Open Access

Identification of candidate genes and long non-coding RNAs associated with the effect of ATP5J in colorectal cancer

  • Authors:
    • Bingjun Bai
    • Binbin Xie
    • Zongyou Pan
    • Lina Shan
    • Jianpei Zhao
    • Hongbo Zhu
  • View Affiliations

  • Published online on: February 22, 2018     https://doi.org/10.3892/ijo.2018.4281
  • Pages: 1129-1138
  • Copyright: © Bai et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The incidence and development of colorectal cancer (CRC) is a process with multiple gene interactions. We have previously demonstrated that ATP synthase-coupling factor 6, mitochondrial (ATP5J) is associated with CRC migration and 5-fluorouracil resistance; nevertheless, the exact molecular mechanism remains unclear. The following study uses microarray and bioinformatics methods to identify candidate genes and long non-coding RNAs (lncRNAs) in CRC cells (two pairs) with upregulated and downregulated ATP5J. Briefly, a total of 2,190 differentially expressed mRNAs (DEmRNAs) were sorted. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed for 4 DEmRNAs to validate the results of microarray analysis. Functional annotation and pathway enrichment were analyzed for DEmRNAs using the Database for Annotation, Visualization and Integrated Discovery. Significantly enriched pathways included the regulation of gene expression and cell growth. The protein‑protein interaction network was constructed, and AKT serine/threonine kinase 2 (AKT2) was considered as one of the hub genes. For further analysis, 51 DEmRNAs and 30 DElncRNAs were selected that were positively or negatively associated with the expression of ATP5J in the two cell pairs. X-inactive specific transcript (XIST), premature ovarian failure 1B (POF1B) and calmin (CLMN) were identified in the DEmRNA-DElncRNA co-expression network. The expression of AKT2 and XIST in CRC cells was confirmed by RT-qPCR. To sum up, the candidate genes and lncRNAs, as well as potential signaling pathways, which were identified using integrated bioinformatics analysis, could improve the understanding of molecular events involved in the function of ATP5J in CRC.

Introduction

For patients with colorectal cancer (CRC), the overall survival benefits of systemic treatments, including tumor resection, 5-fluorouracil (5-FU)-based chemotherapy and targeted therapies, have been firmly established (1,2). Nevertheless, recurrence and metastasis caused by the drug resistance of tumor cells continue to obstruct significant therapeutic efficacy.

The development of CRC is a multi-gene, multi-step and multi-factor interactive process. The improvement of therapeutic efficacy significantly relies on improved studies of gene functions and mechanisms (3). It has been widely recognized that abnormal bioenergetics is one of the most common phenotypes of a number of tumor cells, including CRC (4). Changes in ATP synthetase are found in tumor cells and are considered to be associated with the energy metabolism and drug resistance within the tumor (5,6).

ATP synthase-coupling factor 6, mitochondrial (ATP5J) is a protein connecting F0 and F1, which are two components of ATP synthetase (7). ATP5J has been hypothesized to recover the activity of ATPase inhibited by oligomycin, as well as the exchange between ATP and inorganic phosphorus (8). Our previous study reported that ATP5J may be a tumor biomarker. Higher expression of ATP5J was found in CRC tissue compared with that in normal tissue, and in metastatic lymph nodes compared with that in primary tumors (9). In vitro experiments demonstrated that upregulation of ATP5J expression in DLD1 cells enhances cell migration and 5-FU resistance, while downregulation reverses this reaction. Investigation of ATP5J has been mainly focused on cardiovascular disease. Only a few studies have discussed the role of ATP5J in cancer, including renal carcinoma and hepatocellular carcinoma (10,11). The molecular mechanism of ATP5J in CRC cells remains unknown.

Based on previous studies, the following study investigated differentially expressed mRNAs (DEmRNAs) and lncRNAs (DElncRNAs) using microarray and bioinformatics methods. The obtained results may provide valuable information on the function and mechanism of ATP5J in CRC, and a better understanding may be beneficial for the improvement of CRC management.

Materials and methods

Cell lines

In our previous study (9), the human colon cancer DLD1 cell line was used for cell transfection and stable colony selection. The expression of ATP5J was highly downregulated in clone 4, while it was highly upregulated in clone 2. Consequently, 4 DLD1 cells that were stably transfected with pcDNA3.1(+)/ATP5J plasmid (DLD1/A2), ATP5J short hairpin (sh)RNA plasmid (DLD1/SA4) and the corresponding control vectors (DLD1/C6 and DLD1/CA6), respectively, were selected and used in the present study.

RNA extraction and microarray

Total RNA was extracted from the 4 cell types by TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocols. RNA quality was detected by an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA, USA). The microarray analysis was performed by CapitalBio Corporation (Beijing, China). Total RNA was extracted from the cells and the cDNA that was then produced by reverse transcription served as the template to synthesize the fluorescently labeled (Cy5 or Cy3) cDNA using Klenow fragment polymerase. The labeled cDNA was hybridized on the lncRNA + mRNA Human Gene Expression Microarray (4×180K; Agilent Technologies, Inc.). The microarrays were washed three times with wash solution (0.2% SDS, 2X SSC at 42°C for 120 sec) and scanned using an Agilent G2565CA Microarray Scanner (Agilent Technologies, Inc.), according to the manu facturer' s protocols. The raw data were analyzed and then normalized using percentile normalization. Only the mRNAs or lncRNAs with a fold-change ≥2.0 and a P-value cutoff of <0.05 were considered as DEmRNAs or DElncRNAs.

Pathway enrichment analysis of DEmRNAs

The Database for Annotation, Visualization and Integrated Discovery (DAVID; https://david.ncifcrf.gov/) provides a comprehensive set of functional annotation tools for investigators to extract biological meaning from genes or proteins. The Kyoto Encyclopedia of Genes and Genomes (KEGG; http://www.kegg.jp/) is a database resource for functional interpretation and annotation of enriched pathways using large-scale gene datasets. The Gene Ontology (GO; http://www.geneontology.org/) database is commonly used to unify the representation of gene and gene product attributes. GO and KEGG pathway enrichment analyses were conducted for differentially expressed genes using DAVID. A P-value of <0.05 was selected as the cut-off criterion.

Protein-protein interaction (PPI) network construction

The Search Tool for the Retrieval of Interacting Genes (STRING; http://www.string-db.org/) database is an online database containing direct and indirect associations of proteins. DEmRNAs were mapped to STRING to assess the interactions. Next, PPI networks were established using Cytoscape software (version 3.6.0; http://www.cytoscape.org/). The Molecular Complex Detection (MCODE) plug-in was utilized to filter the modules of the PPI network in Cytoscape. An MCODE score of >5 was the selection criteria. Hub genes were exported. Function and pathway enrichment analyses were performed for DEmRNAs in the modules. A P-value of <0.05 was considered statistically significant.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RNA was extracted as aforementioned. RNA was quantified using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Inc.). cDNA was generated using an RNeasy Mini kit (Takara Bio, Inc., Otsu, Japan). qPCR analysis was performed with SYBR-Green Master mix (Takara Bio, Inc.) for lncRNA and mRNA detection. The qPCR was performed at 95°C for 2 min, 40 cycles of 95°C for 5 sec and 60°C for 30 sec, one cycle of 95°C for 5 sec, 60°C for 1 min and 95°C for 15 sec, and finally, 50°C for 30 sec. Relative expression was analyzed using the 2−ΔΔCq method (12). Human GAPDH was used as an endogenous reference gene. The sequences of the primers are shown in Table I.

Table I

Sequences of primers used for reverse transcription-quantitative polymerase chain reaction.

Table I

Sequences of primers used for reverse transcription-quantitative polymerase chain reaction.

mRNAs/lncRNAsPrimer sequences
ATP5JF: TCAGCCGTCTCAGTCCATTT
R: CCAAACATTTGCTTGAGCTT
CRTAMF: CCAAATACCAGCTTCTTCATCA
R: CTTCAAACCGGAAGGGTGCT
CD44F: AGTCACAGACCTGCCCAATGCCTTT
R: TTTGCTCCACCTTCTTGACTCCCATG
CST1F: AGGAGACCATGGCCCAGTAT
R: GCAGCGGACGTCTGTAGTAG
EEF1A2F: TCTCCAAGAATGGGCAGACG
R: TTGACGATCTCGTCGTAGCG
XISTF: CTCTCCATTGGGTTCAC
R: GCGGCAGGTCTTAAGAGATGAG
AKT2F: GCCACCATGAATGAGGTGAATA
R: CCTTGTACCCAATGAAGGAGC
GAPDHF: ACCACAGTCCATGCCATCAC
R: TCCACCACCCTGTTGCTGTA

[i] ATP5J, ATP synthase-coupling factor 6, mitochondrial; CRTAM, cytotoxic and regulatory T cell molecule; CST1, cystatin SN; CD44, cluster of differentiation 44; EEF1A2, eukaryotic translation elongation factor 1α2; AKT2, AKT serine/threonine kinase 2; XIST, X-inactive specific transcript; lnCRNA, long non-coding RNA; F, forward; R, reverse.

Construction of DEmRNA-DElncRNA co-expression network

A DElncRNA-DEmRNA co-expression network was constructed to explore the association between the RNAs. Pearson's correlation coefficient (PCC) was calculated between DElncRNAs and DEmRNAs according to corresponding expression levels. The criteria of |PCC| ≥0.90 was used to determine DElncRNA-DEmRNA pairs for network construction. The DElncRNA-DEmRNA network was constructed using Cytoscape 3.5.1 (http://cytoscape.org/).

Statistical analysis

The results of the qPCR were presented using Graph Pad Prism (version 6.0; GraphPad Software, Inc., La Jolla, CA, USA). Data are presented as the mean ± standard error of the mean. The independent samples t-test was performed for data comparison. P<0.05 was considered to indicate a statistically significant difference.

Results

Identification of DEmRNAs

According to microarray analysis, 32,206 mRNAs were detected in two pairs of cells, including 2,190 DEmRNAs (503 upregulated and 1,687 downregulated), which were significantly differentially expressed with a fold-change of ≥2.0. In addition, the DEmRNAs were divided into two sets: Set A contained all DEmRNAs from cell pair DLD1/A2 vs. DLD1/C6, and set B contained all DEmRNAs from DLD1/SA4 vs. DLD1/CA6. Heat map representation showed the top 100 differentially DEmRNAs (Fig. 1).

RT-qPCR validation of DEmRNAs

To validate the results of microarray analysis, RT-qPCR was performed in ATP5J and four randomly selected mRNAs. As shown in Fig. 2, cytotoxic and regulatory T cell molecule and cystatin SN were downregulated in DLD1/A2 vs. DLD1/C6 and upregulated in DLD1/SA4 vs. DLD1/CA6, while opposite results were obtained for ATP5J, cluster of differentiation 44 and eukaryotic translation elongation factor 1α2. The PCR results were basically concurrent with the microarray data.

Functional and pathway enrichment analysis

In order to investigate potential gene and gene products, GO functional and KEGG pathway enrichment analyses were performed for sets A and B, respectively. The DEmRNAs from set A were mainly enriched in biological processes associated with 'positive regulation of gene expression', 'cell-cell signaling' and 'regulation of cell growth'. The 10 most significantly enriched GO terms for DEmRNAs from sets A and B are shown in Fig. 3A and C, while the 10 most significantly enriched KEGG pathways in sets A and B are presented in Fig. 3B and D.

PPI network analysis

By submitting all DEmRNAs from sets A and B into STRING, the PPI network was obtained (data not shown). Next, the MCODE plug-in was used to analyze the results of STRING in Cytoscape software. The 3 most significant modules were acquired; the functions were mainly associated with 'cytokine-cytokine receptor interaction', 'ubiquitin-mediated proteolysis' and 'cell adhesion molecules (CAMs)' (Fig. 4). Moreover, a total of 20 genes were considered as hub genes (Table II), among which AKT serine/threonine kinase 2 (AKT2) obtained the highest value for neighborhood connectivity, outdegree and closeness centrality. This meant that AKT2 was the most important gene within the PPI network and represented the closest connection with other genes in the module (13).

Table II

Hub genes from Molecular Complex Detection analysis.

Table II

Hub genes from Molecular Complex Detection analysis.

Gene symbolNeighborhood connectivityOutdegreeCloseness centrality
MTNR1A42.2012 3.23×10−1
SPSB130.658 2.93×10−1
CCKBR47.258 2.94×10−1
AKT2a57.5034 3.54×10−1
GPX316.1815 2.62×10−1
PTPN641.7131 3.38×10−1
CLIC317.205 2.28×10−1
TNFRSF1910.006 2.56×10−1
IFT8045.832 2.03×10−1
AMHR234.691 2.93×10−1
MAMLD141.008 2.96×10−1
DHRSX30.633 1.93×10−1
SLC47A15.0011.00
SLC30A43.7500.00
CYBRD119.3311.00
INTS614.6700.00
CLDN79.504 2.04×10−1
TNFSF1256.679 2.93×10−1
DGKA21.503 3.13×10−1
HOMER227.132 2.49×10−1

a Gene showing the closest connection with other genes.

Co-expression network of DEmRNA-DElncRNA

Based on microarray analysis, 39,304 lncRNAs were detected. A total of 3,002 DElncRNAs (2,319 in DLD1/A2 vs. DLD1/C6; 683 in DLD1/SA4 vs. DLD1/CA6) were significantly differentially expressed with a fold-change of ≥2.0. For further analysis, DElncRNAs upregulated in DLD1/A2 vs. DLD1/C6 and downregulated in DLD1/SA4 vs. DLD1/CA6 were selected, which meant that the expression of DElncRNAs was positively associated with the expression of ATP5J in the two cell pairs. The DElncRNAs that were negatively associated with ATP5J in the two cell pairs were also included. Certain DEmRNAs were selected according to the aforementioned criteria. Therefore, 51 DEmRNAs and 30 DElncRNAs were identified and listed in Tables III and IV.

Table III

Selected differentially expressed mRNAs for co-expression network construction (n=51).

Table III

Selected differentially expressed mRNAs for co-expression network construction (n=51).

Ensemble IDGene symbolLog2FC (A2 vs. C6)log2FC (SA4 vs. CA6)
Upregulation
 ENST00000463422ATOH82.3664742−1.5749975
 ENST00000308108CCNE21.0017490−1.0507374
 ENST00000278385CD443.8303200−3.9564400
 ENST00000298912CLMN1.2790971−1.2013025
 ENST00000329882CSH11.2013025−2.2145548
 ENST00000249749DLL41.4630564−1.3910798
 ENST00000217182EEF1A23.5102847−2.7776937
 ENST00000371021FRAT11.1014051−1.1662812
 ENST00000435292GUCA1B1.7285424−1.9108304
 ENST00000377791 HIST1H2AC1.0301589−2.0924091
 ENST00000330062IDH21.3220385−2.0191135
 ENST00000518982IL71.3051137−1.8685079
 ENST00000268638IRF81.8297353−2.0302430
 ENST00000378111KCNAB21.1377705−1.4946451
 ENST00000394683 KIAA11991.0515032−1.0550995
 ENST00000420981 MGC393721.2202988−1.6457891
 ENST00000396217MYRIP1.9900737−1.2685270
 ENST00000277541NOTCH12.4109862−1.5415106
 ENST00000276124POF1B1.1683197−3.3742200
 ENST00000313755PRODH1.1842122−1.4703089
 ENST00000341901SBK11.1663734−1.3532438
 ENST00000247182SIX11.7563076−1.2851509
 ENST00000393062SPIRE21.3516588−1.1577921
 ENST00000328526XKRX1.1844625−1.1355352
Downregulation
 ENST00000376726ACSS1−1.42645631.0032806
 ENST00000374111 C10orf53−3.04941992.7619016
 ENST00000397899C2orf55−1.04067281.8891068
 ENST00000492730C4BPB−1.81779811.7743891
 ENST00000509979C5orf13−4.46110872.1796174
 ENST00000503763CRHBP−2.48694041.2709899
 ENST00000227348CRTAM−2.10765432.4206290
 ENST00000450719CSHL1−1.24762451.3876114
 ENST00000398402CST1−1.76637363.7468631
 ENST00000304725CST2−3.12945754.1763420
 ENST00000292414CYP3A7−1.50099232.0561150
 ENST00000317811FJX1−1.10501191.2775639
 ENST00000310357GPRC6A−1.33999302.4899235
 ENST00000393584GSTA5−1.73830621.0165440
 ENST00000309446KLF7−1.58191201.1883107
 ENST00000375827LY6G6D−1.18855482.3284416
 ENST00000427231NEB−2.47037221.1157570
 ENST00000319792PVRL3−4.11476762.2300897
 ENST00000216392PYGL−3.47740671.2769729
 ENST00000405158SAA1−3.25507861.6204370
 ENST00000414546SAA2−1.48487271.1160498
 ENST00000051659SCML1−2.63394361.5956994
 ENST00000486749SLC2A3−2.81747081.1550741
 ENST00000358525SLC6A20−1.22441661.4633511
 ENST00000338380SLPI−1.97165223.2052798
 ENST00000394511UGT8−4.23159201.8874178

[i] FC, fold-change.

Table IV

Selected differentially expressed long non-coding RNAs for co-expression network construction (n=30).

Table IV

Selected differentially expressed long non-coding RNAs for co-expression network construction (n=30).

Ensemble gene IDGene symbollog2FC (A2 vs. C6)log2FC (SA4 vs. CA6)
Upregulation
 ENSG00000026508CD445.7112436−4.6520596
 ENSG00000248690 HAS2-AS11.5613460−1.3604736
 ENSG00000104432IL71.2327710−2.0651786
 ENSG00000242887IGHJ31.1636353−1.1661916
 ENSG00000227372 TP73-AS11.1705691−1.1062335
 ENSG00000237807 RP11-400K9.41.0098063−1.4481292
 ENSG00000227357 HLA-DRB41.0012778−1.1985005
 ENSG00000212999 AC117834.11.2642217−1.2010332
 ENSG00000170011MYRIP1.9657596−1.1791620
 ENSG00000174562KLK151.7544044−1.0959578
 ENSG00000140968IRF82.0519360−1.8488283
Downregulation
 ENSG00000100181TPTEP1−1.15477851.0562963
 ENSG00000256124 RP11-84E24.3−1.09878111.4957023
 ENSG00000255071 SAA2-SAA4−2.93030021.6360683
 ENSG00000080823MOK−1.21338371.0177355
 ENSG00000253668 RP11-463C14.1−3.70305352.1768303
 ENSG00000151612ZNF827−1.93097111.2170410
 ENSG00000225383SFTA1P−1.13556291.3586316
 ENSG00000229791 LINC00420−1.65852931.3905687
 ENSG00000236654 AC079780.3−4.64696801.8889217
 ENSG00000254148 RP11-84E24.2−2.13624431.6749586
 ENSG00000102098SCML2−1.34234051.0036592
 ENSG00000229807XIST−2.47719001.0491910
 ENSG00000173432SAA1−1.91629211.2718056
 ENSG00000212232SNORD17−1.27171611.0156708
 ENSG00000206402LY6G6D−1.52642712.9315690
 ENSG00000071575TRIB2−1.38523541.0461107
 ENSG00000138735PDE5A−1.55258751.1479750
 ENSG00000183531 Z98256.1−2.95385602.0470590
 ENSG00000174607UGT8−3.38679342.0097785

[i] FC, fold-change.

To further investigate the potential association between DEmRNAs and DElncRNAs, PCC was calculated according to the expression levels of 51 DEmRNAs and 30 DElncRNAs. Using |PCC| ≥0.90, 343 DEmRNA/DElncRNA pairs were used to construct the co-expression network, including 239 pairs exhibiting positive correlation. The network is shown in Fig. 5. The pair of premature ovarian failure 1B (POF1B) and ENSG00000236654 presented the most significant positive correlation coefficiency, while the most marked negative correlation coefficiency was found in the pair of glycogen phosphorylase L and ENSG00000170011. One DElncRNA may target multiple DEmRNAs; for example, XIST was associated with POF1B, chorionic somatomammotropin hormone 1 (CSH1) and calmin (CLMN), leading to multiple signaling pathways or mechanisms.

RT-qPCR validation of hub genes and DElncRNA

RT-qPCR was used to validate AKT2 and XIST. As shown in Fig. 6, AKT2 and XIST were downregulated in DLD1/A2 vs. DLD1/C6 (P<0.01) and upregulated in DLD1/SA4 vs. DLD1/CA6 (P<0.05). In general, the validation results were consistent with the microarray data.

Discussion

ATP5J has been associated with several cancer types, including diffuse large B-cell lymphoma renal carcinoma and hepatocellular carcinoma (10,11,14). Furthermore, our previous study confirmed that ATP5J is associated with CRC cell migration and 5-fluorouracil resistance. The present study further investigated the molecular mechanism and potential key genes interacting with ATP5J in CRC via microarray and bioinformatics analyses.

The mRNAs from set A, which were differentially expressed in the upregulation of ATP5J, were mainly enriched in the GO terms of 'extracellular matrix organization', 'cell adhesion', 'positive regulation of gene expression' and 'regulation of cell growth'. These biological processes are essential for tumor cell survival and growth. Emerging data have confirmed the crucial role of the extracellular matrix in tumor metastasis (15,16). Changes in the content of the extracellular matrix may influence tumor cell properties, including proliferation and motility (17). Moreover, the primary enriched GO terms of set B contained enzyme regulation ('regulation of transcription from RNA polymerase II promoter') and biological responses ('immune response' and 'inflammatory response'). It is widely accepted that a causal association exists between inflammation, immunity and cancer (18). Human immunity responses, such as immune surveillance, are part of an innate and efficient antineoplastic system. Therefore, it could be concluded that the upregulation of ATP5J may affect cell migration and 5-FU sensitivity by influencing the biological processes of the intracellular and extracellular environment, thus promoting cell growth; its downregulation may operate by regulating immune and inflammatory responses. The KEGG pathways of set A were enriched primarily in tumor-related processes, including the phosphoinositide 3-kinase-protein kinase B signaling pathway, the tumor necrosis factor (TNF) signaling pathway and the Janus kinase-signal transducer and activator of transcription signaling pathway (19,20).

According to PPI network analysis, several biomarkers were identified. Some of these genes are associated with CRC biological behavior, including AKT2, TNF receptor superfamily member 19, claudin 7, cholecystokinin B receptor, glutathione peroxidase 3 and homer scaffolding protein 2. AKT2, one of the most significantly meaningful genes, has been shown to be essential in several cellular pathways involved in cell proliferation, metastasis and drug resistance (21). Overexpression of AKT2 has been detected in breast, ovarian and colon cancer (22,23). Previous studies have investigated the role of AKT2 in CRC via the construction of cell and animal models. The results showed that AKT2 deficiency may decrease the metastatic ability of CRC cells in mice (24). In addition, an shRNA-mediated AKT2-knockdown system has been shown to decrease cell survival and proliferation in primary tumors (25). Furthermore, low AKT2 expression in HCT116 cells has been shown to be correlated with increased chemosensitivity to paclitaxel (26). Taken together, the regulation of AKT2 may be a critical process for ATP5J exerting an effect on CRC cell biological functions.

Numerous studies have confirmed the association between lncRNAs and tumors. Previous studies have indicated that lncRNAs could have an important regulatory role in gene expression and are associated with cancer development (27). In the present study, microarray analysis was performed for lncRNAs. From the lncRNA expression profiles, DElncRNAs meeting the criteria were selected for further analysis. According to the results, TP73-AS1, HAS2-AS1, SFTA1P and XIST were highlighted and have been previously associated with the development and progression of certain cancer types, including hepatocellular carcinoma and oral squamous cell carcinoma (2830). Among them, XIST was the only lncRNA that has been previously investigated in CRC (31). XIST, located in the X chromosome, was one of the first lncRNAs to be found that was involved in the progression of cancer, including non-small cell lung cancer and human glioblastoma (32,33). Certain studies have found the mechanism of XIST in several cancer types; for example, the lncRNA XIST has been shown to promote the malignancy of esophageal squamous cell carcinoma through the modulation of miR-101/enhancer of zeste homolog 2 (34). In addition, by regulating miR-186-5p, XIST controls cell proliferation and invasion in non-small cell lung cancer (35). Moreover, significantly high XIST expression has been found in CRC tumor tissues compared with that in paired adjacent normal tissues (36). High-level expression of XIST could predict poor disease-free survival times in CRC patients. Moreover, XIST is considered to be an oncogene that could promote cell proliferation through the miR-132-3p/mitogen-activated protein kinase 1 axis (31).

To further elucidate the potential functions of lncRNAs and find out their target genes in the cell pairs of the present study, a co-expression network of DEmRNA/DElncRNA was constructed. XIST was associated with 3 mRNAs (POF1B, CSH1 and CLMN). The gene encoding POF1B was critical for ovarian function (37). However, its impact was also confirmed in the regulation of cell adhesion in human intestinal cell lines (38). CLMN has been shown to regulate the cell cycle in a report involving neuroblastoma cells (39). Therefore, we hypothesized that the co-repression of XIST and POF1B and CLMN was involved in the molecular mechanisms of ATP5J in CRC cells, which will be confirmed by further cell line experiments in future studies.

In conclusion, the present study determined the expression profiles of mRNAs and lncRNAs in CRC cells overexpressing/underexpressing ATP5J. According to bioinformatics analyses, AKT2 and XIST expression was identified as a potential biomarker participating in the effect of ATP5J in CRC, which in turn was associated with cell migration and 5-FU resistance. Further research is necessary to confirm this hypothesis.

Acknowledgments

This study represents partial fulfillment of the requirements for a Master degree for Dr Bingjun Bai.

Notes

[1] Funding

This study was supported by the National Natural Science Foundation of China (grant no. 81272681) and the Medical and Health Science and Technology Foundation of Zhejiang Province (grant no. 2017 KY593).

[2] Availability of data and materials

The datasets analyzed during the current study are not publicly available as they will be used in our further studies, but they are available from the corresponding author on reasonable request.

[3] Authors' contributions

Guarantor of integrity of entire study: BJB, BBX, ZYP and HBZ. Study concepts: BJB, BBX, ZYP and HBZ. Study design: BJB, BBX, ZYP and HBZ. Data acquisition: LNS and ZJP. Data analysis/interpretation: LNS and ZJP. Statistical analysis: BJB, BBX, ZYP and HBZ. Manuscript preparation: LNS and ZJP. Manuscript revision/review: BJB, BBX, ZYP and HBZ. Manuscript final version approval: BJB, BBX, ZYP and HBZ.

[4] Ethics approval and consent to participate

Not applicable.

[5] Consent for publication

Not applicable.

[6] Conflicts of interest

All authors listed in the manuscript agree on the content of the and this submission. The authors declare no conflict of interest.

References

1 

Chau I and Cunningham D: Chemotherapy in colorectal cancer: New options and new challenges. Br Med Bull. 64:159–180. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Shao YC, Chang YY, Lin JK, Lin CC, Wang HS, Yang SH, Jiang JK, Lan YT, Lin TC, Li AF, et al: Neoadjuvant chemotherapy can improve outcome of colorectal cancer patients with unresectable metastasis. Int J Colorectal Dis. 28:1359–1365. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Liu HY and Zhang CJ: Identification of differentially expressed genes and their upstream regulators in colorectal cancer. Cancer Gene Ther. 24:244–250. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Pedersen PL: Bioenergetics of cancer cells - A brief orientation to this minireview series. J Bioenerg Biomembr. 29:301–302. 1997. View Article : Google Scholar

5 

Cuezva JM, Krajewska M, de Heredia ML, Krajewski S, Santamaría G, Kim H, Zapata JM, Marusawa H, Chamorro M and Reed JC: The bioenergetic signature of cancer: A marker of tumor progression. Cancer Res. 62:6674–6681. 2002.PubMed/NCBI

6 

Shin YK, Yoo BC, Chang HJ, Jeon E, Hong SH, Jung MS, Lim SJ and Park JG: Down-regulation of mitochondrial F1F0-ATP synthase in human colon cancer cells with induced 5-fluorouracil resistance. Cancer Res. 65:3162–3170. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Collinson IR, van Raaij MJ, Runswick MJ, Fearnley IM, Skehel JM, Orriss GL, Miroux B and Walker JE: ATP synthase from bovine heart mitochondria. In vitro assembly of a stalk complex in the presence of F1-ATPase and in its absence. J Mol Biol. 242:408–421. 1994.PubMed/NCBI

8 

Joshi S and Pringle MJ: ATP synthase complex from bovine heart mitochondria. Passive H+ conduction through mitochondrial coupling factor 6-depleted F0 complexes. J Biol Chem. 264:15548–15551. 1989.PubMed/NCBI

9 

Zhu H, Chen L, Zhou W, Huang Z, Hu J, Dai S, Wang X, Huang X and He C: Over-expression of the ATP5J gene correlates with cell migration and 5-fluorouracil sensitivity in colorectal cancer. PLoS One. 8:e768462013. View Article : Google Scholar : PubMed/NCBI

10 

Yang W, Lu Y, Xu Y, Xu L, Zheng W, Wu Y, Li L and Shen P: Estrogen represses hepatocellular carcinoma (HCC) growth via inhibiting alternative activation of tumor-associated macrophages (TAMs). J Biol Chem. 287:40140–40149. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Bjerregaard H, Pedersen S, Kristensen SR and Marcussen N: Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma. Diagn Mol Pathol. 20:212–217. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

13 

Carson MB and Lu H: Network-based prediction and knowledge mining of disease genes. BMC Med Genomics. 8(Suppl 2): S92015. View Article : Google Scholar : PubMed/NCBI

14 

Zamani-Ahmadmahmudi M, Najafi A and Nassiri SM: Reconstruction of canine diffuse large B-cell lymphoma gene regulatory network: Detection of functional modules and hub genes. J Comp Pathol. 152:119–130. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Lu P, Weaver VM and Werb Z: The extracellular matrix: A dynamic niche in cancer progression. J Cell Biol. 196:395–406. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Hynes RO: The extracellular matrix: Not just pretty fibrils. Science. 326:1216–1219. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Gilkes DM, Semenza GL and Wirtz D: Hypoxia and the extracellular matrix: Drivers of tumour metastasis. Nat Rev Cancer. 14:430–439. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Coussens LM and Werb Z: Inflammation and cancer. Nature. 420:860–867. 2002. View Article : Google Scholar : PubMed/NCBI

19 

Martini M, De Santis MC, Braccini L, Gulluni F and Hirsch E: PI3K/AKT signaling pathway and cancer: An updated review. Ann Med. 46:372–383. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Groner B and von Manstein V: Jak Stat signaling and cancer: Opportunities, benefits and side effects of targeted inhibition. Mol Cell Endocrinol. 451:1–14. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Cheung M and Testa JR: Diverse mechanisms of AKT pathway activation in human malignancy. Curr Cancer Drug Targets. 13:234–244. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Agarwal E, Brattain MG and Chowdhury S: Cell survival and metastasis regulation by Akt signaling in colorectal cancer. Cell Signal. 25:1711–1719. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Chau NM and Ashcroft M: Akt2: A role in breast cancer metastasis. Breast Cancer Res. 6:55–57. 2004. View Article : Google Scholar :

24 

Rychahou PG, Kang J, Gulhati P, Doan HQ, Chen LA, Xiao SY, Chung DH and Evers BM: Akt2 overexpression plays a critical role in the establishment of colorectal cancer metastasis. Proc Natl Acad Sci USA. 105:20315–20320. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Agarwal E, Robb CM, Smith LM, Brattain MG, Wang J, Black JD and Chowdhury S: Role of Akt2 in regulation of metastasis suppressor 1 expression and colorectal cancer metastasis. Oncogene. 36:3104–3118. 2017. View Article : Google Scholar : PubMed/NCBI

26 

Ding Z, Xu F, Li G, Tang J, Tang Z, Jiang P and Wu H: Knockdown of Akt2 expression by shRNA inhibits proliferation, enhances apoptosis, and increases chemosensitivity to paclitaxel in human colorectal cancer cells. Cell Biochem Biophys. 71:383–388. 2015. View Article : Google Scholar

27 

Prensner JR and Chinnaiyan AM: The emergence of lncRNAs in cancer biology. Cancer Discov. 1:391–407. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Li S, Huang Y, Huang Y, Fu Y, Tang D, Kang R, Zhou R and Fan XG: The long non-coding RNA TP73-AS1 modulates HCC cell proliferation through miR-200a-dependent HMGB1/RAGE regulation. J Exp Clin Cancer Res. 36:512017. View Article : Google Scholar : PubMed/NCBI

29 

Zhu G, Wang S, Chen J, Wang Z, Liang X, Wang X, Jiang J, Lang J and Li L: Long noncoding RNA HAS2-AS1 mediates hypoxia-induced invasiveness of oral squamous cell carcinoma. Mol Carcinog. 56:2210–2222. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Zhang H, Xiong Y, Xia R, Wei C, Shi X and Nie F: The pseudogene-derived long noncoding RNA SFTA1P is downregulated and suppresses cell migration and invasion in lung adenocarcinoma. Tumour Biol. 39:10104283176914182017.

31 

Song H, He P, Shao T, Li Y, Li J and Zhang Y: Long non-coding RNA XIST functions as an oncogene in human colorectal cancer by targeting miR-132-3p. J BUON. 22:696–703. 2017.PubMed/NCBI

32 

Fang J, Sun CC and Gong C: Long noncoding RNA XIST acts as an oncogene in non-small cell lung cancer by epigenetically repressing KLF2 expression. Biochem Biophys Res Commun. 478:811–817. 2016. View Article : Google Scholar : PubMed/NCBI

33 

Yao Y, Ma J, Xue Y, Wang P, Li Z, Liu J, Chen L, Xi Z, Teng H, Wang Z, et al: Knockdown of long non-coding RNA XIST exerts tumor-suppressive functions in human glioblastoma stem cells by up-regulating miR-152. Cancer Lett. 359:75–86. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Wu X, Dinglin X, Wang X, Luo W, Shen Q, Li Y, Gu L, Zhou Q, Zhu H, Li Y, et al: Long noncoding RNA XIST promotes malignancies of esophageal squamous cell carcinoma via regulation of miR-101/EZH2. Oncotarget. 8:76015–76028. 2017.PubMed/NCBI

35 

Wang H, Shen Q, Zhang X, Yang C, Cui S, Sun Y, Wang L, Fan X and Xu S: The long non-coding RNA XIST controls non-small cell lung cancer proliferation and invasion by modulating miR-186-5p. Cell Physiol Biochem. 41:2221–2229. 2017. View Article : Google Scholar : PubMed/NCBI

36 

Kara M, Yumrutas O, Ozcan O, Celik OI, Bozgeyik E, Bozgeyik I and Tasdemir S: Differential expressions of cancer-associated genes and their regulatory miRNAs in colorectal carcinoma. Gene. 567:81–86. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Bione S, Rizzolio F, Sala C, Ricotti R, Goegan M, Manzini MC, Battaglia R, Marozzi A, Vegetti W, Dalprà L, et al: Mutation analysis of two candidate genes for premature ovarian failure, DACH2 and POF1B. Hum Reprod. 19:2759–2766. 2004. View Article : Google Scholar : PubMed/NCBI

38 

Crespi A, Bertoni A, Ferrari I, Padovano V, Della Mina P, Berti E, Villa A and Pietrini G: POF1B localizes to desmosomes and regulates cell adhesion in human intestinal and keratinocyte cell lines. J Invest Dermatol. 135:192–201. 2015. View Article : Google Scholar

39 

Marzinke MA and Clagett-Dame M: The all-trans retinoic acid (atRA)-regulated gene Calmin (Clmn) regulates cell cycle exit and neurite outgrowth in murine neuroblastoma (Neuro2a) cells. Exp Cell Res. 318:85–93. 2012. View Article : Google Scholar

Related Articles

Journal Cover

April-2018
Volume 52 Issue 4

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Bai B, Xie B, Pan Z, Shan L, Zhao J and Zhu H: Identification of candidate genes and long non-coding RNAs associated with the effect of ATP5J in colorectal cancer. Int J Oncol 52: 1129-1138, 2018.
APA
Bai, B., Xie, B., Pan, Z., Shan, L., Zhao, J., & Zhu, H. (2018). Identification of candidate genes and long non-coding RNAs associated with the effect of ATP5J in colorectal cancer. International Journal of Oncology, 52, 1129-1138. https://doi.org/10.3892/ijo.2018.4281
MLA
Bai, B., Xie, B., Pan, Z., Shan, L., Zhao, J., Zhu, H."Identification of candidate genes and long non-coding RNAs associated with the effect of ATP5J in colorectal cancer". International Journal of Oncology 52.4 (2018): 1129-1138.
Chicago
Bai, B., Xie, B., Pan, Z., Shan, L., Zhao, J., Zhu, H."Identification of candidate genes and long non-coding RNAs associated with the effect of ATP5J in colorectal cancer". International Journal of Oncology 52, no. 4 (2018): 1129-1138. https://doi.org/10.3892/ijo.2018.4281