HBV suppresses thapsigargin‑induced apoptosis via inhibiting CHOP expression in hepatocellular carcinoma cells

Corrigendum in: /10.3892/ol.2017.7243

  • Authors:
    • Danqi Zhao
    • Yan Liu
    • Xing Liu
    • Tao Li
    • Zhenhui Xin
    • Xilin Zhu
    • Xiaopan Wu
    • Ying Liu
  • View Affiliations

  • Published online on: July 25, 2017     https://doi.org/10.3892/ol.2017.6666
  • Pages: 4403-4409
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Hepatocellular carcinoma (HCC) accounts for a proportion of cancer‑associated mortalities worldwide. Hepatitis B virus (HBV) infection is a major cause of HCC in China. Thapsigargin (TG) is a potential antitumor prodrug, eliciting endoplasmic reticulum (ER) stress via the inhibition of the ER calcium pump, effectively inducing apoptosis. The present study therefore examined the role of HBV in TG‑induced apoptosis using two HCC cell lines, HBV positive HepG2.2.15 and HBV negative HepG2. When these two cell lines were treated with TG, HepG2.2.15 was less susceptible to apoptosis than HepG2. This phenomenon was confirmed by an MTT assay and Annexin V‑FITC/propidium iodide staining. Reverse transcription quantitative polymerase chain reaction and western blotting were used to detect the expression levels of genes in the ER stress pathway subsequent to treatment with TG. Notably, the mRNA and protein levels of the apoptosis factor DNA damage inducible transcript 3 (CHOP) increased significantly in the HepG2 cells compared with the HepG2.2.15 cells. Additionally, the HepG2.2.15 cells treated with interferon‑α exhibited higher levels of CHOP compared with the untreated cells. The overexpression or knockdown of CHOP microRNA in HepG2.2.15 or HepG2 cells may reduce the difference in apoptosis status between the two cell lines. These results suggest that HBV may inhibit the apoptosis induced by ER stress. These findings may be useful in the development of selective therapies for patients with HBV‑positive tumors.

Introduction

Thapsigargin (TG) is a natural product isolated from the seeds of Thapsia garganica L, which binds tightly to and inhibits the function of the transmembrane portion of the sarcoplasmic/endoplasmic reticulum calcium adenosine triphosphatase pump, inducing apoptosis (1,2). TG initiates endoplasmic reticulum (ER) stress via the unfolded protein response (UPR), which is initiated by 3 ER transmembrane proteins termed protein kinase-like endoplasmic reticulum kinase (PERK), inositol-requiring enzyme 1 (IRE1) and activating transcription factor (ATF) 6 (3,4). An abnormality of this network affects the progression of various types of cancer, such as breast cancer, pancreatic adenocarcinoma and melanoma (3,5).

A TG prodrug that is activated in the vasculature of solid tumors by tumor endothelial cells has been developed (6). It is highly selective to tumor endothelial cells, and the drug toxicity level is expected to be low. This TG prodrug is useful in the majority of types of solid tumors with prostate-specific membrane antigen expression, including hepatocellular carcinoma (HCC) (7). Several factors contribute to HCC, such as chronic hepatitis B infection, excessive alcohol consumption and other chronic hepatic damage (8). These factors may cause oxidative stress, inflammation and mutation, which transform hepatic cells into HCC cells by inducing ER stress (911). In China, numerous patients with HCC are hepatitis B virus (HBV) carriers (12). HBV infection causes massive viral replication and produces a large number of viral proteins in a short period of time, which results in the disturbance of ER homeostasis and therefore protein misfolding. The accumulation of unfolded or misfolded proteins leads to ER stress, followed by UPR (13). However, only a limited number of studies have investigated the effect of HBV on UPR gene expression and apoptosis (14,15). The present study used two cell lines, HepG2 and HepG2.2.15, which are HBV negative and positive, respectively, to study whether HBV affects apoptosis during ER stress induced by TG.

Materials and methods

Cell culture, reagents and antibodies

The HepG2 cells were purchased from the Chinese Academy of Medical Sciences Cell Culture Center (Beijing, China) and the HepG2.2.15 cells were purchased from China Center for Type Culture Collection (Wuhan, China). The cells were cultured in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific Inc., Waltham, MA, USA) with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.). The cell lines were maintained in an atmosphere with 5% CO2 and saturated humidity at 37°C. Images of the cells were captured using a CKX41 microscope (Olympus Corporation, Tokyo, Japan) at a magnification of ×100 using the TopTek ToupView version 3.7 (OPTEC, Chongqing, China). TG was obtained from Sigma-Aldrich; Merck Millipore (Darmstadt, Germany; cat. no., 586005-1MG), dissolved in dimethylsulfoxide (DMSO; Amresco, LLC., Solon, OH, USA) and used at a dilution of 500 nM.

A total of 200 units/well recombinant human interferon (IFN)α-2A (Fangcheng BioTech Co Ltd; Beijing, China; cat. no., CYT-204) was added 6 h prior to TG treatment. MTT was purchased from Sigma-Aldrich; Merck Millipore (cat no. M2128) and was used at a concentration of 5 mg/ml. PBS was purchased from Tianjin TBD Haoyang BioTech Co Ltd (Tianjin, China; cat. no., PB2004Y). A eukaryotic DNA damage inducible transcript 3 (CHOP) expression plasmid encoding the full-length CHOP protein was purchased from Tianyi Huiyuan Biotechnology Co., (Wuhan, China). Small interfering RNA (siRNA) for the CHOP protein was purchased from Guangzhou RiboBio Co., Ltd., (Guangzhou, China). Lipofectamine 2000 was purchased from Invitrogen; Thermo Fisher Scientific, Inc., (cat. no., 1609073). The Ultrapure RNA (cat. no., CW0581), Protein Extraction (cat. no., cw0889), SYBR Green polymerase chain reaction (PCR; cat. no., CW2601), Annexin V-FITC/PI Apoptosis Detection (cat. no., CW2574) and Cell Cycle and Apoptosis Detection (cat. no., CW2575) kits were purchased from CWBio (Beijing, China). The ReverTra Ace reverse transcription quantitative (RT-q)PCR Master Mix was purchased from Toyobo Co., Ltd. (Osaka, Japan; cat. no., FSQ-201). Antibodies against CHOP (polyclonal rabbit, cat. no., sc-575) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; polyclonal rabbit, cat. no., CW0101) were purchased from Santa Cruz Biotechnology, Inc., (Santa Cruz; Dallas, TX, USA) and CWBIO (Beijing, China), respectively. Horseradish peroxidase conjugated goat anti rabbit IgG was purchased from CWBio (cat. no., CW103A).

MTT assay

The HepG2 or HepG2.2.15 cells were seeded at a density of 5×103 cells/well in 96-well plates. The cells were treated with TG for 24, 48, 72 and 96 h and cells treated with PBS were used as controls. Subsequent to the end of each time point, the cells were incubated with 10 µl MTT for 4 h at 37°C in the dark. The supernatant was removed and 100 µl DMSO was used for dissolution. A Synergy H1 microplate reader (BioTek; Winooski, VT, USA) was used to measure absorbance at 490 nm. All experiments were performed in triplicate and repeated 3 times.

Flow cytometry assay

A flow cytometry assay was used to investigate the level of apoptosis and the cell cycle of the HepG2 and HepG2.2.15 cells. The HepG2 cells were divided into 2 groups. The cells in the first group were treated with TG for 24, 48, 72 and 96 h. The untreated cells in the second group were used as controls. The HepG2.2.15 cells were divided into 3 groups. The cells in the first group were treated with IFNα-2A for 6 h and incubated with TG for 24, 48, 72 and 96 h at 37°C. The cells in the second group were treated with TG for 24, 48, 72 and 96 h directly. The untreated cells in the third group were used as controls. For the apoptosis assays, the cells were incubated with propidium iodide (PI) and Annexin V-FITC at 24°C for 15 min according to the protocol of the Annexin V-FITC/PI Apoptosis Detection kit. For the cell cycle assays, the collected cells were treated according to the protocol provided with the Cell Cycle and Apoptosis Detection kit. Apoptosis and cell cycle were quantified and analyzed using the Accuri C6 flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).

Quantitative analysis of gene expression

The HepG2 cells were seeded in 24-well plates at a density of 2×105/well for a RT qPCR analysis. Each well of HepG2 or HepG2.2.15 cells was incubated with 500 nM TG. The HepG2 or HepG2.2.15 cells were treated with TG for 24, 48, 72 and 96 h at 37°C. Untreated cells were used as controls. All treatments were performed in triplicate and repeated 3 times. The cells were collected at each time point and total RNA extraction was performed using the Ultrapure RNA kit according to the protocol of the manufacturer. Complementary DNA was synthesized in a 10 µl reaction volume using ReverTra Ace qPCR RT Master Mix following the protocol of the manufacturer. The mRNA expression levels of ATF6, ATF4, CHOP and protein phosphatase 1 regulatory subunit 15A (GADD34) were measured by a SYBR Green relative quantitative analysis using the Bio-Rad iQ5 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). GAPDH was used as an internal control. The primers and probes used for the qPCR are listed in Table I. The RT qPCR conditions were as follows: 95°C for 10 min, followed by 40 cycles of 92°C for 15 sec and 58°C for 1 min. The relative expression levels of genes were calculated by the 2−∆∆Ct method (16) and normalized by the level of the internal control. X-box protein 1 (XBP1) microRNA (mRNA) splicing was detected by RT qPCR as described previously (17). Theoretically, a 289 bp amplicon is generated from unspliced XBP1, XBP1u, while a 263 bp amplicon is generated from spliced XBP1, XBP1s (17).

Table I.

Primers used in the mRNA quantification.

Table I.

Primers used in the mRNA quantification.

Primers and probesSequence (5′-3′)
ATF6
  Forward primer of PCR CCCAAGACTCAAACAAACTC
  Reverse primer of PCR GTGATTAGGGAGCTGTGTGA
ATF4
  Forward primer of PCR GTGTGCGTTTTCCCTCCTC
  Reverse primer of PCR TGTCGGTTACAGCAACGCT
XBP1
  Forward primer of PCR TTACGAGAGAAAACTCATGGC
  Reverse primer of PCR GGGTCCAAGTTGTCCAGAATGC
CHOP
  Forward primer of PCR TCTAAGGCACTGAGCGTATC
  Reverse primer of PCR CAGTCTGGAAAAGCACATCT
GADD34
  Forward primer of PCR CCAGAAACCCCTACTCATG
  Reverse primer of PCR CAGGAAATGGACAGTGACC
GAPDH
  Forward primer of PCR TCTGACTTCAACAGCGACAC
  Reverse primer of PCR CAAATTCGTTGTCATACCAG
Overexpression or knockdown of CHOP

A total of 5×103 HepG2 or HepG2.2.15 cells were seeded in each well of a 96-well plate. The cells were transfected with 0.1 µg of CHOP expression plasmids or 50 nM siRNA with 0.2 µl Lipofectamine 2000. The cells transfected with only Lipofectamine 2000 were set as controls. A total of 6 h subsequent to transfection, 500 nM TG was added to the culture medium. The cells were then collected at 24, 48, 72 and 96 h for the MTT assay.

Western blotting

The proteins were extracted using the Mammalian Protein Extraction kit, separated by 10% SDS-PAGE, and transferred to a polyvinylidene fluoride membrane (cat. no., ISEQ00010; EMD Millipore, Billerica, MA, USA). Subsequent to blocking with 5% non-fat powdered milk, the membranes were incubated with antibodies against CHOP (dilution, 1:1,000) and GAPDH (dilution, 1:10,000) at 4°C overnight. The membranes were washed with TBS containing 0.1% Tween 20 and stained with the 1:10,000 IgG at 37°C for 1 h. Micrographs were captured using the Tanon 5200 Multi (Tanon Science and Technology Co., Ltd., Shanghai, China).

Statistical analysis

Spliced XBP1 mRNA as a percentage of the total XBP1 mRNA was estimated using ImageJ software 1.4r (National Institutes of Health, Bethesda, MD, USA). Statistical analyses were performed using SPSS v.15.0 (SPSS, Inc., Chicago, IL, USA) and all data were analyzed by a one-way analysis of variance from three independent experiments. P-values were determined using unpaired Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

HBV-positive HepG2.2.15 cells are less susceptible to apoptosis

HBV-positive HepG2.2.15 and HBV negative HepG2 cells were seeded in 24-well plates. Subsequent to 1 day, 500 nM TG or PBS was added to the experimental or control groups respectively. As demonstrated in Fig. 1, the HepG2 and HepG2.2.15 cells treated with PBS exhibited normal morphologies, with clear cell membrane boundaries and homogeneous cell cytoplasm densities, whilst the two cell types showed apoptosis when treated with TG. Notably, the HepG2 cells underwent more apoptosis than HepG2.2.15 cells, by morphological observation. Accordingly, it was hypothesized that HBV may alleviate the apoptosis induced by TG.

HBV may repress apoptosis induced by ER stress via the CHOP pathway

To determine whether HBV affects cell survival and apoptosis, the HepG2.2.15 and HepG2 cells were treated with 500 nM TG or PBS for 24, 48, 72 and 96 h and cell proliferation was detected using the MTT assay. As illustrated in Fig. 2, TG inhibited cell growth in a time-dependent manner, especially in the HepG2 cells, for which 64% cell growth was inhibited at 96 h compared with 45% in the HepG2.2.15 cells (P<0.001). Similarly, at 24, 48 and 72 h, greater inhibition was observed for the HepG2 cells than for HepG2.2.15 cells. These results indicated that HBV may alleviate the induction of apoptosis by TG.

Using annexin V/PI double staining, the effect of TG on apoptosis in the cells was then examined. Using flow cytometry, and demonstrated in Fig. 3A, it was revealed that TG increased the apoptotic populations of HepG2 cells more significantly (P<0.01) compared with the HepG2.2.15 cells, as illustrated in Fig. 3B. In addition, to confirm the role of HBV, the HepG2.2.15 cells were treated with IFNα-2A, an anti-HBV drug, and the aforementioned experiments were repeated. When the HepG2.2.15 cells were treated with IFNα-2A and TG the HBV load decreased and the apoptosis rate increased compared with the HepG2.2.15 cells treated with TG (P<0.05), as demonstrated in Fig. 3B. PI staining was used to detect the cell cycle, as demonstrated in Fig. 4A. TG reduced the proportion of G2 phase cells (P<0.05), as illustrated in Fig. 4B. In the HepG2 cells, there were significant sub-apoptosis peaks at 96 h, which indicated that HBV may induce apoptosis to a lesser degree. Based on the cell cycle experiment, the HepG2.2.15 cells treated with IFNα-2A and TG exhibited sub-apoptosis peaks at 96 h, similar to the HepG2 cells, as illustrated in Fig. 4B. However, no difference was observed in the results of the MTT experiment with respect to IFNα-2A treatment: The ratio of the HepG2.2.15 cells treated with TG and IFNα-2A to the cells treated with TG alone at each time point was between 0.99 and 1.03. These results demonstrated that a reduced HBV load in the HepG2.2.15 cells may increase apoptosis, or HBV may inhibit the apoptosis induced by TG.

To explore the mechanism underlying the associations between HBV, TG and apoptosis, the mRNA levels of 5 genes in 3 UPR pathways: The ATF6 gene in the ATF6 pathway; the XBP1 gene in the IRE1 pathway and the ATF4, CHOP and GADD34 genes in the PERK pathway, were examined. The ATF6, ATF4, CHOP and GADD34 genes were examined by qPCR, and XBP1 mRNA splicing was evaluated by RT-PCR. The results of these analyses are summarized in Fig. 5. The mRNA levels of CHOP, GADD34 and XBP1 increased significantly subsequent to TG treatment, as illustrated in Fig. 5A, and the mRNA levels of ATF6 and ATF4 exhibited increases, as demonstrated in Fig. 5B. According to this analysis, CHOP appeared to be the gene of greatest importance. Subsequent to TG treatment, the level of CHOP mRNA increased by 42- to 95-fold in the HepG2 cells, and 10- to 30-fold in the HepG2.2.15 cells. At each time point, the level of CHOP mRNA expression was significantly higher in the HepG2 cells compared with the HepG2.2.15 cells (P<0.001). When the HepG2.2.15 cells were treated with IFNα-2A and TG, the CHOP mRNA expression levels were 1.16 and 1.11-fold higher than the expression levels without IFNα-2A at 72 and 96 h (P<0.05). Western blotting also confirmed that the protein levels of CHOP were higher in the HepG2 cells than in the HepG2.2.15 cells at each time point subsequent to treatment with TG, as demonstrated in Fig. 6.

CHOP overexpression in HepG2.2.15 cells or knockdown in HepG2 cells affects proliferation

When CHOP was overexpressed in the HepG2.2.15 cells, the proliferation rate decreased by 6.5% at 24 h and 19.6% at 96 h, relative to the wild-type cells (P<0.01), whilst in contrast, CHOP knockdown in the HepG2 cells increased proliferation 8.1% at 24 h and 12.5% at 96 h (P<0.05), as demonstrated in Fig. 7.

Discussion

The results of the present study indicated that HBV may inhibit the apoptosis induced by ER stress via the repression of CHOP. CHOP is a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors (18), and functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members and preventing their DNA binding activity (19). CHOP is activated by ER stress, and promotes apoptosis. The activation of PERK increases the level of the phosphorylation of eukaryotic initiation factor 2 (eIF2), leading to an increase in the level of ATF4 translation. In turn, ATF4 induces the expression of CHOP (18). ATF4 and CHOP transactivate GADD34 (20), which selectively dephosphorylates eIF2α, completing a negative feedback loop and promoting the translation of other UPR genes. Whether CHOP promotes or inhibits oncogenesis is controversial. A previous study has revealed that pharmacological ER stresses that induce CHOP may kill cancer cells, including hepatomas, in vitro (21). However, in additional studies, CHOP appears to promote oncogenesis (22,23). In the present study, it was demonstrated that increased levels of CHOP expression may have promoted HCC cell apoptosis, as summarized in Figs. 27, suggesting an antitumor role of CHOP.

According to a previous study (13), HBV induces ER stress independently, but the regulatory mechanisms of HBV-infected cells may be activated to reduce ER stress. Previous studies have investigated the pathological effect of HBV surface protein expression on the liver. In the livers of BALB/c transgenic mice, the expression of the HBV surface protein activates the PERK pathway and results in the expression of CHOP, leading to more extensive liver injury and fibrosis compared with transgenic mice with the C57BL/6 background (24). In another study using hepatoma cells, HBV small surface proteins triggered UPR, activated the PERK pathway and induced the phosphorylation of eIF2α, which promotes the expression of CHOP (25). In TG treated HepG2.2.15 cells, the present study demonstrated that HBV reduces the expression of CHOP. This affects liver cancer cell apoptosis.

The present study contained a number of limitations. HepG2.2.15 cells were derived from HepG2 cells, and were stably transformed with 2 copies of the HBV genome (26). The culture medium of the HepG2.2.15 cells stably expressed HBV particles, hepatitis B surface antigen and Hepatitis B envelope antigen, but at low concentrations. Therefore, when the cells were treated with IFNα-2A, the antiviral effect was not measured due to the baseline HBV concentration being low. Additionally, these HBV markers are encoded by 2 copies of the HBV genome, stably transformed into the genomes, which is dissimilar to the natural progression of HBV infection in the human liver. Previously, the Na+-taurocholate cotransporting polypeptide (NTCP) was identified as a functional receptor for human HBV, a topic that requires attention (27). In future studies, HepG2 cells may be transfected with NTCP to increase the expression of HBV in the culture medium, simulating the natural history of HBV infection. In vivo studies should also be conducted to verify the role of HBV during ER stress.

In conclusion, the present study demonstrated that HBV may inhibit the cell apoptosis induced by ER stress, which is important for the development of ER stress based antitumor therapies for patients with HBV.

Acknowledgements

The present study was supported by grants from the National Basic Research Program of China (973 Program; grant nos., 2012CB519005 and 2013CB944903).

Glossary

Abbreviations

Abbreviations:

HBV

hepatitis B virus

HCC

hepatocellular carcinoma

ER

endoplasmic reticulum

UPR

unfolded protein response

TG

thapsigargin

PERK

protein kinase-like endoplasmic reticulum kinase

IRE1

inositol-requiring enzyme 1

ATF4

activating transcription factor 4

ATF6

activating transcription factor 6

CHOP

DNA damage inducible transcript 3

GADD34

protein phosphatase 1 regulatory subunit 15A

References

1 

Toyoshima C, Nomura H and Sugita Y: Crystal structures of Ca2+-ATPase in various physiological states. Ann N Y Acad Sci. 986:1–8. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Winther AM, Liu H, Sonntag Y, Olesen C, le Maire M, Soehoel H, Olsen CE, Christensen SB, Nissen P and Møller JV: Critical roles of hydrophobicity and orientation of side chains for inactivation of sarcoplasmic reticulum Ca2+-ATPase with thapsigargin and thapsigargin analogs. J Biol Chem. 285:28883–28892. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Rajapaksa G, Nikolos F, Bado I, Clarke R, Gustafsson JÅ and Thomas C: ERβ decreases breast cancer cell survival by regulating the IRE1/XBP-1 pathway. Oncogene. 34:4130–4141. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Senft D and Ronai ZA: UPR, autophagy, and mitochondria crosstalk underlies the ER stress response. Trends Biochem Sci. 40:141–148. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Romero-Ramirez L, Cao H, Regalado MP, Kambham N, Siemann D, Kim JJ, Le QT and Koong AC: X box-binding protein 1 regulates angiogenesis in human pancreatic adenocarcinomas. Transl Oncol. 2:31–38. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Denmeade SR, Mhaka AM, Rosen DM, Brennen WN, Dalrymple S, Dach I, Olesen C, Gurel B, Demarzo AM, Wilding G, et al: Engineering a prostate-specific membrane antigen-activated tumor endothelial cell prodrug for cancer therapy. Sci Transl Med. 4:140ra1862012. View Article : Google Scholar

7 

Park SW and Ozcan U: Potential for therapeutic manipulation of the UPR in disease. Semin Immunopathol. 35:351–373. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Chen CJ and Chen DS: Interaction of hepatitis B virus, chemical carcinogen, and genetic susceptibility: Multistage hepatocarcinogenesis with multifactorial etiology. Hepatology. 36:1046–1049. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Wang WA, Groenendyk J and Michalak M: Endoplasmic reticulum stress associated responses in cancer. Biochim Biophys Acta. 1843:2143–2149. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Liu YH, Weng YP, Lin HY, Tang SW, Chen CJ, Liang CJ, Ku CY and Lin JY: Aqueous extract of Polygonum bistorta modulates proteostasis by ROS-induced ER stress in human hepatoma cells. Sci Rep. 7:414372017. View Article : Google Scholar : PubMed/NCBI

11 

Tameire F, Verginadis II and Koumenis C: Cell intrinsic and extrinsic activators of the unfolded protein response in cancer: Mechanisms and targets for therapy. Semin Cancer Biol. 33:3–15. 2015. View Article : Google Scholar : PubMed/NCBI

12 

El-Serag HB and Rudolph KL: Hepatocellular carcinoma: Epidemiology and molecular carcinogenesis. Gastroenterology. 132:2557–2576. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Lazar C, Uta M and Branza-Nichita N: Modulation of the unfolded protein response by the human hepatitis B virus. Front Microbiol. 5:4332014. View Article : Google Scholar : PubMed/NCBI

14 

Sunami Y, Ringelhan M, Kokai E, Lu M, O'Connor T, Lorentzen A, Weber A, Rodewald AK, Mullhaupt B, Terracciano L, et al: Canonical NF-κB signaling in hepatocytes acts as a tumor-suppressor in hepatitis B virus surface antigen-driven hepatocellular carcinoma by controlling the unfolded protein response. Hepatology. 63:1592–1607. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Yeganeh B, Rezaei Moghadam A, Alizadeh J, Wiechec E, Alavian SM, Hashemi M, Geramizadeh B, Samali A, Bagheri Lankarani K, Post M, et al: Hepatitis B and C virus-induced hepatitis: Apoptosis, autophagy, and unfolded protein response. World J Gastroenterol. 21:13225–13239. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Lin JH, Li H, Yasumura D, Cohen HR, Zhang C, Panning B, Shokat KM, Lavail MM and Walter P: IRE1 signaling affects cell fate during the unfolded protein response. Science. 318:944–949. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Li Y, Guo Y, Tang J, Jiang J and Chen Z: New insights into the roles of CHOP-induced apoptosis in ER stress. Acta Biochim Biophys Sin (Shanghai). 46:629–640. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Sheedy C, Mooney C, Jimenez-Mateos E, Sanz-Rodriguez A, Langa E, Mooney C and Engel T: De-repression of myelin-regulating gene expression after status epilepticus in mice lacking the C/EBP homologous protein CHOP. Int J Physiol Pathophysiol Pharmacol. 6:185–198. 2014.PubMed/NCBI

20 

Marciniak SJ, Yun CY, Oyadomari S, Novoa I, Zhang Y, Jungreis R, Nagata K, Harding HP and Ron D: CHOP induces death by promoting protein synthesis and oxidation in the stressed endoplasmic reticulum. Genes Dev. 18:3066–3077. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Moon DO, Park SY, Choi YH, Ahn JS and Kim GY: Guggulsterone sensitizes hepatoma cells to TRAIL-induced apoptosis through the induction of CHOP-dependent DR5: Involvement of ROS-dependent ER-stress. Biochem Pharmacol. 82:1641–1650. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Crozat A, Aman P, Mandahl N and Ron D: Fusion of CHOP to a novel RNA-binding protein in human myxoid liposarcoma. Nature. 363:640–644. 1993. View Article : Google Scholar : PubMed/NCBI

23 

Panagopoulos I, Höglund M, Mertens F, Mandahl N, Mitelman F and Aman P: Fusion of the EWS and CHOP genes in myxoid liposarcoma. Oncogene. 12:489–494. 1996.PubMed/NCBI

24 

Churin Y, Roderfeld M, Stiefel J, Würger T, Schröder D, Matono T, Mollenkopf HJ, Montalbano R, Pompaiah M, Reifenberg K, et al: Pathological impact of hepatitis B virus surface proteins on the liver is associated with the host genetic background. PLoS One. 9:e906082014. View Article : Google Scholar : PubMed/NCBI

25 

Li J, Liu Y, Wang Z, Liu K, Wang Y, Liu J, Ding H and Yuan Z: Subversion of cellular autophagy machinery by hepatitis B virus for viral envelopment. J Virol. 85:6319–6333. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Sells MA, Chen ML and Acs G: Production of hepatitis B virus particles in Hep G2 cells transfected with cloned hepatitis B virus DNA. Proc Natl Acad Sci USA. 84:1005–1009. 1987. View Article : Google Scholar : PubMed/NCBI

27 

Yan H, Zhong G, Xu G, He W, Jing Z, Gao Z, Huang Y, Qi Y, Peng B, Wang H, et al: Sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis B and D virus. Elife. 1:e000492012. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October-2017
Volume 14 Issue 4

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhao D, Liu Y, Liu X, Li T, Xin Z, Zhu X, Wu X and Liu Y: HBV suppresses thapsigargin‑induced apoptosis via inhibiting CHOP expression in hepatocellular carcinoma cells Corrigendum in /10.3892/ol.2017.7243. Oncol Lett 14: 4403-4409, 2017.
APA
Zhao, D., Liu, Y., Liu, X., Li, T., Xin, Z., Zhu, X. ... Liu, Y. (2017). HBV suppresses thapsigargin‑induced apoptosis via inhibiting CHOP expression in hepatocellular carcinoma cells Corrigendum in /10.3892/ol.2017.7243. Oncology Letters, 14, 4403-4409. https://doi.org/10.3892/ol.2017.6666
MLA
Zhao, D., Liu, Y., Liu, X., Li, T., Xin, Z., Zhu, X., Wu, X., Liu, Y."HBV suppresses thapsigargin‑induced apoptosis via inhibiting CHOP expression in hepatocellular carcinoma cells Corrigendum in /10.3892/ol.2017.7243". Oncology Letters 14.4 (2017): 4403-4409.
Chicago
Zhao, D., Liu, Y., Liu, X., Li, T., Xin, Z., Zhu, X., Wu, X., Liu, Y."HBV suppresses thapsigargin‑induced apoptosis via inhibiting CHOP expression in hepatocellular carcinoma cells Corrigendum in /10.3892/ol.2017.7243". Oncology Letters 14, no. 4 (2017): 4403-4409. https://doi.org/10.3892/ol.2017.6666