Open Access

Knockdown of long non‑coding RNA PVT1 inhibits the proliferation of Raji cells through cell cycle regulation

  • Authors:
    • Chanli Zheng
    • Yu Xiao
    • Yangqiu Li
    • Dongmei He
  • View Affiliations

  • Published online on: June 7, 2019     https://doi.org/10.3892/ol.2019.10450
  • Pages: 1225-1234
  • Copyright: © Zheng et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Long non‑coding RNA plasmacytoma variant translocation 1 (PVT1) has been reported to be associated with oncogenesis. However, the functional role of PVT1 in Burkitt lymphoma has not yet been addressed. The purpose of the present study was to investigate the effect of PVT1 knockdown by small interfering RNA (siRNA) on the proliferation of Burkitt lymphoma Raji cells and to explore its possible mechanism of action. An effective siRNA targeting PVT1 was screened and the corresponding short hairpin RNA (shRNA) was reconstructed into a lentiviral vector. Cell proliferation and cell cycle distribution were assessed by Cell Counting kit‑8 assay and flow cytometry, respectively. Protein expression levels of c‑Myc, cyclin‑dependent kinase inhibitor1A (CDKN1A, P21) and cyclin E1 (CCNE1) were detected by western blotting. A polymerase chain reaction (PCR) array was used to analyse the expression of genes associated with the cell cycle. PVT1 knockdown markedly suppressed proliferation, and induced cell cycle arrest at the G0/G1 phase in Raji cells. Protein expression levels of c‑Myc and CCNE1 were reduced, whereas P21 protein expression was markedly increased following downregulation of PVT1 in Raji cells. The cell cycle PCR array revealed that 54 genes were upregulated and 26 genes were downregulated in Raji cells following PVT1 knockdown. Reverse transcription‑quantitative PCR demonstrated that cyclin G2 (CCNG2), CDKN1A, Retinoblastoma‑like 2 (RBL2, p130), HUS1 checkpoint homolog, cyclin dependent kinase inhibitor 3 (CDKN3) and cyclin dependent kinase inhibitor 1B (CDKN1B) expression were upregulated, whereas the expression levels of CCNE1, cyclin D1 (CCND1) and cell division cycle 20 (CDC20) were downregulated in Raji cells with PVT1 knockdown. In conclusion, PVT1 knockdown may inhibit the proliferation of Raji cells by arresting cells in G0/G1 phase. Furthermore, inhibition of cell proliferation may be associated with a reduction inc‑Myc expression and alterations in the expression levels of cell cycle‑associated genes.

Introduction

Burkitt lymphoma (BL) is an aggressive form of B-cell lymphoma that mostly affects children and adolescents. In BL, dysregulation of the oncogenic transcription factor Myc is considered to be the major driving force of lymphoma development (1,2). However, the molecular mechanisms of the pathogenesis of BL have not been fully elucidated.

Long non-coding RNAs (lncRNAs) are defined as cellular RNA molecules, >200 base pairs in length, without protein-coding capacity, which act as key regulators at transcriptional and post-transcriptional levels (3,4). Increasing evidence indicates that lncRNAs are involved in various biological processes, including DNA replication, stem cell pluripotency, proliferation and apoptosis (4,5). LncRNAs serve a critical role in the development of various types of human cancer, including haematopoietic malignancies, and may be potential targets for tumour treatment (5).

Human plasmacytoma variant translocation 1 (PVT1), also known as the Pvt1 oncogene, is a lncRNA that is homologous to the mouse plasmacytoma variant translocation gene. PVT1 is located on chromosome 8, ~55 kb distal to the MYC proto-oncogene bHLH transcription factor (c-Myc) gene, and is frequently involved in translocations that occur in variant BL (6,7). The overexpression of PVT1 is one of the most frequent events in a variety of malignant diseases, including melanoma (8), hepatocellular carcinoma (9,10), thyroid cancer and colorectal cancer (11,12). A number of studies have demonstrated that lncRNA PVT1 interacts with the proliferation-associated nucleolar proteins NOP2 or c-Myc, stabilizes these proteins against degradation, and negatively modulates microRNA (miRNA) as a competing endogenous RNA or a molecular sponge, in order to exert a tumour-promoting effect (8,10,13,14). A large genome-wide association study identified one high-risk single nucleotide polymorphism (SNP; rs2608053) for classic Hodgkin lymphoma at 8q24 near the Myc/PVT1 locus, which is associated with patient outcome (15). In a meta-analysis, two independent SNPs, rs13255292 and rs4733601, at 8q24.21 were identified for diffuse large B cell lymphoma (16). However, the functional role and molecular mechanism of PVT1 in BL remain unclear.

In the present study, knockdown of PVT1 was able to inhibit Raji cell growth by regulating cell cycle progression. Furthermore, it was revealed that PVT1 may serve an important role in G0/G1 arrest, which may be associated with the expression of c-Myc and cell cycle-associated genes. Together, these results indicated that lncRNA PVT1 may serve a critical role in Raji cell proliferation, and may be considered a candidate target for novel treatment of human BL.

Materials and methods

Cell culture and transfection

The Raji cell line was purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China. http://www.cellbank.org.cn/index.asp). Cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), supplemented with 10% heat-inactivated foetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) at 37°C in a humidified incubator with 5% CO2. Four small interfering RNA (siRNA) sequences targeting PVT1 (siRNA54, siRNA176, siRNA845, siRNA1055) and a scrambled control (SC) siRNA were designed and synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). The sequences of the siRNA are as follows: PVT1-siRNA54: 5′-CCUGAUGGAUUUACAGUGATT-3′, PVT1-siRNA176: 5′-GCUGAAUGCCUCAUGGAUUTT-3′, PVT1-siRNA845: 5′-CCUGUUACACCUGGGAUUUTT-3′, PVT1-siRNA1055: 5′-GCUUCUCCUGUUGCUGCUATT-3′, SC-siRNA: 5′-GCUACGAUCUGCCUAAGAUTT-3′. Raji cells (3–4×105 cells/ml) in the exponential growth phase were grown for 24 h, then PVT1-siRNA54, -siRNA176, -siRNA845 and-siRNA1055 were transfected into Raji cells using HiPerfect (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocol. In addition to non-silencing SC siRNA control, cells in the mock transfection group were treated with HiPerfect agents only. The total concentration of siRNA applied in eachcase was 100 nM. At 24 and 48 h post-transfection, silencing of PVT1 RNA was examined.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA from the Raji cells of post-transfection was isolated using a TRIzol® total RNA isolation system (Invitrogen; Thermo Fisher Scientific, Inc.). RNA purity and concentration were measured using a spectrophotometer, and RNA was reverse transcribed into first-strand cDNA using random hexamer primers and the reverse transcriptase Superscript II kit (Toyobo Life Science, Osaka, Japan), according to the manufacturer's protocol. The 2−ΔCt method (17) was used to analyse the relative changes in gene expression in RT-qPCR experiments with SYBR Green (Toyobo Life Science, Japan). The primers were designed and synthesized by Shanghai GeneChem Co., Ltd. (Shanghai, China). The primer sequences are listed in Table I. GAPDH was used as a reference gene. The total PCR reaction volume was 20 µl and reaction conditions were as follows: Enzyme activation at 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec, 60°C for 15 sec and 72°C for 32 sec. At the end of each run a melting curve was performed, starting at 65°C and reaching 95°C with an increase of 1°C/2 sec, to verify primer specificities, specificity of amplification and absence of primer dimers. RT-qPCR was repeated in at least three separate experiments.

Table I.

Sequences of primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Sequences of primers used for reverse transcription-quantitative polymerase chain reaction.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
PVT1 GTCTTGGTGCTCTGTGTTC CCCGTTATTCTGTCCTTCT
CCNG2 GGTTTCACCTTCATAAGAGCC GCTGAGTTTGATTGAGGCTAC
CDKN1A AGCGACCTTCCTCATCCACC AAGACAACTACTCCCAGCCCCATA
HUS1 ATGGGTCACAATGCGGCTACT GCTAACATCGGAAAACTTATCTCG
CDKN1B GGGCAAGTACGAGTGGCAAGAG CAAATGCGTGTCCTCAGAGTTAGC
CDKN3 AGTCCCAAACCTTCTGGATCTCTAC CTCCCAAGTCCTCCATAGCAGTG
RBL2 TTCTGGTAGTGCTGGCTGGTG GGGTGACTGAAGTTCGTGCTG
CCNE1 AAAGGTTTCAGGGTATCAGTGGTG TCTCTGTGGGTCTGTATGTTGTGTG
CCND1 CCCTCGGTGTCCTACTTCAAATGT GGAAGCGGTCCAGGTAGTTCAT
CDC20 TCACCAGAGCTTGCACTCCAC ACCTGCCGTTACATTCCTTCC
GAPDH GGACCTGACCTGCCGTCTAG GTAGCCCAGGATGCCCTTGA
Western blot analysis

Cells were washed with PBS (10 mM, pH 7.4) and incubated in 200 µl cell lysis buffer (Beyotime Institute of Biotechnology) on ice for 30 min, and centrifuged at 13,000 × g for 15 min at 4°C. The protein content of the cell lysate was determined by Bio-Rad protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA), according to the manufacturer's protocol. Whole cell extracts equivalent to 100 µg total protein were separated by 8% SDS-PAGE and transferred to nitrocellulose membranes (Gibco; Thermo Fisher Scientific, Inc.) at 18 V for 10–15 min. The blots were immersed in blocking buffer (10% non-fat dry milk, 1% Tween-20, 20 mM Tris-buffered saline, pH 7.5) for 1 h at room temperature, and were then incubated with appropriate anti-human primary antibodies [rabbit immunoglobulin G (IgG) anti-c-Myc (1:1,000 dilution; cat. no., sc-40, Santa Cruz Biotechnology, Inc., Dallas, TX, USA), anti-P21 (1:1,000 dilution; cat. no., ab109520, Abcam, Cambridge, MA, USA) or anti-cyclin E1 (CCNE1) (1:1,000 dilution; cat. no., ab33911, Abcam, Cambridge, MA, USA USA), or mouse anti-GAPDH/IgG (1:1,000 dilution; cat. no., ab8245, Abcam, Cambridge, MA, USA) USA] in blocking buffer overnight at 4°C. Blots were then incubated with anti-rabbit (cat. no., sc-2357) or anti-mouse (cat. no., sc-516102) horseradish peroxidase-conjugated secondary antibodies (1:2,000 dilution; Santa Cruz Biotechnology, Inc.) for 1 h at room temperature and bands were detected by chemiluminescence using Enhanced Chemiluminescence Hyperfilm (EMD, Millpore, USA).

PVT1 short hairpinRNA (shRNA)-expressing plasmid construction and cloning screen

To stably knockdown the expression of PVT1, a shRNA sequence targeting PVT1 (siRNA1055) was cloned into the pGV248-lentivirus vector (Shanghai GenePharma Co., Ltd.). Subsequently, PVT1 knockdown vectors were reconstructed and sequenced. pGV248 vector containing the negative control (NC) shRNA was used as a control. Subsequently, 293T cells from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China) were cultured in Dulbecco's modified Eagle's medium (Gibco; ThermoFisher Scientific, Inc., Waltham, MA, USA) containing 10% FBS, maintained at 37°C in a humidified incubator with 5% CO2 and transfected with pGV248-shRNAs, Helper 1.0 and Helper 2.0 (Shanghai GenePharma Co., Ltd.) using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The media were replaced with 10 ml fresh medium after incubation overnight. The virus-containing supernatants (LV-PVT1-shRNA and LV-NC-shRNA) were collected after 48 h. Raji cells were infected, respectively, with LV-PVT1-shRNA and LV-NC-shRNA (multiplicity of infection=250) at 37°C for 72 h, and were then selected using 4 µg/ml puromycin to screen single cell clones for 2 weeks and expand the culture for 4 weeks. Green fluorescence of cells was observed by inverted fluorescence microscopy. The knockdown efficiency was measured using RT-qPCR. Cell proliferation and cell cycle distribution were analysed in positive clone Raji cells. In subsequent assays, Raji cells were divided into three groups: Blank control group (cells without infection), NC group (cells with LV-NC-shRNA) and PVT1 knockdown group (cells with LV-PVT1-shRNA).

Cell proliferation assay

For the quantitative determination of cellular proliferation, a Cell Counting kit-8 (CCK8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) assay was performed. The assay was performed for Raji cells carrying LV-PVT1-shRNA and LV-NC-shRNA. Cells were seeded at a density of 5×104 cells/well in 96-well plates and cultured at 37°C with 5% CO2 in a humidified incubator. According to the manufacturer's protoocols 10 µl CCK8 solution was added 4 h prior to the end of incubation at 37°C at 24, 48, 72 and 96 h. Cell proliferation was measured using a spectrophotometer (Bio-Rad Laboratories, Inc.) at an absorbance wavelength of 450 nm. All experiments were repeated three times.

Cell cycle assay

Raji cells containing LV-PVT1-shRNA or LV-NC-shRNA were harvested. The cells were fixed with 70% ethanol at −20°C overnight and stained with propidium iodide (5 µg/ml; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) in the presence of ribonuclease A (1 mg/ml; Sigma-Aldrich; Merck KGaA) for 30 min at room temperature. The cell cycle distribution was analysed via flow cytometry (BD Biosciences, San Jose, CA, USA). All experiments were repeated three times.

RT-PCR-based array analysis

Human Cell Cycle RT2 RNA QC PCR arrays (Qiagen, Inc.) were used to screen a panel of 84 representative cell cycle-associated genes in Raji cells infected with LV-PVT1-shRNA. Total RNA was isolated from the LV-PVT1-shRNA and LV-NC-shRNA cells using the Qiagen RNeasy Mini kit (Qiagen, Inc.) according to the manufacturer's protocol. RNA was quantified by the NanoDrop® ND-1000 (NanoDrop; Thermo Scientific, Inc., Wilmington, DE, USA), and quality was assessed by visualizing 18S and 28S ribosomal RNA bands separated by 1% agarose gel electrophoresis with ethidium bromide staining (Sigma-Aldrich; Merck KGaA). According to manufacturer's protocol, the first-strand cDNA was obtained using an RT2 First Strand kit (Qiagen, Inc.). qPCR was conducted using 2X RT2 SYBR Green qPCR Master Mix (Qiagen, Inc.) on a Bio-Rad Real-Time PCR system (Bio-Rad Laboratories, Inc.) according to the RT2 Profiler PCR array protocols under the following conditions: 95°C for 10 min, then 40 cycles at 95°C for 15 sec and 60°C for 1 min. At the end of each run a melting curve was performed, extending at 60°C for 1 min. Microarray data were normalized for housekeeping genes (ACTB, B2M, GAPDH, HPRT1, RPLP0) by calculating the ΔCq and 2−ΔΔCq (17) for each gene of interest in the plate. Fold changes of each gene between the LV-PVT1-shRNA and LV-NC-shRNA groups were calculated as 2−ΔΔCt, and scatter plots were analysed.

Statistical analysis

All data are expressed as the means ± standard deviation. Differences among three or more groups were compared using one-way analysis of variance (ANOVA), followed by SNK post hoc test. All data were analysed using SPSS v13.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

PVT1 siRNAs or shRNA suppress PVT1 RNA and c-Myc protein expression in Raji cells

To determine the efficiency of PVT1 inhibition following siRNA (siRNA54, siRNA176, siRNA845, siRNA1055) transfection, PVT1 RNA expression was analysed. RT-qPCR data were obtained from at least three independent experiments. The relative qPCR formula: 2−ΔCt ×100% was used. As shown in Fig. 1A, at 24 and 48 h after transient transfection, the relative expression levels of PVT1 RNA in Raji cells transfected with PVT1 siRNA (siRNA1055)were significantly lower than in cells transfected with the control SC siRNA (P<0.05). Conversely, siRNA54, siRNA176, siRNA845 had no significant effect on the expression of PVT1 RNA when compared respectively with the control SC siRNA. A specific siRNA (siRNA1055) against PVT1 was used to stably knockdown PVT1 expression. Subsequently, lentiviral vectors carrying LV-PVT1-shRNA or LV-NC-shRNA were successfully constructed. Raji cells stably carrying PVT1-shRNA or NC-shRNA were screened. Raji cells expressing LV-PVT1-shRNA were observed to exhibit green fluorescence under an inverted fluorescence microscope (data not shown). As shown in Fig. 1B, following stable infection with the LV-PVT1-shRNA expression vector, the expression levels of PVT1 RNA were significantly reduced compared with in the LV-NC-shRNA and blank control cell groups (P<0.05). Additionally, no significant differences between the LV-NC-shRNA group and the blank control cell group were identified (P>0.05).

The protein expression levels of c-Myc were assessed by western blotting. As shown in Fig. 1C, western blot analysis confirmed that c-Myc protein expression was decreased in the Raji cells transfected with PVT1 siRNA1055 after 48 h compared with in the SC siRNA and blank control cell groups. There were no clear differences in c-Myc expression among the SC siRNA group, mock-transfected cells and blank control cells. Similarly, c-Myc protein expression was decreased in Raji cells stably carrying LV-PVT1-shRNA compared with either the LV-NC-shRNA group or blank control group (Fig. 1D). There was no difference identified between c-Myc expression in the LV-NC-shRNA group and blank control group. These findings indicated that PVT1 siRNA and shRNA were effective at reducing c-Myc protein expression.

Effect of PVT1 knockdown on the proliferation and cell cycle distribution of Raji cells

A CCK8 assay was performed to quantify cell proliferation. As shown in Fig. 2A, the proliferative activity of Raji cells carrying the LV-PVT1-shRNA was significantly inhibited (P<0.01) compared with Raji cells carrying LV-NC-shRNA and blank control cells (P<0.01). No significant difference in proliferation of LV-NC-shRNA group and blank control cells was identified. PVT1 siRNA had a similar effect on the proliferative activity of Raji cells (data not shown).

Proliferation of Raji cells was inhibited following PVT1 knockdown. Additionally, the effect of decreased PVT1 expression on the cell cycle was examined. According to flow cytometric analysis, the percentages of cells in G0/G1, S and G2/M phases were 54. 20±0.61, 34.07±0.64 and 11.70±0.00% in Raji cells carrying LV-PVT1-shRNA, respectively. In Raji cells carrying LV-NC-shRNA, the percentages of cells in G0/G1, S and G2/M phases were 47.37±0.60, 43.27±0.55 and 9.37±0.51%, respectively. There was a significant decrease in the percentage of cells in the S phase and a marked accumulation of cells in the G0/G1 phase in Raji cells carrying LV-PVT1-shRNA compared with those carrying LV-NC-shRNA and blank control cells (Fig. 2B and C). There was no significant difference identified between the Raji cells carrying LV-NC-shRNA and blank control cells. These results indicated that knockdown of PVT1 expression in Raji cells induced G0/G1 phase arrest.

Alteration in expression pattern of cell cycle-associated genes in Raji cells as a result of PVT1 knockdown

Differential mRNA expression levels of 84 genes involved in the cell cycle were assessed. The results of the PCR array revealed that 54 genes were upregulated and 26 genes were downregulated in the LV-PVT1-shRNA group compared with the LV-NC-shRNA group. The other four genes exhibited too low an expression level. There were more upregulated genes than downregulated genes in Raji cells carrying LV-PVT1-shRNA (Fig. 3A; Table II). The present study demonstrated that 16/84 examined genes were upregulated at least two-fold in the LV-PVT1-shRNA group.

Figure 3.

Differential expression of cell cycle-associated genes in Raji cells with PVT1 knockdown. (A) There are three straight lines in the coordinate system, and the black line represents the fold changes (2−ΔΔCt) of 1. Dots above the black line represent genes that are upregulated, and dots below the black line indicate genes that are downregulated in the LV-PVT1-shRNA group compared with the LV-NC-shRNA group. A point within the range of the two dotted lines signifies a differential expression of >1-fold but <2-fold in Raji cells infected with LV-PVT1-shRNA compared with cells infected with LV-NC-shRNA. Points outside the two dotted lines are >2-fold differentially expressed. (B) Protein expression levels of P21 and CCNE1 in Raji cells were determined using western blot analysis following PVT1 knockdown. GAPDH served as a loading control. (C) Reverse transcription-quantitative polymerase chain reaction analysis of nine genes in Raji cells stably infected with LV-PVT1-shRNA compared with the genes in the negative control cells infected with LV-NC-shRNA. GAPDH was used as a reference gene. The graphs depict the mean mRNA expression changes ± standard deviation of three independent experiments. *P<0.05 vs. LV-NC-shRNA. CCNE1, cyclin E1; CCND1, cyclin D1; CCNG2, cyclin G2; CDC20, cell division cycle 20 homolog (S. cerevisiae); CDKN1A, cyclin-dependent kinase inhibitor 1A (P21, Cip1); CDKN1B, cyclin-dependent kinase inhibitor 1B (P27, Kip1); CDKN3, cyclin-dependent kinase inhibitor 3; HUS1, HUS1 checkpoint homolog (S. pombe); LV, lentiviral vector; NC, negative control; PVT1, plasmacytoma variant translocation 1; RBL2, Retinoblastoma-like 2 (p130); shRNA, short hairpin RNA.

Table II.

Differentially expressed genes associated with the cell cycle in Raji cells followingPVT1 knockdown.

Table II.

Differentially expressed genes associated with the cell cycle in Raji cells followingPVT1 knockdown.

Gene symbolAccession no.Gene descriptionFold change
CCNG2NM_004354Cyclin G27.03
RBL2NM_005611Retinoblastoma-like 2 (p130)5.26
CDKN1ANM_000389Cyclin-dependent kinase inhibitor 1A (P21, Cip1)4.78
CCNT1NM_001240Cyclin T14.17
CASP3NM_004346Caspase 3, apoptosis-related cysteine peptidase3.96
RBL1NM_002895Retinoblastoma-like 1 (p107)3.70
RB1NM_000321Retinoblastoma 13.68
HUS1NM_004507HUS1 checkpoint homolog (S. pombe)3.38
CCND2NM_001759Cyclin D22.51
CDC6NM_001254Cell division cycle 6 homolog (S. cerevisiae)2.34
CDKN1BNM_004064Cyclin-dependent kinase inhibitor 1B (p27, Kip1)2.31
TFDP2NM_006286Transcription factor Dp-2 (E2F dimerization partner 2)2.23
CDC16NM_003903Cell division cycle 16 homolog (S. cerevisiae)2.21
GADD45ANM_001924Growth arrest and DNA-damage-inducible, alpha2.08
CDKN3NM_005192Cyclin-dependent kinase inhibitor 32.07
ABL1NM_005157C-abl oncogene 1, non-receptor tyrosine kinase2.04
BRCA2NM_000059Breast cancer 2, early onset−2.22
CCNE1NM_001238Cyclin E1−2.05
CCND1NM_053056Cyclin D1−1.98
CDK6NM_001259Cyclin-dependent kinase 6−1.85
CDC20NM_001255Cell division cycle 20 homolog (S. cerevisiae)−1.81
ATMNM_000051Ataxia telangiectasia mutated−1.67
CKS2NM_001827CDC28 protein kinase regulatory subunit 2−1.56
CDK4NM_000075Cyclin-dependent kinase 4−1.52

[i] Positive and negative values represent upregulation or downregulation of genes in the LV-PVT1-shRNA group compared with the LV-NC-shRNA group, respectively.

Candidate gene selected from PCR microarray analyses was validated. As shown in Fig. 3B, western blotting revealed that P21, encoded by cyclin-dependent kinase inhibitor 1A (CDKN1A) was increased and CCNE1 was decreased in the LV-PVT1-shRNA group compared within the LV-NC-shRNA group and in blank control cells. As shown in Fig. 3C, the RT-qPCR assay demonstrated that the expression levels of cyclin G2 (CCNG2), Retinoblastoma-like 2 (RBL2, p130), CDKN1A, HUS1 checkpoint homolog (HUS1), cyclin dependent kinase inhibitor 3 (CDKN3) and cyclin dependent kinase inhibitor 1B (CDKN1B)were upregulated in Raji cells infected with LV-PVT1-shRNA compared with the LV-NC-shRNA group and blank control cells. Although the expression of CDKN1B was very low in the three groups, there was statistically significant difference between the LV-PVT1-shRNA group and the LV-NC-shRNA group (P<0.05). In addition, CCNE1, CCND1 and cell division cycle 20 (CDC20) were significantly downregulated in the LV-PVT1-shRNA group compared with in the LV-NC-shRNA group and blank control cells (P<0.05). The RT-qPCR assay results of the 9 selected differentially expressed genes did not change notably compared with the PCR array results.

Discussion

PVT1 is aberrantly expressed in a variety of tumour types and acts as a potential oncogene that promotes cancer cell proliferation (812). Gain of PVT1 lncRNA expression is required for high MYC protein levels in 8q24-amplified human cancer cells (13). PVT1 RNA and MYC protein expression are correlated in primary human tumours, and copy number of PVT1 co-increases in >98% of MYC-copy-increase types of cancer (13). Although it was reported in 1990 that the PVT1 locus may be a site of variant translocations, including in human BL (6), to the best of our knowledge, there are no reports about the role of PVT1 in BL. To investigate the role of PVT1 in BL cell proliferation, RNA interference was used to inhibit its expression in the human BL-derived Raji cell line. The results of the present study revealed that the expression levels of PVT1 RNA and c-Myc protein decreased following transfection of Raji cells with PVT1 siRNA targeting the 1,055-1,074 nt region of the PVT1 sequence. No significant effect of the other three siRNAs targeting PVT1 (siRNA54, siRNA176 and siRNA845) on the expression levels of PVT1 RNA was identified. The specific siRNA against PVT1, siRNA1055, was successfully incorporated into a lentiviral vector. Raji cells carrying the PVT1-shRNA lentiviral vector were screened. Once Raji cells stably expressed PVT1-shRNA, the levels of PVT1 RNA and c-Myc protein were markedly reduced, which is consistent with the effect of PVT1 siRNA1055.

In the present study, the proliferation of Raji cells carrying PVT1-shRNA was significantly decreased compared with in control cells. However, downregulation of PVT1 expression by shRNA could not induce apoptosis of Raji cells (data not shown). Cell cycle distribution analysis indicated that knockdown of PVT1 in Raji cells resulted in notable G0/G1 phase arrest. Previous studies have reported that PVT1 can promote the proliferation of cells, including hepatocellular carcinoma (10) and thyroid cancer cells (11). The results of the present study were consistent with those of previous studies. Taken together, the results suggested that the PVT1 shRNA-mediated suppression of Raji cell proliferation may occur via cell cycle arrest.

PVT1 may be associated with a series of signalling pathways and genes in tumour development and progression (1820). According to topological measures, Paci et al (20) revealed that the lncRNA PVT1 is connected to 753 different mRNAs (~50% of total mRNAs in the network), and the miR-200 family members mediate >80% of these interactions. However, the mechanism by which knockdown of PVT1 causes cell cycle alteration in Raji cells remains largely unexplained. It has been confirmed that PVT1 is located adjacent to the proto-oncogene c-Myc, and the expression of PVT1-Myc in the majority of tumours is positively correlated with the copy number of 8q24 (13,15,21). Tseng et al (13) demonstrated that c-Myc protein expression is dependent on the expression levels of PVT1; therefore, this lncRNA may promote cell proliferation and tumourigenesis by regulating the expression of c-Myc protein. Following transfection of Raji cells with PVT1-siRNA or shRNA, the expression of c-Myc protein decreased, which was consistent with previous reports (13). It has been demonstrated that c-Myc is involved in regulation of the cell cycle and proliferation (22). Yang et al (23) revealed that c-Myc regulates the cyclin-dependent kinase1 (CDK1)/cyclin B1-dependent G2/M cell cycle progression by controlling histone H4 acetylation. Additionally, a study has reported that loss of c-Myc function impedes G1-phase progression (22). The CDK inhibitors P27 and P21 appear to be critical targets of c-Myc, which cooperates with the zinc finger MIZ-type containing 1 to repress the transcription of cell-cycle inhibitors, including P15, P21 and P27 (24). Yang et al (23) also reported that suppression of c-Myc induces the upregulation of P21 and the downregulation of P27 in Raji cells. Recently, Wang et al (25) reported that the epigenetically induced lncRNA EPIC1 promotes cell cycle progression by interacting with c-Myc via the 129–283 nt region of EPIC1. EPIC1 knockdown reduces the affinity of c-Myc to its target genes, including CDKN1A, CCNA2, CDC20 and CDC45 (25). The results of the present study suggested that the regulation of G0/G1 cell cycle progression by PVT1 may be associated with c-Myc expression or c-Myc regulation of cell cycle-associated genes.

To further evaluate the alterations in cell cycle-associated gene expression in Raji cells with PVT1 knockdown, a cell cycle PCR microarray was used to detect alterations in cell cycle-associated genes in Raji cells stably expressing PVT1-shRNA. The results revealed that cell cycle-associated genes, including CCNG2, RBL2, CDKN1A, HUS1, CDKN3 and CDKN1B, were upregulated in Raji cells with PVT1 knockdown. The majority of the aforementioned genes inhibit cell cycle progression. CDKN1A encodes a cell cycle-dependent kinase inhibitor, which binds and inhibits the activity of cell cycle-associated genes with cyclin and CDK complexes, including CCND1-CDK4 and CCNE-CDK2. P21 is a member of the cell cycle regulator CIP/KIP family, which is involved in the regulation of numerous important biological behaviours, the most important of which is the regulation of cell cycle progression, particularly cell cycle arrest at the G1 phase (26,27). Therefore, P21 serves a key role in cell quiescence, senescence and differentiation (28). In addition, a recent study identified a positive correlation between PVT1 and miR-1207-5P, and a negative correlation between miR-1207-5P and signal transducer and activator of transcription 6 (STAT6) in breast cancer (29). miR-1207-5P, produced by PVT1 transcription and targeting STAT6, promotes the proliferation of breast cancer cells by regulating P21 and CDKN1B (29). In nasopharyngeal cancer cells, PVT1 promotes cancer stem cell-like properties by inhibiting miR-1207 and activating the phosphoinositide 3-kinase/protein kinase B signalling pathway (30). In the present study, following the downregulation of PVT1 expression in Raji cells, the RNA expression levels of CDKN1A and P21 protein expression were increased, and the cell cycle was blocked in G0/G1 phase, suggesting that PVT1 may promote cell cycle progression by inhibiting the expression of P21. In pancreatic cancer cell lines, PVT1 can promote epithelial-to-mesenchymal transition by downregulating the expression of P21, thus promoting cell proliferation and migration (31). In addition, a study by Cui et al (32) suggested that PVT1 promotes cell proliferation and migration by downregulating P21 in pancreatic cancer cells. Therefore, the results of the present study were consistent with the literature.

CCNG2, which has been shown to be associated with various types of tumour, can cause cell cycle arrest in the G1 phase (3337). A study by Cui et al (37) indicated that CCNG2 expression is decreased in prostate cancer and that PC-3 cells transfected with CCNG2 exhibit a lower survival rate, a higher percentage of cells in the G0/G1 phases and lower CDK2 protein expression, suggesting that CCNG2 may serve important roles as a negative regulator of prostate cancer cells. The results of the present study demonstrated that the downregulation of PVT1 in Raji cells increased the expression of CCNG2, which suggested that PVT1 may also promote cell cycle progression by inhibiting the expression of CCNG2. The RBL2 gene, encoding the proline rich protein BstNI subfamily 2 (pRb2) protein, is most abundant in the G0 phase. RBL2 maintains G0 arrest in quiescent or differentiated cells, controls the transition from G1 to S phase, and is a key regulator of growth arrest in cellular senescence (38). AKT inhibition reduces cell viability, induces cell accumulation in G0/G1 phase and triggers apoptosis, which proves to be largely dependent on RBL2/pRb2 itself, as shown by RBL2/pRb2 silencing (39). The HUS1 protein, encoded by the HUS1 gene, is a component of an evolutionarily conserved and genotoxin-activated checkpoint complex that is involved in cell cycle arrest in response to DNA damage. In the present study, the expression levels of the cell cycle progression regulators RBL2 and HUS1 were increased in Raji cells with PVT1 knockdown, suggesting that the involvement of PVT1 in cell cycle progression may be associated with the expression of RBL2 and HUS1. CDKN3 (also called CDI1 or KAP), encoded by the CDKN3 gene, is a member of the dual specificity protein phosphatase family, which is essential for mitosis and G1/S phase transition, due to its role in regulating the CDK1 (also called CDC2) signalling axis (40), and CDKN3 serves an important role in regulating cell division. CDKN3 may also function as an oncogene by inducing G0/G1 phase progression, apoptosis and metastasis in ovarian cancer cell lines (41). In the present study, the expression levels of CDKN3 were increased in Raji cells with PVT1 knockdown, suggesting that CDKN3 may be involved in the cell cycle arrest by the induction of PVT1 downregulation.

In the present study, CCNE1, CCND1 and CDC20 were significantly downregulated in Raji cells following knockdown of PVT1. CCNE1 is a positive regulator of the cell cycle that controls the transition of cells from the G1 to the S phase, and serves an important role in cell proliferation and tumourigenesis. Overexpression of CCNE1 can increase tumour incidence and susceptibility to multiple tumourigenesis in mice (4244). CCND1, which belongs to the G1 cyclins, serves an important role in cell cycle regulation and promotes cell cycle progression from the G1 phase to S phase through its interaction with CDKs. CCND1 is overexpressed and/or amplified in numerous human types of cancer (45,46). A previous study reported that CCND1 allows for the progression from the G1 to the S phase by binding and sequestering P21 (47). A study by Li et al (48) suggested that PVT1 promotes cell cycle progression by increasing the expression of CCND1. The mechanism involved indicated that PVT1 promotes the progression of clear cell renal cell carcinoma partly via activation of the epidermal growth factor receptor pathway (48). In melanoma cells, silencing of PVT1 significantly inhibits cell proliferation, migration and invasion, and arrests the cell cycle at G0/G1 stage by significantly decreasing CCND1 expression (49). CDC20, which has important functions in chromosome segregation and mitotic exit, is abnormally expressed in a wide range of tumours, including human bladder carcinoma, pancreatic, colorectal breast and lung cell cancer (50). It has been reported that CDC20 were significantly downregulated by lncRNA EPIC1 knockdown in both tumor samples and cell lines (25). Therefore, the results of the present study suggested that the role of PVT1 in regulating G0/G1 cell cycle progression was likely to be associated with the expression levels of CCNE1, CCND1 and CDC20.

In conclusion, the results of the present study revealed that knockdown of PVT1 may inhibit the proliferation of Raji cells by arresting cells in the G0/G1 phase. The role of PVT1 in regulating cell cycle progression may be associated with the expression of c-Myc and cell cycle-associated genes, including CCNG2, RBL2, CDKN1A, HUS1, CDKN3, CDKN1B, CCNE1, CCND1 and CDC20. However, it remains unclear how PVT1 influences the expression levels of cell cycle-associated genes. Furthermore, it is not clear which signalling pathways could be directly associated with PVT1. Therefore, further studies are required to understand the potential molecular mechanisms that underlie the regulation of cell cycle-associated genes by PVT1 in Raji cells. Certainly, the expression pattern of PVT1 in BL should be investigated following the collection of clinical samples. It will be useful to develop a comprehensive understanding of the role of PVT1 and its potential as an oncotarget in BL.

Acknowledgements

The authors would like to thank associate Professor Gexiu Liu and senior experimentalist Mrs Shaohua Chen, School of Medicine, Jinan University, Guangzhou, for providing valuable technical support and advice.

Funding

The project was supported by grants from the Guangdong Science and Technology Project (grant no. 2015A050502029) and the Overseas Chinese Affairs Office of the State Council Key Discipline Construction Fund (grant no. 51205002).

Availability of data and materials

The datasets used and/or analysed in the present study are available from the corresponding author on reasonable request.

Authors' contributions

CZ and YX performed the experiments and interpreted results. DH and YL developed the original concept, designed the study and contributed to the writing of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Molyneux EM, Rochford R, Griffin B, Newton R, Jackson G, Menon G, Harrison CJ, Israels T and Bailey S: Burkitt's lymphoma. Lancet. 379:1234–1244. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Boxer LM and Dang CV: Translocations involving c-myc and c-myc function. Oncogene. 20:5595–5610. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Fang Y and Fullwood MJ: Roles, functions, and mechanisms of long non-coding RNAs in cancer. Genomics Proteomics Bioinformatics. 14:42–54. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Dykes IM and Emanueli C: Transcriptional and post-transcriptional gene regulation by long non-coding RNA. Genomics Proteomics Bioinformatics. 15:177–186. 2017. View Article : Google Scholar : PubMed/NCBI

5 

Rodríguez-Malavé NI and Rao DS: Long noncoding RNAs in hematopoietic malignancies. Brief Funct Genomics. 15:227–238. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Shtivelman E and Bishop JM: Effects of translocations on transcription from PVT. Mol Cell Biol. 10:1835–1839. 1990. View Article : Google Scholar : PubMed/NCBI

7 

Huppi K and Siwarski D: Chimeric transcripts with an open reading frame are generated as a result of translocation to the Pvt-1 region in mouse B-cell tumors. Int J Cancer. 59:848–851. 1994. View Article : Google Scholar : PubMed/NCBI

8 

Wang BJ, Ding HW and Ma GA: Long noncoding RNA PVT1 promotes melanoma progression via endogenous sponging miR-26b. Oncol Res. 26:675–681. 2018. View Article : Google Scholar : PubMed/NCBI

9 

Ding C, Yang Z, Lv Z, Du C, Xiao H, Peng C, Cheng S, Xie H, Zhou L, Wu J and Zheng S: Long non-coding RNA PVT1 is associated with tumor progression and predicts recurrence in hepatocellular carcinoma patients. Oncol Lett. 9:955–963. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Wang F, Yuan JH, Wang SB, Yang F, Yuan SX, Ye C, Yang N, Zhou WP, Li WL, Li W and Sun SH: Oncofetal long noncoding RNA PVT1 promotes proliferation and stem cell-like property of hepatocellular carcinoma cells by stabilizing NOP2. Hepatology. 60:1278–1290. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Zhou Q, Chen J, Feng J and Wang J: Long noncoding RNA PVT1 modulates thyroid cancer cell proliferation by recruiting EZH2 and regulating thyroid-stimulating hormone receptor (TSHR). Tumour Biol. 37:3105–3113. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Takahashi Y, Sawada G, Kurashige J, Uchi R, Matsumura T, Ueo H, Takano Y, Eguchi H, Sudo T, Sugimachi K, et al: Amplification of PVT-1 is involved in poor prognosis via apoptosis inhibition in colorectal cancers. Brit J Cancer. 110:164–171. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Tseng YY, Moriarity BS, Gong W, Akiyama R, Tiwari A, Kawakami H, Ronning P, Reuland B, Guenther K, Beadnell TC, et al: PVT1 dependence in cancer with MYC copy-number increase. Nature. 512:82–86. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Huang F, Chen W, Peng J, Li Y, Zhuang Y, Zhu Z, Shao C, Yang W, Yao H and Zhang S: LncRNA PVT1 triggers Cyto-protective autophagy and promotes pancreatic ductal adenocarcinoma development via the miR-20a-5p/ULK1 Axis. Mol Cancer. 17:982018. View Article : Google Scholar : PubMed/NCBI

15 

Ghesquières H, Larrabee BR, Casasnovas O, Maurer MJ, McKay JD, Ansell SM, Montgomery D, Asmann YW, Farrell K, Verney A, et al: A susceptibility locus for classical Hodgkin lymphoma at 8q24 near MYC/PVT1 predicts patient outcome in two independent cohorts. Brit J Haematol. 180:286–290. 2018. View Article : Google Scholar

16 

Cerhan JR, Berndt SI, Vijai J, Ghesquières H, McKay J, Wang SS, Wang Z, Yeager M, Conde L, de Bakker PI, et al: Genome-wide association study identifies multiple susceptibility loci for diffuse large B cell lymphoma. Nat Genet. 46:1233–1238. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Zhang Y, Mo WJ, Wang X, Zhang TT, Qin Y, Wang HL, Chen G, Wei DM and Dang YW: Microarray-based bioinformatics analysis of the prospective target gene network of key miRNAs influenced by long non-coding RNA PVT1 in HCC. Oncol Rep. 40:226–240. 2018.PubMed/NCBI

19 

Zhang Y, Dang YW, Wang X, Yang X, Zhang R, Lv ZL and Chen G: Comprehensive analysis of long non-coding RNA PVT1 gene interaction regulatory network inhepatocellular carcinoma using gene microarray and bioinformatics. Am J Transl Res. 9:3904–3917. 2017.PubMed/NCBI

20 

Paci P, Colombo T and Farina L: Computational analysis identifies a sponge interaction network between long non-coding RNAs and messenger RNAs in human breast cancer. BMC Syst Biol. 8:832014. View Article : Google Scholar : PubMed/NCBI

21 

Kong R, Zhang EB, Yin DD, You LH, Xu TP, Chen WM, Xia R, Wan L, Sun M, Wang ZX, et al: Long noncoding RNA PVT1 indicates a poor prognosis of gastric cancer and promotes cell proliferation through epigenetically regulating p15 and p16. Mol Cancer. 14:822015. View Article : Google Scholar : PubMed/NCBI

22 

Bretones G, Delgado MD and León J: Myc and cell cycle control. Biochim Biophys Acta. 1849:506–516. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Yang Y Xue K, Li Z, Zheng W, Dong W, Song J, Sun S, Ma T and Li W: c-Myc regulates the CDK1/cyclin B1 dependent-G2/M cell cycle progression by histone H4 acetylation in Raji cells. Int J Mol Med. 41:3366–3378. 2018.PubMed/NCBI

24 

Dang CV: MYC on the path to cancer. Cell. 149:22–35. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Wang Z, Yang B, Zhang M, Guo W, Wu Z, Wang Y, Jia L, Li S; Cancer Genome Atlas Research Network, ; Xie W and Yang D: lncRNA epigenetic landscape analysis identifies EPIC1 as an oncogenic lncRNA that interacts with MYC and promotes cell-cycle progression in cancer. Cancer Cell. 33:706–720.e9. 2018. View Article : Google Scholar : PubMed/NCBI

26 

Dutto I, Tillhon M, Cazzalini O, Stivala LA and Prosperi E: Biology of the cell cycle inhibitor p21 (CDKN1A): Molecular mechanisms and relevance in chemical toxicology. Arch Toxicol. 89:155–178. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Cazzalini O, Scovassi AI, Savio M, Stivala LA and Prosperi E: Multiple roles of the cell cycle inhibitor p21 (CDKN1A) in the DNA damage response. Mutat Res. 704:12–20. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Perucca P, Cazzalini O, Madine M, Savio M, Laskey RA, Vannini V, Prosperi E and Stivala LA: Loss of p21 CDKN1A impairs entry to quiescence and activates a DNA damage response in normal fibroblasts induced to quiescence. Cell Cycle. 8:105–114. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Yan C, Chen Y, Kong W, Fu L, Liu Y, Yao Q and Yuan Y: PVT1-derived miR-1207-5p promotes breast cancer cell growth by targeting STAT6. Cancer Sci. 108:868–876. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Cui M, Chang Y, Fang QG, Du W, Wu JF, Wang JH, Liu ST and Luo SX: Non-coding RNA Pvt1 promotes cancer stem cell-like traits in nasopharyngeal cancer via inhibiting miR-1207. Pathol Oncol Res. 2018. View Article : Google Scholar

31 

Wu BQ, Jiang Y, Zhu F, Sun DL and He XZ: Long noncoding RNA PVT1 promotes EMT and cell proliferation and migration through downregulating p21 in pancreatic cancer cells. Technol Cancer Res Treat. 1:15330346177005592017.

32 

Cui D, Yu CH, Liu M, Xia QQ, Zhang YF and Jiang WL: Long non-coding RNA PVT1 as a novel biomarker for diagnosis and prognosis of non-small cell lung cancer. Tumor Biol. 37:4127–4134. 2016. View Article : Google Scholar

33 

Bennin DA, Don AS, Brake T, McKenzie JL, Rosenbaum H, Ortiz L, DePaoli-Roach AA and Horne MC: Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B′ subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest. J Biol Chem. 277:27449–27467. 2002. View Article : Google Scholar : PubMed/NCBI

34 

Hasegawa S, Nagano H, Konno M, Eguchi H, Tomokuni A, Tomimaru Y, Wada H, Hama N, Kawamoto K, Kobayashi S, et al: Cyclin G2: A novel independent prognostic marker in pancreatic cancer. Oncol Lett. 10:2986–2990. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Yin G, Zhou H, Xue Y, Yao B and Zhao W: MicroRNA-340 promotes the tumor growth of human gastric cancer by inhibiting cyclin G2. Oncol Rep. 36:1111–1118. 2016. View Article : Google Scholar : PubMed/NCBI

36 

Zimmermann M, Arachchige-Don AP, Donaldson MS, Patriarchi T and Horne MC: Cyclin G2 promotes cell cycle arrest in breast cancer cells responding to fulvestrant and metformin and correlates with patient survival. Cell Cycle. 15:3278–3295. 2016. View Article : Google Scholar : PubMed/NCBI

37 

Cui DW, Cheng YJ, Jing SW and Sun GG: Effect of cyclin G2 on proliferative ability of prostate cancer PC-3 cell. Tumour Biol. 35:3017–3024. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Helmbold H, Galderisi U and Bohn W: The switch from pRb/p105 to Rb2/p130 in DNA damage and cellular senescence. J Cell Physiol. 227:508–513. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Pentimalli F, Forte IM, Esposito L, Indovina P, Iannuzzi CA, Alfano L, Costa C, Barone D, Rocco G and Giordano A: RBL2/p130 is a direct AKT target and is required to induce apoptosis upon AKT inhibition in lung cancer and mesothelioma cell lines. Oncogene. 37:3657–3671. 2018. View Article : Google Scholar : PubMed/NCBI

40 

Nalepa G, Barnholtz-Sloan J, Enzor R, Dey D, He Y, Gehlhausen JR, Lehmann AS, Park SJ, Yang Y, Yang X, et al: The tumor suppressor CDKN3 controls mitosis. J Cell Biol. 201:997–1012. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Yu C, Cao H, He X, Sun P, Feng Y, Chen L and Gong H: Cyclin-dependent kinase inhibitor 3 (CDKN3) plays a critical role in prostate cancer via regulating cell cycle and DNA replication signaling. Biomed Pharmacother. 96:1109–1118. 2017. View Article : Google Scholar : PubMed/NCBI

42 

Bortner DM and Rosenberg MP: Induction of mammary gland hyperplasia and carcinomas in transgenic mice expressing human cyclin E. Mol Cell Biol. 17:453–459. 1997. View Article : Google Scholar : PubMed/NCBI

43 

Ma Y, Fiering S, Black C, Liu X, Yuan Z, Memoli VA, Robbins DJ, Bentley HA, Tsongalis GJ, Demidenko E, et al: Transgenic cyclin E triggers dysplasia and multiple pulmonary adenocarcinomas. Proc Natl Acad Sci USA. 104:4089–4094. 2007. View Article : Google Scholar : PubMed/NCBI

44 

Loeb KR, Kostner H, Firpo E, Norwood T, D Tsuchiya K, Clurman BE and Roberts JM: A mouse model for cyclin E-dependent genetic instability and tumorigenesis. Cancer Cell. 8:35–47. 2005. View Article : Google Scholar : PubMed/NCBI

45 

Santarius T, Shipley J, Brewer D, Stratton MR and Cooper CS: A census of amplified and overexpressed human cancer genes. Nat Rev Cancer. 10:59–64. 2010. View Article : Google Scholar : PubMed/NCBI

46 

Cheng G, Zhang L, Lv W, Dong C, Wang Y and Zhang J: Overexpression of cyclin D1 in meningioma is associated with malignancy grade and causes abnormalities in apoptosis, invasion and cell cycle progression. Med Oncol. 32:4392015. View Article : Google Scholar : PubMed/NCBI

47 

Hall M, Bates S and Peters G: Evidence for different modes of action of cyclin-dependent kinase inhibitors: p15 and p16 bind to kinases, p21 and p27 bind to cyclins. Oncogene. 11:1581–1588. 1995.PubMed/NCBI

48 

Li W, Zheng Z, Chen H, Cai Y and Xie W: Knockdown of long non-coding RNA PVT1 induces apoptosis and cell cycle arrest in clear cell renal cell carcinoma through the epidermal growth factor receptor pathway. Oncol Lett. 15:7855–7863. 2018.PubMed/NCBI

49 

Chen L, Ma D, Li Y, Li X, Zhao L, Zhang J and Song Y: Effect of long non-coding RNA PVT1 on cell proliferation and migration in melanoma. Int J Mol Med. 41:1275–1282. 2018.PubMed/NCBI

50 

Kapanidou M, Curtis NL and Bolanos-Garcia VM: Cdc20: At the crossroads between chromosome segregation and mitotic exit. Trends Biochem Sci. 42:193–205. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

August-2019
Volume 18 Issue 2

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zheng C, Xiao Y, Li Y and He D: Knockdown of long non‑coding RNA PVT1 inhibits the proliferation of Raji cells through cell cycle regulation. Oncol Lett 18: 1225-1234, 2019.
APA
Zheng, C., Xiao, Y., Li, Y., & He, D. (2019). Knockdown of long non‑coding RNA PVT1 inhibits the proliferation of Raji cells through cell cycle regulation. Oncology Letters, 18, 1225-1234. https://doi.org/10.3892/ol.2019.10450
MLA
Zheng, C., Xiao, Y., Li, Y., He, D."Knockdown of long non‑coding RNA PVT1 inhibits the proliferation of Raji cells through cell cycle regulation". Oncology Letters 18.2 (2019): 1225-1234.
Chicago
Zheng, C., Xiao, Y., Li, Y., He, D."Knockdown of long non‑coding RNA PVT1 inhibits the proliferation of Raji cells through cell cycle regulation". Oncology Letters 18, no. 2 (2019): 1225-1234. https://doi.org/10.3892/ol.2019.10450