Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-2019 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2019 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Correlation between microsatellite instability and RAS gene mutation and stage Ⅲ colorectal cancer

  • Authors:
    • Wenbo Niu
    • Guiying Wang
    • Jun Feng
    • Zheng Li
    • Chenhui Li
    • Baoen Shan
  • View Affiliations / Copyright

    Affiliations: Department of Surgery Ⅱ, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050000, P.R. China, Center of Scientific Research, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050000, P.R. China
    Copyright: © Niu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 332-338
    |
    Published online on: October 23, 2018
       https://doi.org/10.3892/ol.2018.9611
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Correlation between RAS gene mutation and microsatellite instabi­lity (MSI) status in cancer tissues and clinicopathological parameters of patients with stage Ⅲ colorectal cancer (CRC) were investigated. Tissues were collected from 180 patients diagnosed with stage Ⅲ CRC in the Department of Gastrointestinal Surgery of the Fourth Hospital of Hebei Medical University from 2012 to 2016. RAS gene mutations in paraffin sections were detected by PCR and Sanger sequencing. Expression of mismatch repair proteins MLH1, MSH2, MSH6 and PMS2 was detected by immunohistochemistry, and MSI status was determined based on the positive and negative expression combinations of the above proteins, and the correlation with clinicopathological parameters of CRC was analyzed. Mutation rates of KRAS and NRAS were 48.33% (87/180) and 2.78% (5/180), respectively. Mutation rate of p.G12D in codon 12 of exon 2 in KRAS gene was the highest (31/87, 35.63%). Mutation rate of p.G12D in codon 12 of exon 2 in NRAS gene was the highest (2/5, 40%). Mutation rate of KRAS gene in right colon was higher than that in left colon and rectum (p<0.05), and mutation rate in N2b phase was higher than that in N2a and N1 phases (p<0.01). In low degree of microsatellite instability (MSI‑L) and high degree of microsatellite instability (MSI‑H) status, negative MKH1 protein expression was dominant (18/32, 56.25%). MSI‑H in CRC patients aged ≥50 years was higher than that of CRC patients <50 years. Rates of MSI‑H in N1, N2a, and N2b were 1.75, 12.82, and 1.11% (p<0.05). Mutation rate of KRAS gene in MSI‑H status of stage Ⅲ CRC patients was significantly higher than that in MSI‑L/microsatellite stability (MSS) (p<0.05). Mutation of RAS gene and the status of MSI are involved in the occurrence and development of stage Ⅲ CRC. Detection of RAS gene has important significance for the individual treatment of CRC in clinic.

Introduction

Colorectal cancer (CRC) is one of the most common malignant tumors of the digestive tract in the world, and it is seriously endangering the health of humans. In recent years, the incidence of CRC showed an increasing trend and onset age is becoming increasingly younger (1). At present, surgical resection is the main treatment of CRC (2). However, due to differences in genotypes among different individuals, the incidence of drug resistance during chemotherapy increases significantly (3). Therefore, how to achieve personalized treatment of CRC under the guidance of precision medical treatment has been the focus of treatment in recent years.

Studies have shown that changes in molecular pathways are involved in the development of CRC tumors, of which microsatellite instability (MSI) and chromosomal instability (CIN) play the most important roles (4). MSI is the change of DNA genome sequence caused by mismatch repair gene mutation during DNA replication. It plays an important role in the regulation of various tumors, and CRC is one of the malignant tumors with a high incidence of MSI (5). It has been reported that >90% of CRCs have a high degree of MSI (6). CIN is related to a variety of signal transduction pathways, of which the epidermal growth factor receptor (EGFR)-mediated signaling pathway plays an important role (7). Activation of the EGFR signal transduction pathway can regulate the phosphorylation of downstream signaling pathways, thereby promoting cell proliferation (8). RAS proto-oncogene family includes KRAS, HRAS, and NRAS, of which the KRAS gene has the highest mutation rate in CRC disease and can be as high as 45% (9). KRAS is an important component of the downstream pathway of the EGFR signaling pathway, and its mutation can lead to activation of the RAS/RAF/MAPK signaling pathway and loss of EGFR regulation (10). Therefore, outcomes of clinical use of EGFR drugs targeting KRAS gene mutations in CRC patients are extremely poor. In this study, PCR-Sanger sequencing and immunohistochemical methods were used to detect RAS gene mutations and MSI status in paraffin sections of patients with stage III CRC and to analyze the correlation with clinical parameters. Our study provided theoretical basis for personalized treatment for clinical CRC.

Patients and methods

Patient data

Tissues were collected from 180 patients who were diagnosed as stage III CRC in the Department of Gastrointestinal Surgery of the Fourth Hospital of Hebei Medical University (Shijiazhuang, China). All tissue specimens were fixed with 10% formaldehyde and stored as paraffin blocks. These patients included 104 males (57.78%) and 76 females (42.22%), and age ranged from 26 to 81 years, with an average age of 54.38+17.32 years. Inclusion criteria: i) all patients were treated with surgery and excluded from chemotherapy, radiotherapy, biological therapy, and other special treatment methods; ⅱ) patients pathologically diagnosed with stage III CRC; ⅲ) excluded from other intestinal diseases or other parts of the original tumor; and ⅳ) all the patients and their families were informed, and signed informed consent. In this study, the clinical and pathological grade of tumors were determined according to the standards proposed by the Union for International Cancer Control (UICC) in 2010 (11).

The study was approved by the Ethics Committee of the Fourth Hospital of Hebei Medical University. Signed informed consents were obtained from the patients or the guardians.

Detection of gene mutation

DNA was extracted from CRC paraffin blocks using a DNA FFPE Tissue kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. PCR (Thermo Fisher Scientific, Inc.) reactions were performed to amplify DNA. All primer sequences are listed in Table I. Primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). PCR reaction conditions were: 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 50°C for 30 sec and 70°C for 1 min, and 70°C for 10 min. After purification of PCR products, Sanger sequencing of KRAS, NRAS and HRAS in the RAS family was performed using the ABI 3730×l sequencer (Sangon Biotech Co., Ltd.), and the sequencing results were analyzed.

Table I.

RAS gene amplification primer sequences and PCR product length.

Table I.

RAS gene amplification primer sequences and PCR product length.

NameForward primerReverse primerFragment length (bp)
KRAS
  Exon 2 CCAGACTGTGTTTCTCCCTTC TTTAAACCCACCTATAATGGTG  92
  Exon 3 CTTGGATATTCTCGACACAGCA TCCCTCATTGCACTGTACTCCT131
  Exon 4 TGATTTTGCAGAAAACAGAT GACACAAAACAGGCTCAGGA120
NRAS
  Exon 2 ATGACTGAGTACAAACTGGTC CTCTATGGTGGGATCATATTG128
  Exon 3 AAACAAGTGGTTATAGATGGT CACAGAGGAAGCCTTCGCCT  97
  Exon 4 TTGGCCCCATTTAGAAACTTCTGT TCATCTTGGGCTCTTGTGCCA  93
HRAS
  Exon 2 TCACGCACCAACGTGTAGAA CTTCGAGATGGCCAGAGTCC204
Immunohistochemistry

Immunohistochemistry was used to detect the expression of MLH1, MSH2, MSH6 and PMS2. CRC tissue blocks were used to prepare tissue sections with a thickness of 4 µm, which were fixed on glass slide, and then baked at 65°C for 2 h. After dewaxing and hydration, immunohistochemical SP was performed. All antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Tissue sections were incubated with primary mouse anti-human MLH1 (dilution, 1:200; cat. no. sc-56160), MSH2 (dilution, 1:250; cat. no. sc-56163), MSH6 (dilution, 1:100; cat. no. 137015), and PMS2 (dilution, 1:300; cat. no. sc-137015) monoclonal antibodies overnight at 4°C, followed by incubation with goat anti-mouse secondary polyclonal antibody (dilution, 1:100; cat. no. sc-2005) at 37°C for 1 h. DAB color development and hematoxylin counterstaining were performed. PBS was used instead of the primary antibody to serve as a negative control. Positive sections were used as positive controls.

Determination of the results

Six visual fields were randomly selected under a 400-fold microscope (Olympus, Tokyo, Japan), and the results were judged by percentage of positive cells and depth of coloration. i) Scoring according to depth of coloration: negative was 0 points, light yellow was 1 point, brown-yellow score was 2 points, and brown score was 3 points. ⅱ) Scoring according to the percentage of positive cells: 0–30% was 1 point, 30–70% was 2 points, and 70–100% was 3 points. Product of the two scores ≥3 points was positive, otherwise it was negative. MSI result was determined as: positive expression of the above four proteins in CRC patients was defined as microsatellite stability (MSS). Negative expression of one of the proteins was defined as low degree of microsatellite instability (MSI-L). The presence of negative expression of two or more proteins was defined as high degree of microsatellite instability (MSI-H) (12).

Statistical analysis

Statistical analysis was performed using the SPSS 22.0 statistical analysis software (IBM Corp., Armonk, NY, USA). Measurement data was recorded as mean ± SD Count data were recorded as rates and processed using Chi-square test to investigate the relationship between RAS gene mutations, MSI status, and CRC clinicopathological parameters. P<0.05 indicates a difference with statistical significance (Table I).

Results

RAS gene mutation in stage III CRC patients

Analysis of 180 cases of phase III CRC tissues revealed that RAS mutation rate was 51.11% (92/180), of which KRAS and NRAS gene mutation rates were 48.33% (87/180) and 2.78% (5/180), respectively. HRAS mutation was not detected. The number of exon 2, 3 and 4 mutations in KRAS gene was 78 (89.66%), 2 (2.30%), and 7 (8.05%), respectively. Mutation rate of p.G12D in codon 12 of exon 2 in KRAS gene was the highest (31/87, 35.63%). Mutation rate of p.G12D in codon 12 of exon 2 in NRAS gene was the highest (2/5, 40%) (Table II).

Table II.

Incidence of KRAS and NRAS mutations [n (%)].

Table II.

Incidence of KRAS and NRAS mutations [n (%)].

Gene exonGene mutationsn (%)
KRAS
  Exon 2p.G12D31 (35.63)
p.G12V14 (16.09)
p.G12A5 (5.75)
p.G12C4 (4.60)
p.G12S4 (4.60)
p.G12R1 (1.15)
p.G13D19 (21.84)
  Exon 3p.A59T1 (1.15)
p.Q61H1 (1.15)
  Exon 4p.A146T4 (4.60)
p.A146V1 (1.15)
Others2 (2.30)
  Total 87 (48.33)
NRAS
  Exon 2p.G12D2 (40.00)
  Exon 3p.A18T1 (20.00)
p.Q61L1 (20.00)
p.Q61R1 (20.00)
  Total 5 (2.78)
MSI status of patients with stage III CRC

Immunohistochemical detection of 180 cases of CRC tissues revealed that MLH1 protein positive expression was observed in 168 cases (93.33%) and negative expression in 12 cases (6.67%). MSH2 protein positive expression was observed in 154 cases (85.56%), and negative expression in 26 cases (14.44%). MSH6 protein was positively expressed in 151 cases (83.89%) and negatively expressed in 29 cases (16.11%). PMS2 protein was positively expressed in 148 cases (82.22%) and negatively expressed in 32 cases (17.78%). There were 148 cases of MSS status (82.22%), 22 cases of MSI-L status (12.22%), and 10 cases of MSI-H status (5.56%). In MSI-L and MSI-H status, MLH1 protein negative expression was the dominant (18/32, 56.25%). Fig. 1 shows the immunohistochemical staining of MSS.

Figure 1.

Detection of MSI status in stage III CRC patients by immunohistochemistry (SP method, ×100). (A) Negative control group; (B) MLH1 positive expression; (C) MSH2 positive expression; (D) MSH6 positive expression; (E) PMS2 positive expression. MSI, microsatellite instability; CRC, colorectal cancer.

Relationship between RAS gene mutation and clinicopathological parameters of patients with stage III CRC

This study investigated the relationship between RAS gene mutations and clinicopathological parameters in stage III CRC patients and found that the mutation rate of KRAS gene in the right colon was 65.82%, which was significantly higher than that of the left colon and rectum (p<0.05). Mutation rate in N2b phase was 81.48%, which was significantly higher than that in N2a and N1 phases (p<0.01). NRAS gene mutation was not correlated with age, sex, lymph node metastasis, tumor site, depth of invasion, or pathological stage of CRC patients (p>0.05) (Table III).

Table III.

Relationship between RAS gene mutations and clinicopathological parameters of patients with stage III CRC [n (%)].

Table III.

Relationship between RAS gene mutations and clinicopathological parameters of patients with stage III CRC [n (%)].

KRASNRAS


Pathological parametersCasesWild-typeMutantsχ2P-valueWild-typeMutantsχ2P-valueAll wild-typeOne mutation at leastχ2P-value
Sex
  Male10447 (45.19)57 (54.81)   11.3820.492101 (97.12)3 (2.88)   21.8430.28149 (47.12)55 (52.88)   39.2210.183
  Female  7646 (60.53)30 (39.47)   74 (97.37)2 (2.63) 70 (92.11)6 (7.89)
Age (years)
  <50  4831 (64.58)17 (35.42)   31.9400.192  47 (97.92)1 (2.08)   14.4830.38135 (72.92)13 (27.08)   17.2810.415
  ≥5013262 (46.97)70 (53.03) 128 (96.97)4 (3.03) 84 (63.64)48 (36.36)
Lymph node metastasis
  No10764 (59.81)43 (40.19)   79.1710.091104 (97.20)3 (2.80)   49.1730.12167 (62.62)40 (37.38)   56.3310.105
  Yes  7329 (39.73)44 (60.27)   71 (97.26)2 (2.74) 52 (71.23)21 (28.77)
Tumor site
  Right colon  7927 (34.18)52 (65.82)124.2180.038  77 (97.47)2 (2.53)   44.7110.18433 (41.77)46 (58.23)   83.1910.092
  Left colon  15  8 (53.33)  7 (46.67)   14 (93.33)1 (6.67)   9 (60.00)  6 (40.00)
  Rectum  8658 (67.44)28 (32.56)   84 (97.67)2 (2.33) 77 (89.53)  9 (10.47)
Infiltration depth
  T1  2  1 (50.00)  1 (50.00)   20.9110.29402 (100)   46.8310.1280  2 (100.0)   12.0110.493
  T2  15  8 (53.33)  7 (46.67)   14 (93.33)1 (6.67)   9 (60.00)  6 (40.00)
  T312869 (53.91)59 (46.09) 127 (99.22)1 (0.78) 90 (70.31)38 (29.69)
  T4  3515 (42.86)20 (57.14)   34 (97.14)1 (2.86) 20 (57.14)15 (42.86)
Pathological stage
  N111473 (64.04)41 (35.96)214.2810.003111 (97.37)3 (2.63)101.3820.06984 (73.68)30 (26.32)177.2640.012
  N2a  3915 (38.46)24 (61.54)   38 (97.44)1 (2.56) 21 (53.85)18 (46.15)
  N2b  27  5 (18.52)22 (81.48)   26 (96.30)1 (3.70) 14 (51.85)13 (48.15)
Relationship between MSI status and clinicopathological parameters of patients with stage III CRC

This study investigated the relationship between MSI status and clinicopathological parameters of patients with stage III CRC. Results showed that MSI-H was observed in 9 cases (6.82%) in patients with ≥50 years of age, which was significantly higher than that of CRC patients <50 years (1 case, 2.08%, p<0.05). The ratios of MSI-H in N1, N2a, and N2b phases were 1.75, 12.82, and 1.11%, respectively, and significant differences were found among them (p<0.05) (Table IV).

Table IV.

Relationship between MSI status and clinicopathological parameters of patients with stage III CRC [n (%)].

Table IV.

Relationship between MSI status and clinicopathological parameters of patients with stage III CRC [n (%)].

Pathological parametersCasesMSI-HMSI-L/MSSχ2P-value
Sex
  Male1047 (6.73)  97 (93.27)   13.2810.381
  Female  763 (3.95)  73 (96.05)
Age (years)
  <50  481 (2.08)  47 (97.92)   71.3060.028
  ≥501329 (6.82)123 (93.18)
Lymph node metastasis
  No1076 (5.61)101 (94.39)   41.8110.128
  Yes  734 (5.48)  69 (94.52)
Tumor site
  Right colon  797 (8.86)  72 (91.14)   59.4410.091
  Left colon  151 (6.67)  14 (93.33)
  Rectum  862 (2.33)  84 (97.67)
Infiltration depth
  T1  20  2 (100.0)   32.9120.294
  T2  151 (6.67)  14 (93.33)
  T31287 (5.47)121 (94.53)
  T4  352 (5.71)  33 (94.29)
Pathological stage
  N11142 (1.75)112 (98.25)101.2210.012
  N2a  39  5 (12.82)  34 (87.18)
  N2b  273 (1.11)  24 (88.89)

[i] MSI, microsatellite instability; CRC, colorectal cancer; MSI-H, high degree of microsatellite instability; MSI-L, low degree of microsatellite instability; MSS, microsatellite stability.

Correlation between MSI status and RAS gene mutation in stage III CRC patients

Results of this study revealed that mutation rate of KRAS gene in MSI-H status of stage III CRC patients was 60% (6/10), which was significantly higher than that in MSI-L/MSS (47.65%, 81/170, p<0.05). However, there was no significant difference in NRAS gene mutation rate among MSI-H, MSI-L/MSS status (p>0.05) (Table V).

Table V.

Correlation between MSI status and RAS gene mutation in patients with stage III CRC [n (%)].

Table V.

Correlation between MSI status and RAS gene mutation in patients with stage III CRC [n (%)].

KRASNRAS


MSI statusCasesWild-typeMutantsχ2P-valueWild-typeMutantsχ2P-value
MSI-H  10  4 (40.00)  6 (60.00)104.2810.011  9 (90.00)1 (1.00)14.9210.385
MSI-L/MSS17089 (52.35)81 (47.65) 166 (97.65)4 (2.35)

[i] MSI, microsatellite instability; CRC, colorectal cancer; MSI-H, high degree of microsatellite instability; MSI-L, low degree of microsatellite instability; MSS, microsatellite stability.

Discussion

CRCs lack obvious symptoms and most patients are diagnosed with tumor metastasis, which is a major challenge of clinical treatment. Realization of disease molecular typing in individuals with tumors can help identify the biological characteristics of the tumor and clarify its pathogenesis (13). The three main molecular properties of CRC are CIN, MSI and CpG island methylation (14). The most important EGFR signal transduction pathway in CIN plays an important role in malignant transformation of tumors. Studies have shown that high expression of level EGFR in tumor tissue of malignant tumors promotes tumor cell invasion and metastasis (15). KRAS, NRAS and HRAS genes in RAS family are important downstream components of the EGFR signaling pathway. Studies have shown that mutations in KRAS gene cause conformational changes in KRAS protein that reduce its ability to bind to GDP. The binding of KRAS protein to GDP activates KRAS protein, ultimately activating downstream proliferative signaling pathways and promoting tumor cell growth (16). Therefore, the 2010 NCCN guidelines clearly stated that CRC patients should be tested for KRAS gene mutation rates to guide the clinical application of anti-EGFR signaling pathway drugs (17). MSI is another molecular characteristic of CRC, and its detection has become increasingly popular in the diagnosis of CRC. Mismatch repair genes encode MLH1, MSH2, PMS2, and MSH6 proteins to identify replication errors during DNA replication. DNA polymerases cleave the erroneously-replicated fragments, and DNA ligases cleave both ends of the excised fragments, so as to achieve correct DNA replication (18). Microsatellites are small DNA fragments in the human genome. Microsatellites are repeated sequences and error rate is high during replication. However, when the mismatch repair gene is mutated, the encoded protein cannot be expressed, and DNA erroneous replication cannot be corrected, eventually resulting in the production of MSI (19). Therefore, this study explored the correlation between RAS gene mutations, MSI status and the occurrence and development of CRC, so as to provide theoretical basis for individualized treatment of CRC patients.

In this study, tissue paraffin specimens from 180 patients with stage III CRC were examined. Results showed that the RAS mutation rate was 51.11% (92/180) and KRAS and NRAS gene mutation rate was 48.33% (87/180) and 2.78% (5/180), respectively. It has been reported that KRAS gene mutation rate in CRC patients is 35–45% (20), which is generally consistent with the results of our study. Ye et al (21) investigated the CRC of Chinese population and found that the mutation rate of KRAS gene was 37.9%, which was slightly lower than the results of our study. The possible explanation is they only included the 12th codon. In this study, codons 12 and 13 in exon 2 were both detected. Results showed that the number of exon 2, 3 and 4 mutations in KRAS mutations was 78 cases (89.66%), 2 cases (2.30%), 7 cases (8.05%), respectively. Mutation rate of p.G12D in codon 12 of exon 2 was the highest (35.63%, 31/87), which was in agreement with that reported by Ye et al (21). Mutation rate of p.G13D in codon 13 was 21.84% (19/87), which was lower than the mutation rate of codon 12. This result is consistent with that of Omidifar et al (22). HRAS mutation was not detected, which was consistent with the results of previous studies (23). This study further analyzed the correlation between KRAS and NRAS mutations and the clinicopathological parameters of phase III CRC and found that mutation rate of KRAS gene in right colon was 65.82%, which was significantly higher than that in left colon and rectum (p<0.05). Mutation rate in N2b phase was 81.48%, which was significantly higher than that in N2a and N1 phases (p<0.01), but there was no correlation with other pathological parameters. Studies have shown that the age of patients with KRAS and CRC and the degree of tumor differentiation are closely observed (24,25). An explanation of the different results may be the differences in the survey population. It has been reported that NRAS gene mutations are associated with low expression of c-MET, and NRAS gene mutations are more likely to occur in elderly patients with malignant melanoma (26). In this study we found that NRAS gene mutations were not associated with age, sex, lymph node metastasis, tumor location, depth of invasion, and pathological stage of patients with CRC, possibly due to the fact that mutation rate of NRAS in CRC is significantly lower than that of KRAS (27). In addition, the sample size of our study was small and biased results cannot be avoided.

In this study, immunohistochemistry was used to detect phase III CRC tissue paraffin sections. There were 148 cases (82.22%) of MSS status, 22 cases (12.22%) of MSI-L status, 10 cases (5.56%) of MSI-H status, and MKH1 protein negative expression was dominant in MSI-L and MSI-H status (18/32, 56.25%), indicating that patients with stage III CRC are mainly MSS. Fleming et al (28) analyzed 128 patients with malignant rectal cancer and found that patients with MSI-H mostly showed poor differentiation, lymph node infiltration, and high degree of tissue heterogeneity, and MSI-H mostly occurred in female patients and right semi-colon. Correlation analysis showed that MSI-H is closely related to the pathological stage of CRC, and it mostly occurs in elderly patients aged ≥50 years. The reason for the discrepancy in the analysis is that this study only selected patients with stage III CRC as the study subjects, and Fleming et al (28) selected patients with stage II and III CRC as study subjects. Finally, the relationship between RAS gene mutation and MSI was analyzed. It was found that the mutation rate of KRAS gene in MSI-H status of stage III CRC patients was 60% (6/10), which was significantly higher than that in MSI-L/MSS (47.65%, 81/170). Mutation rate of NRAS gene was not correlated with MSI. Ogura et al (26) found that patients with MSI-L tumors were more likely to have NRAS mutations than KRAS mutations, possibly due to the different subjects included in that study.

In summary, RAS gene mutation and MSI status are involved in the occurrence and development of stage III CRC, and detection of these indexes is of great significance to the individual treatment of CRC in the clinic.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

WN drafted the manuscript. WN and GW were mainly devoted to collecting and interpreting the general data. JF and ZL detected gene mutation. CL and BS were responsible for immunohistochemistry. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of the Fourth Hospital of Hebei Medical University (Shijiazhuang, China). Signed informed consents were obtained from the patients or the guardians.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Martins C, Sousa P, Araújo T, Castro-Poças F and Pedroto I: Mediastinal mass in a patient with colorectal cancer: A diagnostic challenge. GE Port J Gastroenterol. 24:193–197. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Cermak K, Thill V, Simoens CH, Smets D, Ngongang CH and da Costa PM: Surgical resection for colon cancer: laparoscopic assisted vs. open colectomy. Hepatogastroenterology. 55:412–417. 2008.PubMed/NCBI

3 

Heo JH, Ryu CG, Jung EJ, Paik JH and Hwang DY: Clinical significance of preoperative virtual colonoscopy for evaluation of the proximal colon in patient with obstructive colorectal cancer. Ann Coloproctol. 33:130–133. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Wicha MS: Targeting self-renewal, an Achilles' heel of cancer stem cells. Nat Med. 20:14–15. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Jiricny J: The multifaceted mismatch-repair system. Nat Rev Mol Cell Biol. 7:335–346. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Iyer RR, Pluciennik A, Burdett V and Modrich PL: DNA mismatch repair: Functions and mechanisms. Chem Rev. 106:302–323. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Barberán S, Fraguas S and Cebrià F: The EGFR signaling pathway controls gut progenitor differentiation during planarian regeneration and homeostasis. Development. 143:2089–2102. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Saafan H, Foerster S, Parra-Guillen ZP, Hammer E, Michaelis M, Cinatl J Jr, Völker U, Fröhlich H, Kloft C and Ritter CA: Utilising the EGFR interactome to identify mechanisms of drug resistance in non-small cell lung cancer - proof of concept towards a systems pharmacology approach. Eur J Pharm Sci. 94:20–32. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Tang Y, Zhou H, Chen A, Pittman RN and Field J: The Akt proto-oncogene links Ras to Pak and cell survival signals. J Biol Chem. 275:9106–9109. 2000. View Article : Google Scholar : PubMed/NCBI

10 

Di Nicolantonio F, Martini M, Molinari F, Sartore-Bianchi A, Arena S, Saletti P, De Dosso S, Mazzucchelli L, Frattini M, Siena S, et al: Wild-type BRAF is required for response to panitumumab or cetuximab in metastatic colorectal cancer. J Clin Oncol. 26:5705–5712. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Trojan J, Mineur L, Tomášek J, Rouleau E, Fabian P, de Maglio G, García-Alfonso P, Aprile G, Taylor A, Kafatos G, et al: Panitumumab use in metastatic colorectal cancer and patterns of KRAS testing: Results from a Europe-wide physician survey and medical records review. PLoS One. 10:e01407172015. View Article : Google Scholar : PubMed/NCBI

12 

Hu J, Yan WY, Xie L, Cheng L, Yang M, Li L, Shi J, Liu BR and Qian XP: Coexistence of MSI with KRAS mutation is associated with worse prognosis in colorectal cancer. Medicine (Baltimore). 95:e56492016. View Article : Google Scholar : PubMed/NCBI

13 

Sideris M and Papagrigoriadis S: Molecular biomarkers and classification models in the evaluation of the prognosis of colorectal cancer. Anticancer Res. 34:2061–2068. 2014.PubMed/NCBI

14 

Slik K, Kurki S, Korpela T, Carpén O, Korkeila E and Sundström J: Ezrin expression combined with MSI status in prognostication of stage II colorectal cancer. PLoS One. 12:e01854362017. View Article : Google Scholar : PubMed/NCBI

15 

Ciardiello F and Tortora G: EGFR antagonists in cancer treatment. N Engl J Med. 358:1160–1174. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Neumann J, Zeindl-Eberhart E, Kirchner T and Jung A: Frequency and type of KRAS mutations in routine diagnostic analysis of metastatic colorectal cancer. Pathol Res Pract. 205:858–862. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Shemirani AI, Haghighi MM, Milanizadeh S, Taleghani MY, Fatemi SR, Damavand B, Akbari Z and Zali MR: The role of kras mutations and MSI status in diagnosis of colorectal cancer. Gastroenterol Hepatol Bed Bench. 4:70–75. 2011.PubMed/NCBI

18 

Vilar E and Gruber SB: Microsatellite instability in colorectal cancer-the stable evidence. Nat Rev Clin Oncol. 7:153–162. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Philip P, Ernst P and Wantzin GL: Karyotypes in infectious mononucleosis. Scand J Haematol. 15:201–206. 1975. View Article : Google Scholar : PubMed/NCBI

20 

Kambara T, Simms LA, Whitehall VL, Spring KJ, Wynter CV, Walsh MD, Barker MA, Arnold S, McGivern A, Matsubara N, et al: BRAF mutation is associated with DNA methylation in serrated polyps and cancers of the colorectum. Gut. 53:1137–1144. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Ye JX, Liu Y, Qin Y, Zhong HH, Yi WN and Shi XY: KRAS and BRAF gene mutations and DNA mismatch repair status in Chinese colorectal carcinoma patients. World J Gastroenterol. 21:1595–1605. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Omidifar N, Geramizadeh B and Mirzai M: K-ras mutation in colorectal cancer, a report from Southern Iran. Iran J Med Sci. 40:454–460. 2015.PubMed/NCBI

23 

Fujiyoshi K, Yamamoto G, Takahashi A, Arai Y, Yamada M, Kakuta M, Yamaguchi K, Akagi Y, Nishimura Y, Sakamoto H, et al: High concordance rate of KRAS/BRAF mutations and MSI-H between primary colorectal cancer and corresponding metastases. Oncol Rep. 37:785–792. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Martinetti D, Costanzo R, Kadare S, Alimehmeti M, Colarossi C, Canzonieri V, Berretta M and Memeo L: KRAS and BRAF mutational status in colon cancer from Albanian patients. Diagn Pathol. 9:1872014. View Article : Google Scholar : PubMed/NCBI

25 

Kawazoe A, Shitara K, Fukuoka S, Kuboki Y, Bando H, Okamoto W, Kojima T, Fuse N, Yamanaka T, Doi T, et al: A retrospective observational study of clinicopathological features of KRAS NRAS, BRAF and PIK3CA mutations in Japanese patients with metastatic colorectal cancer. BMC Cancer. 15:2582015. View Article : Google Scholar : PubMed/NCBI

26 

Ogura T, Kakuta M, Yatsuoka T, Nishimura Y, Sakamoto H, Yamaguchi K, Tanabe M, Tanaka Y and Akagi K: Clinicopathological characteristics and prognostic impact of colorectal cancers with NRAS mutations. Oncol Rep. 32:50–56. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Yamane LS, Scapulatempo-Neto C, Alvarenga L, Oliveira CZ, Berardinelli GN, Almodova E, Cunha TR, Fava G, Colaiacovo W, Melani A, et al: KRAS and BRAF mutations and MSI status in precursor lesions of colorectal cancer detected by colonoscopy. Oncol Rep. 32:1419–1426. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Fleming M, Ravula S, Tatishchev SF and Wang HL: Colorectal carcinoma: Pathologic aspects. J Gastrointest Oncol. 3:153–173. 2012.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Niu W, Wang G, Feng J, Li Z, Li C and Shan B: Correlation between microsatellite instability and RAS gene mutation and stage Ⅲ colorectal cancer. Oncol Lett 17: 332-338, 2019.
APA
Niu, W., Wang, G., Feng, J., Li, Z., Li, C., & Shan, B. (2019). Correlation between microsatellite instability and RAS gene mutation and stage Ⅲ colorectal cancer. Oncology Letters, 17, 332-338. https://doi.org/10.3892/ol.2018.9611
MLA
Niu, W., Wang, G., Feng, J., Li, Z., Li, C., Shan, B."Correlation between microsatellite instability and RAS gene mutation and stage Ⅲ colorectal cancer". Oncology Letters 17.1 (2019): 332-338.
Chicago
Niu, W., Wang, G., Feng, J., Li, Z., Li, C., Shan, B."Correlation between microsatellite instability and RAS gene mutation and stage Ⅲ colorectal cancer". Oncology Letters 17, no. 1 (2019): 332-338. https://doi.org/10.3892/ol.2018.9611
Copy and paste a formatted citation
x
Spandidos Publications style
Niu W, Wang G, Feng J, Li Z, Li C and Shan B: Correlation between microsatellite instability and RAS gene mutation and stage Ⅲ colorectal cancer. Oncol Lett 17: 332-338, 2019.
APA
Niu, W., Wang, G., Feng, J., Li, Z., Li, C., & Shan, B. (2019). Correlation between microsatellite instability and RAS gene mutation and stage Ⅲ colorectal cancer. Oncology Letters, 17, 332-338. https://doi.org/10.3892/ol.2018.9611
MLA
Niu, W., Wang, G., Feng, J., Li, Z., Li, C., Shan, B."Correlation between microsatellite instability and RAS gene mutation and stage Ⅲ colorectal cancer". Oncology Letters 17.1 (2019): 332-338.
Chicago
Niu, W., Wang, G., Feng, J., Li, Z., Li, C., Shan, B."Correlation between microsatellite instability and RAS gene mutation and stage Ⅲ colorectal cancer". Oncology Letters 17, no. 1 (2019): 332-338. https://doi.org/10.3892/ol.2018.9611
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team