the mutated sites are shown in Fig. 4C. Compared with the wild-type pGL-3-UCA1-700 construct, HCT116 and DLD1 cells yielded a lower promoter activity when transcription factor Ets-2 binding site was mutated, as assessed by luciferase reporter assays (0.677±0.06 for Ets-2 vs. 1 for control, P=0.0084, 0.725±0.08 for Ets-2 vs. 1 for control, P=0.019, respectively) (Fig. 4D). The results suggested that Ets-2 binding sites play an essential role in the regulation of the UCA1 promoter activity.

Discussion

CRC is the process whereby benign polyps develop into adenoma and then into tumors; thus, early screening and diagnosis are important to decrease the death rate (21). Numerous genetic and epigenetic alterations, such as DNA methylation and microRNAs, have been studied as potential biomarkers for screening or diagnosis in CRC. However, few such markers can be applied for clinical diagnosis and treatment. Thus, it is essential to screen out new effective biomarkers.

LncRNAs have attracted increased interest from researchers in recent years. A growing number of studies (2224) suggest that abnormal expressions of lncRNAs are closely related to tumor initiation and progression. Unlike protein-coding mRNAs, which are expressed in multiple tissue types, most lncRNAs show tissue-specific expression patterns. For example, Yang et al (25) found that CCAT1 was upregulated in gastric cancer and might be a potential therapeutic marker. Qi et al (26) also suggested that low expression of lncRNA loc285194 was related to poor prognosis in CRC. There is no doubt that lncRNAs have significant roles in cancer progression and development. However, only a limited number of lncRNAs have been investigated in detail (2729) and the functional roles of lncRNAs in CRC are not yet well elucidated.

In the present study, we observed that UCA1 was highly expressed in CRC tissues, suggesting a positive role for UCA1 in CRC tumourigenesis. In addition, the expression of UCA1 was associated with lymph mode metastasis (P=0.04), distant metastasis (P=0.043) and tumor stage (P=0.01). In the survival analysis, high UCA1 expression levels were related with poor prognosis, indicating that UCA1 could be a valuable prognostic biomarker. In fact, UCA1 has been extensively studied in the context of cancer (3032), especially in bladder cancer (33). Fang et al (34) have reported that a significantly elevated expression of UCA1 in tongue squamous cell carcinomas was found and there was higher expression of UCA1 in lymph node metastases than in paired primary tumors. Previous studies indicated that other lncRNAs were also considered as molecular biomarkers in CRC. CCAT1 (35), an upregulated lncRNA in CRC, was explored for early screening and detection. Elevated levels of lincRNA-p21 were significantly associated with CRC disease state. In this regard, UCA1 could be used as a potential prognostic indicator in CRC.

We identified the biological functions of UCA1 in CRC cells. Proliferative activity and the ability to metastasis were significantly suppressed in vitro after silencing of UCA1. Besides, knockdown of UCA1 induced G0/G1 phase arrest and promoted apoptosis in CRC cells. Similar to these findings, Fan et al (20) reported that ectopic UCA1 expression enhances the tumorigenic potential and increases invasion. Some of our results were similar to those of Han et al (36), who also observed that elevated UCA1 expression in CRC could influence cancer cell proliferation and apoptosis. However, our results differ in terms of the metastatic phenotype. Our results showed that high expression of UCA1 could significantly enhance migration and invasion of CRC cell lines, whereas those of Han et al did not. The contradictory results may be due in part to the different cells used. The results suggest that UCA1 acts as an oncogene in CRC.

Recent studies put forward that the transcription factors regulate lncRNAs via binding with the promoters of lncRNAs, which has been proved to play a pivotal role in tumor progression (3739). In the present study, we found that Ets-2 could bind to the UCA1 core promoter and stimulated UCA1 transcriptional activation in CRC cells. Similar to these findings, Wu et al (40) have also demonstrated that Ets-2 bound to the UCA1 promoter region and regulated cell apoptosis via Akt pathway in bladder cancer. Our data support that Ets-2 takes part in CRC development, but the exact regulatory mechanisms of UCA1 by Ets-2 in CRC require further investigation.

Some studies have reported that UCA1 may act as a switch to regulate gene expression in different cell signal pathways in cancer. Yang et al (38) observed that UCA1 regulated the cell cycle through CREB via the PI3K-AKT pathway in bladder carcinoma. In another study, UCA1 was observed to regulate bladder cancer cell glucose metabolism through the cascade of mTOR-STAT3/miR143-HK2 (41). These results highlighted the effect of UCA1 on signal transduction pathways. Besides, the report that UCA1 could be regulated by hsa-miR-1 in bladder cancer showed that lncRNAs may act as a novel set of targets for microRNA (42). Other regulatory factors such as histone modification and DNA methylation that influence UCA1 expression in CRC need to be further studied.

Our results showed that UCA1 expression was significantly increased in CRC tissues and cell lines. Elevated levels of UCA1 were statistically correlated with lymph mode metastasis, distant metastasis and tumor stage, and predicted poor prognosis in CRC. In vitro, we demonstrated that UCA1 was associated with tumor migration, invasion and proliferation of CRC cells. These findings provide important insight into exploring new biomarkers for the diagnosis and therapy of CRC. The results indicate that UCA1 may be a promising target for future therapy of CRC.

Acknowledgements

The present study was partly supported by the National Natural Scientific Foundation of China (grant nos. 81201581 to D.C. and 81372566 to L.W.), the Guangdong Provincial Scientific Research Foundation (grant no. S2013010013478 to D.C.), the Sun Yat-Sen University Young Teacher Training Program (grant no. 88000-3126201 to D.C.), National Key Technology Support Program (grant no. 2014BAI09B06) and Science and Technology Plan Project of Guangzhou (grant no. 2013J4500045). We thank Z. Wang for his assistance in recruiting the subjects and X. Fu for his laboratory assistance.

Abbreviations:

CRC

colorectal cancer

UCA1

urothelial carcer associated 1

LncRNA

long non-coding RNA

qPCR

quantitative real-time polymerase chain reaction

sncRNA

small non-coding RNAs

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

RTCA

real-time cellular analysis

FACS

fluorescence-activated cell sorting

References

1 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Brenner H, Kloor M and Pox CP: Colorectal cancer. Lancet. 383:1490–1502. 2014. View Article : Google Scholar

3 

Sana J, Faltejskova P, Svoboda M and Slaby O: Novel classes of non-coding RNAs and cancer. J Transl Med. 10:1032012. View Article : Google Scholar : PubMed/NCBI

4 

Øster B, Linnet L, Christensen LL, Thorsen K, Ongen H, Dermitzakis ET, Sandoval J, Moran S, Esteller M, Hansen TF, et al: COLOFOL steering group: Non-CpG island promoter hypomethylation and miR-149 regulate the expression of SRPX2 in colorectal cancer. Int J Cancer. 132:2303–2315. 2013. View Article : Google Scholar

5 

Doberstein K, Steinmeyer N, Hartmetz AK, Eberhardt W, Mittelbronn M, Harter PN, Juengel E, Blaheta R, Pfeilschifter J and Gutwein P: MicroRNA-145 targets the metalloprotease ADAM17 and is suppressed in renal cell carcinoma patients. Neoplasia. 15:218–230. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Ponjavic J, Ponting CP and Lunter G: Functionality or transcriptional noise? Evidence for selection within long noncoding RNAs. Genome Res. 17:556–565. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Wilusz JE, Sunwoo H and Spector DL: Long noncoding RNAs: Functional surprises from the RNA world. Genes Dev. 23:1494–1504. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Luo M, Li Z, Wang W, Zeng Y, Liu Z and Qiu J: Long non-coding RNA H19 increases bladder cancer metastasis by associating with EZH2 and inhibiting E-cadherin expression. Cancer Lett. 333:213–221. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Tsang WP, Ng EK, Ng SS, Jin H, Yu J, Sung JJ and Kwok TT: Oncofetal H19-derived miR-675 regulates tumor suppressor RB in human colorectal cancer. Carcinogenesis. 31:350–358. 2010. View Article : Google Scholar

10 

Ji P, Diederichs S, Wang W, Böing S, Metzger R, Schneider PM, Tidow N, Brandt B, Buerger H, Bulk E, et al: MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22:8031–8041. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Xu C, Yang M, Tian J, Wang X and Li Z: MALAT-1: A long non-coding RNA and its important 3′ end functional motif in colorectal cancer metastasis. Int J Oncol. 39:169–175. 2011.PubMed/NCBI

12 

Kogo R, Shimamura T, Mimori K, Kawahara K, Imoto S, Sudo T, Tanaka F, Shibata K, Suzuki A, Komune S, et al: Long noncoding RNA HOTAIR regulates polycomb-dependent chromatin modification and is associated with poor prognosis in colorectal cancers. Cancer Res. 71:6320–6326. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Xue Y, Ma G, Gu D, Zhu L, Hua Q, Du M, Chu H, Tong N, Chen J, Zhang Z, et al: Genome-wide analysis of long noncoding RNA signature in human colorectal cancer. Gene. 556:227–234. 2015. View Article : Google Scholar

14 

Shi D, Zheng H, Zhuo C, Peng J, Li D, Xu Y, Li X, Cai G and Cai S: Low expression of novel lncRNA RP11-462C24.1 suggests a biomarker of poor prognosis in colorectal cancer. Med Oncol. 31:312014. View Article : Google Scholar : PubMed/NCBI

15 

Zhai H, Fesler A, Schee K, Fodstad O, Flatmark K and Ju J: Clinical significance of long intergenic noncoding RNA-p21 in colorectal cancer. Clin Colorectal Cancer. 12:261–266. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Takahashi Y, Sawada G, Kurashige J, Uchi R, Matsumura T, Ueo H, Takano Y, Eguchi H, Sudo T, Sugimachi K, et al: Amplification of PVT-1 is involved in poor prognosis via apoptosis inhibition in colorectal cancers. Br J Cancer. 110:164–171. 2014. View Article : Google Scholar :

17 

Deng Q, He B, Gao T, Pan Y, Sun H, Xu Y, Li R, Ying H, Wang F, Liu X, et al: Up-regulation of 91H promotes tumor metastasis and predicts poor prognosis for patients with colorectal cancer. PLoS One. 9:e1030222014. View Article : Google Scholar : PubMed/NCBI

18 

Wang XS, Zhang Z, Wang HC, Cai JL, Xu QW, Li MQ, Chen YC, Qian XP, Lu TJ, Yu LZ, et al: Rapid identification of UCA1 as a very sensitive and specific unique marker for human bladder carcinoma. Clin Cancer Res. 12:4851–4858. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Wang F, Li X, Xie X, Zhao L and Chen W: UCA1, a non-protein-coding RNA up-regulated in bladder carcinoma and embryo, influencing cell growth and promoting invasion. FEBS Lett. 582:1919–1927. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Fan Y, Shen B, Tan M, Mu X, Qin Y, Zhang F and Liu Y: Long non-coding RNA UCA1 increases chemoresistance of bladder cancer cells by regulating Wnt signaling. FEBS J. 281:1750–1758. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Gellad ZF and Provenzale D: Colorectal cancer: National and international perspective on the burden of disease and public health impact. Gastroenterology. 138:2177–2190. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Li J, Chen Z, Tian L, Zhou C, He MY, Gao Y, Wang S, Zhou F, Shi S, Feng X, et al: LncRNA profile study reveals a three-lncRNA signature associated with the survival of patients with oesophageal squamous cell carcinoma. Gut. 63:1700–1710. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Yang F, Zhang L, Huo XS, Yuan JH, Xu D, Yuan SX, Zhu N, Zhou WP, Yang GS, Wang YZ, et al: Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans. Hepatology. 54:1679–1689. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Schmidt LH, Spieker T, Koschmieder S, Schäffers S, Humberg J, Jungen D, Bulk E, Hascher A, Wittmer D, Marra A, et al: The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. J Thorac Oncol. 6:1984–1992. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Yang F, Xue X, Bi J, Zheng L, Zhi K, Gu Y and Fang G: Long noncoding RNA CCAT1, which could be activated by c-Myc, promotes the progression of gastric carcinoma. J Cancer Res Clin Oncol. 139:437–445. 2013. View Article : Google Scholar

26 

Qi P, Xu MD, Ni SJ, Huang D, Wei P, Tan C, Zhou XY and Du X: Low expression of LOC285194 is associated with poor prognosis in colorectal cancer. J Transl Med. 11:1222013. View Article : Google Scholar : PubMed/NCBI

27 

Spizzo R, Almeida MI, Colombatti A and Calin GA: Long non-coding RNAs and cancer: A new frontier of translational research? Oncogene. 31:4577–4587. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Pandey GK, Mitra S, Subhash S, Hertwig F, Kanduri M, Mishra K, Fransson S, Ganeshram A, Mondal T, Bandaru S, et al: The risk-associated long noncoding RNA NBAT-1 controls neuroblastoma progression by regulating cell proliferation and neuronal differentiation. Cancer Cell. 26:722–737. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Yuan SX, Tao QF, Wang J, Yang F, Liu L, Wang LL, Zhang J, Yang Y, Liu H, Wang F, et al: Antisense long non-coding RNA PCNA-AS1 promotes tumor growth by regulating proliferating cell nuclear antigen in hepatocellular carcinoma. Cancer Lett. 349:87–94. 2014. View Article : Google Scholar : PubMed/NCBI

30 

Hiemer SE, Szymaniak AD and Varelas X: The transcriptional regulators TAZ and YAP direct transforming growth factor β-induced tumorigenic phenotypes in breast cancer cells. J Biol Chem. 289:13461–13474. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Liu SP, Yang JX, Cao DY and Shen K: Identification of differentially expressed long non-coding RNAs in human ovarian cancer cells with different metastatic potentials. Cancer Biol Med. 10:138–141. 2013.

32 

Huang J, Zhou N, Watabe K, Lu Z, Wu F, Xu M and Mo YY: Long non-coding RNA UCA1 promotes breast tumor growth by suppression of p27 (Kip1). Cell Death Dis. 5:e10082014. View Article : Google Scholar : PubMed/NCBI

33 

Xue M, Li X, Li Z and Chen W: Urothelial carcinoma associated 1 is a hypoxia-inducible factor-1α-targeted long noncoding RNA that enhances hypoxic bladder cancer cell proliferation, migration, and invasion. Tumour Biol. 35:6901–6912. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Fang Z, Wu L, Wang L, Yang Y, Meng Y and Yang H: Increased expression of the long non-coding RNA UCA1 in tongue squamous cell carcinomas: A possible correlation with cancer metastasis. Oral Surg Oral Med Oral Pathol Oral Radiol. 117:89–95. 2014. View Article : Google Scholar

35 

Nissan A, Stojadinovic A, Mitrani-Rosenbaum S, Halle D, Grinbaum R, Roistacher M, Bochem A, Dayanc BE, Ritter G, Gomceli I, et al: Colon cancer associated transcript-1: A novel RNA expressed in malignant and pre-malignant human tissues. Int J Cancer. 130:1598–1606. 2012. View Article : Google Scholar

36 

Han Y, Yang YN, Yuan HH, Zhang TT, Sui H, Wei XL, Liu L, Huang P, Zhang WJ and Bai YX: UCA1, a long non-coding RNA up-regulated in colorectal cancer influences cell proliferation, apoptosis and cell cycle distribution. Pathology. 46:396–401. 2014. View Article : Google Scholar : PubMed/NCBI

37 

Xue M, Li X, Wu W, Zhang S, Wu S, Li Z and Chen W: Upregulation of long non-coding RNA urothelial carcinoma associated 1 by CCAAT/enhancer binding protein α contributes to bladder cancer cell growth and reduced apoptosis. Oncol Rep. 31:1993–2000. 2014.PubMed/NCBI

38 

Yang C, Li X, Wang Y, Zhao L and Chen W: Long non-coding RNA UCA1 regulated cell cycle distribution via CREB through PI3-K dependent pathway in bladder carcinoma cells. Gene. 496:8–16. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Kabbout M, Garcia MM, Fujimoto J, Liu DD, Woods D, Chow CW, Mendoza G, Momin AA, James BP, Solis L, et al: ETS2 mediated tumor suppressive function and MET oncogene inhibition in human non-small cell lung cancer. Clin Cancer Res. 19:3383–3395. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Wu W, Zhang S, Li X, Xue M, Cao S and Chen W: Ets-2 regulates cell apoptosis via the Akt pathway, through the regulation of urothelial cancer associated 1, a long non-coding RNA, in bladder cancer cells. PLoS One. 8:e739202013. View Article : Google Scholar : PubMed/NCBI

41 

Li Z, Li X, Wu S, Xue M and Chen W: Long non-coding RNA UCA1 promotes glycolysis by upregulating hexokinase 2 through the mTOR-STAT3/microRNA143 pathway. Cancer Sci. 105:951–955. 2014. View Article : Google Scholar : PubMed/NCBI

42 

Wang T, Yuan J, Feng N, Li Y, Lin Z, Jiang Z and Gui Y: Hsa-miR-1 downregulates long non-coding RNA urothelial cancer associated 1 in bladder cancer. Tumour Biol. 35:10075–10084. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October 2015
Volume 47 Issue 4

Print ISSN: 1019-6439
Online ISSN:1791-2423

2016 Impact Factor: 3.079
Ranked #33/217 Oncology
(total number of cites)

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Ni, B., Yu, X., Guo, X., Fan, X., Yang, Z., Wu, P. ... Wang, L. (2015). Increased urothelial cancer associated 1 is associated with tumor proliferation and metastasis and predicts poor prognosis in colorectal cancer. International Journal of Oncology, 47, 1329-1338. https://doi.org/10.3892/ijo.2015.3109
MLA
Ni, B., Yu, X., Guo, X., Fan, X., Yang, Z., Wu, P., Yuan, Z., Deng, Y., Wang, J., Chen, D., Wang, L."Increased urothelial cancer associated 1 is associated with tumor proliferation and metastasis and predicts poor prognosis in colorectal cancer". International Journal of Oncology 47.4 (2015): 1329-1338.
Chicago
Ni, B., Yu, X., Guo, X., Fan, X., Yang, Z., Wu, P., Yuan, Z., Deng, Y., Wang, J., Chen, D., Wang, L."Increased urothelial cancer associated 1 is associated with tumor proliferation and metastasis and predicts poor prognosis in colorectal cancer". International Journal of Oncology 47, no. 4 (2015): 1329-1338. https://doi.org/10.3892/ijo.2015.3109