Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
May 2013 Volume 29 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May 2013 Volume 29 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Core binding factor acute myeloid leukaemia and c-KIT mutations

  • Authors:
    • Ludovica Riera
    • Filippo Marmont
    • Daniela Toppino
    • Chiara  Frairia
    • Francesca  Sismondi
    • Ernesta Audisio
    • Cristiana Di Bello
    • Stefano  D'Ardia
    • Paola  Francia Di Celle
    • Emanuela Messa
    • Giorgio Inghirami
    • Umberto Vitolo
    • Achille Pich
  • View Affiliations / Copyright

    Affiliations: Department of Molecular Biotechnology and Health Sciences, Section of Pathology, University of Turin, Turin, Italy, Department of Haematology, Azienda Ospedaliera Città della Salute e della Scienza, Turin, Italy, Center for Experimental Research and Medical Studies (CeRMS), University of Turin, Turin, Italy
  • Pages: 1867-1872
    |
    Published online on: March 5, 2013
       https://doi.org/10.3892/or.2013.2328
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Core binding factor (CBF) acute myeloid leukaemia (AML) represents 5-8% of all AMLs and has a relatively favourable prognosis. However, activating c-KIT mutations are reported to be associated with higher risk of relapse and shorter survival. To verify the incidence and prognostic value of c-KIT mutations in CBF AML, we retrospectively analysed bone marrow samples of 23 consecutive adult patients with de novo CBF AML [14 inv(16) and 9 t(8;21)] treated at a single institution from 2000 to 2011. All patients received standard induction chemotherapy with cytarabine, idarubicin and etoposide; 13 underwent allogeneic stem cell transplantation. c-KIT mutations in exons 8, 9, 10, 11, 13, 14 and 17 were assessed by PCR amplification in combination with direct sequencing. c-KIT mutations (3 in exon 10 and 4 in exon 17) were detected in 7/23 (30.4%) patients, 3 with t(8;21) and 4 with inv(16). No difference in c-KIT mutation status was observed between cases with inv(16) or t(8;21) alone and cases with additional cytogenetic abnormalities. No association between gender, age, white blood cell and platelet count, peripheral blood and bone marrow blast cells at diagnosis, achievement of complete remission, cytogenetic risk groups and Wilms tumour gene 1 (WT1) levels was found. On the contrary, lactate dehydrogenase (LDH) values were higher in mutated than in non-mutated patients (p=0.01). Overall survival (OS) rates were longer in CBF compared to the other types of AML and disease-free survival (DFS) was longer in inv(16) than in t(8;21) AML. OS and DFS were similar in mutated and non-mutated CBF AML patients. Our results confirm a better prognosis for CBF AML than all other AML categories, and for inv(16) than t(8;21) AML. However, no prognostic value for c-KIT mutational status was found in our series. The association between LDH levels and c-KIT mutation would indicate a more active proliferation for mutated CBF AML.

Introduction

RUNX1-RUNX1T1 [t(8;21)] or CBFB-MYH11 [inv(16)] fusion transcripts identify the core binding factor (CBF) acute myeloid leukaemia (AML). Both t(8;21) and inv(16) are characterised at the molecular level by disruption of genes encoding different subunits of CBF (1). CBF AML represents 5–8% of all AML (2) and has a relatively favourable prognosis, following treatment with high dose cytarabine in the consolidation phase (3–5). Mutations of c-KIT occur in 20–25% of t(8;21) and in approximately 30% of inv(16) cases (6). In CBF AML, c-KIT mutations occur frequently within exon 17, which encodes the activation loop in the kinase domain, and in exon 8, which encodes the extracellular portion of the KIT receptor (7). Older age, CD56 expression and activating c-KIT mutations are reported to be associated with higher incidence of relapse and lower survival (6,8,9) while inv(16) patients with +22 secondary abnormality have a better prognosis (10,11). However, no significant differences in overall survival (OS) rates according to c-KIT mutation status have been reported in CBF AML patients (12). In the present study, we retrospectively analysed 23 patients with CBF AML in order to investigate the incidence and prognostic value of c-KIT mutations.

Materials and methods

Patients

Two hundred and forty-nine consecutive unselected adult patients with newly diagnosed AML were admitted to the Division of Haematology, Città della Salute e della Scienza, University of Turin, Italy, from 2000 to 2011. Among these, 23 patients (12 female and 11 male) with de novo CBF AML were retrospectively examined. The mean age was 42.7 years (range, 19–64). Diagnosis of CBF AML was performed according to the WHO criteria (2). Inv(16) was present in 14 patients (60.8%), 9 with isolated inv(16) and 5 with additional cytogenetic abnormalities. Nine patients (39.2%) showed t(8;21); 7 had isolated t(8;21) and 2 t(8;21) with additional cytogenetic aberrations. All patients received standard induction chemotherapy with cytarabine, idarubicin and etoposide (ICE), followed by consolidation treatment with high-dose cytarabine. Thirteen patients with suitable HLA matched donors (related or unrelated) underwent allogeneic stem cell transplantation in first (10 cases) or second (3 cases) remission. To avoid confounding effect of the transplant procedure, patients were censored at the time of the transplantation. General informed consent was obtained according to the local Ethics Committee guidelines. Samples were numerically identified, maintaining patient anonymity.

Molecular analysis

c-KIT mutations in exons 8, 9, 10, 11, 13, 14 and 17 were assessed by polymerase chain reaction (PCR) amplification in combination with direct sequencing from bone marrow (BM) samples.

Amplification of c-KIT exons was performed by PCR with specific oligonucleotide primers (Table I) (13–15), and DNA sequencing was executed using the cDNA from AML BM samples. Sequencing reactions were carried out using the BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA), and the analysis was performed on an ABI 3130 automated capillary system. FLT3-ITD and D835 mutation status was determined by conventional PCR and direct sequencing (16) and NPM1 mutation status was determined by PCR-capillary electrophoresis methods (17), followed by direct sequencing for positive sample characterization (18) (primers in Table I). The electropherograms were compared to published germ-line sequences using basic local alignment search tool (BLAST) on the Internet. Wilms tumour gene 1 (WT1) expression was quantified using a real-time quantitative PCR (WT1 ELN kit, Nanogen, Buttigliera Alta, Turin, Italy).

Table I

Primer sequences for mutation analysis.

Table I

Primer sequences for mutation analysis.

Sequences
FLT3 ITDF: TGTCGAGCAGTACTCTAAACA
R: ATCCTAGTACCTTCCCAAACTC
FLT3 D835F: CCGCCAGGAACGGCTTG
R: GCAGACGGGCATTGCCCC
NPM-I11f-FAM GTGGTAGAATGAAAAATAGAT
NPM-E12r CTTGGCAATAGAACCTGGAC
NPM1F: TGGTTCTCTTCCCAAAGTGG
R: CCTGGACAACATTTATCAAACACG
CK9F: TCCTAGAGTAAGCCAGGGCTT
R: TGGTAGACAGAGCCTAAACATCC
CK11F: CCAGAGTGCTCTAATGACTG
R: AGCCCCTGTTTCATACTGAC
CK13F: GCTTGACATCAGTTTGCCAG
R: AAAGGCAGCTTGGACACGGCTTTA
CK17F: TGAACATCATTCAAGGCGTACTTTTG
R: TTGAAACTAAAAATCCTTTGCAGGAC
CK14F: TCTCACCTTCTTTCTAACCTTTTC
R: AACCCTTATGACCCCATGAA
KIT10F: TGCCAAAGTTTGTGATTCCA
R: GTGGGGAGAAAGGGAAAAAT
CKIT8F: GCAGCCTCAGGAAGGTTGTA
R: AATTGCAGTCCTTCCCCTCT

[i] F, forward; R, reverse.

Histology

Formalin-fixed, paraffin-embedded BM biopsies were stained with H&E, Dominici, Perls, reticulin and immunostained with monoclonal antibodies anti-CD2, CD13, CD33, CD34, CD56 (all from Novocastra, Newcastle, UK), anti-human nucleophosmin, CD68PGM1, and polyclonal antibodies anti-human myeloperoxidase and CD117 (all from Dako, Glostrup, Denmark) (Figs. 1 and 2).

Figure 1

Inv(16) AML (FAB M4 Eo). Bone marrow biopsy (Dominici’s staining, ×600) showing proliferation of both neutrophil and monocyte precursors, and abnormal eosinophils with basophilic granules. (Inset, Giemsa staining, ×1,000).

Figure 2

Inv(16) AML. Blasts expressing MPO, CD34, CD68PGM1 and intranuclear NPM. (Bone marrow biopsy; immunoperoxidase staining, ×600).

Statistical analysis

The association between c-KIT mutation and clinical or haematological parameters was assessed by the one-way analysis of variance (ANOVA) and the Fisher’s exact test. Univariate survival analyses were based on Kaplan-Meier product-limit estimates of survival distribution, and differences between survival curves were tested using the Cox-Mantel test.

Results

c-KIT mutations were detected in 7/23 (30.4%) patients. M541L mutation (exon 10) was found in 3 samples and D816V or D816H or D816Y mutation (exon 17) in 4. Two SNPs (K546K and I798I) were detected in 6 AML samples (Table II). c-KIT mutation electropherograms are shown in Fig. 3. FLT3 ITD, FLT3 D835 and NPM1 mutations rarely occurred (data not shown).

Figure 3

c-KIT mutation electropherograms. Representation of peaks corresponding to wild-type (wt) and mutant c-KIT alleles (indicated by arrows) in chromatograms of cDNA from leukaemic cells of the seven mutated cases in exon 10 or 17. Wt sequences of control cases are also reported.

Table II

c-KIT mutations observed in 23 CBF AML cases.

Table II

c-KIT mutations observed in 23 CBF AML cases.

No. of casesc-KIT mutatedMutation typec-KIT negative (polymorphism)Polymorphism
t(8;21)93D816H (exon 17)6 (3)I798I
D816V (exon 17)I798I
M541L (exon 10)I798I, K546K (simultaneous)
inv(16)144D816Y (exon 17)10 (3)K546K
D816V (exon 17)I798I
M541L (exon 10)K546K
M541L (exon 10)
Total23
Association between c-KIT mutation and clinical and haematological characteristics

c-KIT mutations were detected in 3/9 (33.3%) patients with t(8;21) and in 4/14 (28.6%) patients with inv(16). No significant difference in c-KIT mutation was found between cases with t(8;21) or inv(16) alone and cases with additional cytogenetic aberrations (Tables III and IV).

Table III

Association between c-KIT mutations and t(8;21) AML (N=9).

Table III

Association between c-KIT mutations and t(8;21) AML (N=9).

No. of casest(8;21) alonet(8;21) plus additional cytogenetic abnormalitiesP-value
Mutation3210.58
No mutation651
Total972

Table IV

Association between c-KIT mutations and inv(16) AML (N=14).

Table IV

Association between c-KIT mutations and inv(16) AML (N=14).

No. of casesinv(16) aloneinv(16) plus additional cytogenetic abnormalitiesP-value
Mutation4220.45
No mutation1073
Total1495

c-KIT mutation status was not associated with gender, age, white blood cell and platelet count, percentage of peripheral blood and bone marrow blasts at diagnosis, cytogenetic risk groups and WT1 levels. Also, no association was found for the achievement of complete remission (CR), although the two patients who did not achieve CR were non-mutated. On the contrary, lactate dehydrogenase (LDH) levels were higher (1386 UI/l) in c-KIT mutated than in non-mutated patients (753 UI/l; P=0.01) (Table V).

Table V

Association between c-KIT mutation and clinical and haematological characteristics in CBF AML (N=23).

Table V

Association between c-KIT mutation and clinical and haematological characteristics in CBF AML (N=23).

c-KIT mutated (n=7)c-KIT non mutated (n=16)


VariablesNo. of casesMean ± SDMean ± SDP-value
Age (years)2351±11.239±13.40.06
WBC count (x109/l)2334.045±33.921.702±19.9180.3
Plt count (x109/l)2330.428±31.32046.133±24.0230.2
LDH (UI/l)231,386±629753±3120.01
PB blasts (%)2348.43±23.0454.92±19.670.5
BM blasts (%)2348.85±24.8860.64±14.250.17
WT1 (number of WT1 copies/104 ABL copies)1517,307±22,628 (4)15,687±17,780 (11)0.8
Gender
 Male113/78/16
 Female124/78/160.5
Cytogenic risk
 Low186/712/16
 High51/74/160.5
Remission
 Complete remission217/714/16
 No remission20/72/160.5

[i] WBC, white blood cell; Plt, platelet; LDH, lactate dehydrogenase; PB, peripheral blood; BM, bone marrow; WT1, Wilms tumour gene.

Correlation of c-KIT mutation with overall and disease-free survival

In the 23 CBF AML patients OS was significantly longer than in the 226 patients with other types of AML treated at the same institution during the same period; at the 10-year follow-up, 57% of CBF AML patients were alive compared to 24% of patients with all other AML categories (P=0.0004) (Fig. 4).

Figure 4

Overall survival of patients with CBF AML and other types of AML.

No difference in OS was found between inv(16) and t(8;21) CBF AML; after 88 months, 76% of inv(16) and 60% of t(8;21) patients were alive, respectively (P=0.6). However, DFS for inv(16) AML was significantly longer than that for t(8;21) cases; after 88 months, 67% of inv(16) patients were free of the disease, vs. 20% of those with t(8;21) (P=0.04) (Fig. 5).

Figure 5

Disease-free survival for patients with inv(16) and t(8;21) AML.

No difference in OS was found when CBF AML patients were categorised according to c-KIT mutation; after 88 months, 78% of c-KIT non-mutated and 68% of mutated patients were alive, respectively (P=0.9) (Fig. 6). DFS was similar in c-KIT mutated and non-mutated CBF AML patients (P=0.6).

Figure 6

Kaplan-Meier overall survival curves for patients with CBF AML categorised according to c-KIT mutation.

Discussion

Our results showed an overall incidence of c-KIT mutation in 30.4% of cases, as previously reported in adult CBF AML (6), and a better prognosis for CBF AML than for cytogenetically normal or other subtypes of AML, which is in agreement with previous data (19,20). In our study, inv(16) AML had a significantly longer DFS than t(8;21) AML, consistent with previous reports demonstrating that patients with t(8;21) have significantly shorter survival times after relapse than patients with inv(16), possibly related to a lower response to salvage treatment in patients with t(8;21)(10,11,21).

c-KIT mutations in our CBF AMLs were associated with higher LDH levels, suggesting a possible prognostic role. It is well known that high LDH values are associated with a poorer outcome both in AML and myelodysplastic syndromes (MDS) (22–24). This was observed in our study as well; when cases were categorised according to the median LDH value (880 UI/l), all patients with higher LDH values relapsed after 15 months, while 84% of patients with lower LDH values were free of the disease. However, possibly due to the small number of cases, the result is only of borderline significance (P=0.1) (Fig. 7). The association between c-KIT mutation and LDH levels is likely to indicate a more active proliferation in mutated CBF AML.

Figure 7

Kaplan-Meier disease-free survival curves for CBF AML patients categorised according to the median LDH value.

Contrary to most published studies, no association was found in our CBF AML group between c-KIT mutations and achievement of CR, OS and DFS; this may be due to the small number of cases and to considering CBF AML as a single group. Indeed, previous reports showed a prognostic value of c-KIT mutations in t(8;21) but not in inv(16) CBF AML (7,25). Therefore, t(8;21) and inv(16) AML should be regarded as distinct clinical entities to be stratified and reported separately, as already suggested (11), and possibly treated with a tailored approach (26).

Therefore, further studies are required to clarify the prognostic value of c-KIT mutations in newly diagnosed adult AML.

Acknowledgements

This study was supported by grants from the Italian Ministero dell’Università e Ricerca Scientifica e Tecnologica (MURST).

References

1 

Speck NA and Gilliland DG: Core-binding factors in haematopoiesis and leukaemia. Nat Rev Cancer. 2:502–513. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Arber DA, Brunning RD, Le Beau MM, Falini B, Vardiman JW, Porwit A, Thiele J and Bloomfield CD: Acute myeloid leukaemia with recurrent genetic abnormalities. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri S, Stein H, Thiele J and Vardiman JW: 4th edition. IARC Press; Lyon: pp. 110–112. 2008

3 

Mrózek K, Heinonen K, Lawrence D, Carroll AJ, Koduru PR, Rao KW, Strout MP, Hutchison RE, Moore JO, Mayer RJ, Schiffer CA and Bloomfield CD: Adult patients with de novo acute myeloid leukemia and t(9;11)(p22;q23) have a superior outcome to patients with other translocations involving band 11q23: a Cancer and Leukemia Group B Study. Blood. 90:4532–4538. 1997.PubMed/NCBI

4 

Bloomfield CD, Lawrence D, Byrd JC, Carroll A, Pettenati MJ, Tantravahi R, Patil SR, Davey FR, Berg DT, Schiffer CA, Arthur DC and Mayer RJ: Frequency of prolonged remission duration after high-dose cytarabine intensification in acute myeloid leukemia varies by cytogenetic subtype. Cancer Res. 58:4173–4179. 1998.PubMed/NCBI

5 

Grimwade D, Walker H, Oliver F, Wheatley K, Harrison C, Harrison G, Rees J, Hann I, Stevens R, Burnett A and Goldstone A: The importance of diagnostic cytogenetics on outcome in AML: analysis of 1,612 patients entered into the MRC AML 10 trial. The Medical Research Council Adult and Children’s Leukaemia Working Parties. Blood. 92:2322–2333. 1998.PubMed/NCBI

6 

Paschka P, Marcucci G, Ruppert AS, Mrózek K, Chen H, Kittles RA, Vukosavljevic T, Perrotti D, Vardiman JW, Carroll AJ, Kolitz JE, Larson RA and Bloomfield CD; Cancer and Leukemia Group B. Adverse prognostic significance of KIT mutations in adult acute myeloid leukemia with inv(16) and t(8;21): a Cancer and Leukemia Group B Study. J Clin Oncol. 24:3904–3911. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Park SH, Chi HS, Min SK, Park BG, Jang S and Park CJ: Prognostic impact of c-KIT mutations in core binding factor acute myeloid leukemia. Leuk Res. 35:1376–1383. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Baer MR, Stewart CC, Lawrence D, Arthur DC, Byrd JC, Davey FR, Schiffer CA and Bloomfield CD: Expression of the neural cell adhesion molecule CD56 is associated with short remission duration and survival in acute myeloid leukemia with t(8;21)(q22;q22). Blood. 90:1643–1648. 1997.PubMed/NCBI

9 

Delaunay J, Vey N, Leblanc T, Fenaux P, Rigal-Huguet F, Witz F, Lamy T, Auvrignon A, Blaise D, Pigneux A, Mugneret F, Bastard C, Dastugue N, Van den Akker J, Fière D, Reiffers J, Castaigne S, Leverger G, Harousseau JL and Dombret H; French Acute Myeloid Leukemia Intergroup; Groupe Ouest-Est des Leucémies Aiguës Myéoblastiques; Leucémies Aiguës Myéoblastiques de l’Enfant; Acute Leukemia French Association; Bordeaux-Grenoble-Marseille-Toulouse cooperative groups. Prognosis of inv(16)/t(16;16) acute myeloid leukemia (AML): a survey of 110 cases from the French AML Intergroup. Blood. 102:462–469. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Schlenk RF, Benner A, Krauter J, Büchner T, Sauerland C, Ehninger G, Schaich M, Mohr B, Niederwieser D, Krahl R, Pasold R, Döhner K, Ganser A, Döhner H and Heil G: Individual patient data-based meta-analysis of patients aged 16 to 60 years with core binding factor acute myeloid leukemia: a survey of the German Acute Myeloid Leukemia Intergroup. J Clin Oncol. 22:3741–3750. 2004.PubMed/NCBI

11 

Marcucci G, Mrózek K, Ruppert AS, Maharry K, Kolitz JE, Moore JO, Mayer RJ, Pettenati MJ, Powell BL, Edwards CG, Sterling LJ, Vardiman JW, Schiffer CA, Carroll AJ, Larson RA and Bloomfield CD: Prognostic factors and outcome of core binding factor acute myeloid leukemia patients with t(8;21) differ from those of patients with inv(16): a Cancer and Leukemia Group B study. J Clin Oncol. 23:5705–5717. 2005. View Article : Google Scholar : PubMed/NCBI

12 

Marková J, Marková J, Trnková Z, Michková P, Maaloufová J, Starý J, Cetkovský P and Schwarz J: Monitoring of minimal residual disease in patients with core binding factor acute myeloid leukemia and the impact of C-KIT, FLT3, and JAK2 mutations on clinical outcome. Leuk Lymphoma. 50:1448–1460. 2009.PubMed/NCBI

13 

Lasota J, Wozniak A, Sarlomo-Rikala M, Rys J, Kordek R, Nassar A, Sobin LH and Miettinen M: Mutations in exons 9 and 13 of KIT gene are rare events in gastrointestinal stromal tumors. A study of 200 cases. Am J Pathol. 157:1091–1095. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Rubin BP, Singer S, Tsao C, Duensing A, Lux ML, Ruiz R, Hibbard MK, Chen CJ, Xiao S, Tuveson DA, Demetri GD, Fletcher CD and Fletcher JA: KIT activation is a ubiquitous feature of gastrointestinal stromal tumors. Cancer Res. 61:8118–8121. 2001.PubMed/NCBI

15 

Miselli FC, Casieri P, Negri T, Orsenigo M, Lagonigro MS, Gronchi A, Fiore M, Casali PG, Bertulli R, Carbone A, Pierotti MA, Tamborini E and Pilotti S: c-Kit/PDGFRA gene status alterations possibly related to primary imatinib resistance in gastrointestinal stromal tumors. Clin Cancer Res. 13:2369–2377. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Kottaridis PD, Gale RE and Linch DC: Flt3 mutations and leukaemia. Br J Haematol. 122:523–538. 2003. View Article : Google Scholar : PubMed/NCBI

17 

Thiede C, Koch S, Creutzig E, Steudel C, Illmer T, Schaich M and Ehninger G: Prevalence and prognostic impact of NPM1 mutations in 1485 adult patients with acute myeloid leukemia (AML). Blood. 107:4011–4020. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, Sanders MA, Hugens W, Uitterlinden AG, Erpelinck CA, Delwel R, Löwenberg B and Valk PJ: Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML): association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance. Blood. 106:3747–3754. 2005. View Article : Google Scholar

19 

Gulley ML, Shea TC and Fedoriw Y: Genetic tests to evaluate prognosis and predict therapeutic response in acute myeloid leukemia (Review). J Mol Diagn. 12:3–16. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Sangle NA and Perkins SL: Core-binding factor acute myeloid leukemia. Arch Pathol Lab Med. 135:1504–1509. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Appelbaum FR, Kopecky KJ, Tallman MS, Slovak ML, Gundacker HM, Kim HT, Dewald GW, Kantarjian HM, Pierce SR and Estey EH: The clinical spectrum of adult acute myeloid leukaemia associated with corebinding factor translocations. Br J Haematol. 135:165–173. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Kern W, Haferlach T, Schoch C, Loffler H, Gassmann W, Heinecke A, Sauerland MC, Berdel W, Buchner T and Hiddemann W: Early blast clearance by remission induction therapy is a major independent prognostic factor for both achievement of complete remission and long-term outcome in acute myeloid leukemia: data from the German AML Cooperative Group (AMLCG) 1992 Trial. Blood. 101:64–70. 2003. View Article : Google Scholar

23 

Germing U, Hildebrandt B, Pfeilstöcker M, Nösslinger T, Valent P, Fonatsch C, Lübbert M, Haase D, Steidl C, Krieger O, Stauder R, Giagounidis AA, Strupp C, Kündgen A, Mueller T, Haas R, Gattermann N and Aul C: Refinement of the international prognostic scoring system (IPSS) by including LDH as an additional prognostic variable to improve risk assessment in patients with primary myelodysplastic syndromes (MDS). Leukemia. 19:2223–2231. 2005. View Article : Google Scholar

24 

Spoo AC, Lübbert M, Wierda WG and Burger JA: CXCR4 is a prognostic marker in acute myelogenous leukemia. Blood. 109:786–791. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Boissel N, Leroy H, Brethon B, Philippe N, de Botton S, Auvrignon A, Raffoux E, Leblanc T, Thomas X, Hermine O, Quesnel B, Baruchel A, Leverger G, Dombret H and Preudhomme C; Acute Leukemia French Association (ALFA); Leucémies Aiguës Myéloblastiques de l’Enfant (LAME) Cooperative Groups. Incidence and prognostic impact of c-Kit, FLT3, and Ras gene mutations in core binding factor acute myeloid leukemia (CBF-AML). Leukemia. 20:965–970. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Dombret H, Preudhomme C and Boissel N: Core binding factor acute myeloid leukemia (CBF-AML): is high-dose Ara-C (HDAC) consolidation as effective as you think? Curr Opin Hematol. 16:92–97. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Riera L, Marmont F, Toppino D, Frairia C, Sismondi F, Audisio E, Di Bello C, D'Ardia S, Di Celle PF, Messa E, Messa E, et al: Core binding factor acute myeloid leukaemia and c-KIT mutations. Oncol Rep 29: 1867-1872, 2013.
APA
Riera, L., Marmont, F., Toppino, D., Frairia, C., Sismondi, F., Audisio, E. ... Pich, A. (2013). Core binding factor acute myeloid leukaemia and c-KIT mutations. Oncology Reports, 29, 1867-1872. https://doi.org/10.3892/or.2013.2328
MLA
Riera, L., Marmont, F., Toppino, D., Frairia, C., Sismondi, F., Audisio, E., Di Bello, C., D'Ardia, S., Di Celle, P. F., Messa, E., Inghirami, G., Vitolo, U., Pich, A."Core binding factor acute myeloid leukaemia and c-KIT mutations". Oncology Reports 29.5 (2013): 1867-1872.
Chicago
Riera, L., Marmont, F., Toppino, D., Frairia, C., Sismondi, F., Audisio, E., Di Bello, C., D'Ardia, S., Di Celle, P. F., Messa, E., Inghirami, G., Vitolo, U., Pich, A."Core binding factor acute myeloid leukaemia and c-KIT mutations". Oncology Reports 29, no. 5 (2013): 1867-1872. https://doi.org/10.3892/or.2013.2328
Copy and paste a formatted citation
x
Spandidos Publications style
Riera L, Marmont F, Toppino D, Frairia C, Sismondi F, Audisio E, Di Bello C, D'Ardia S, Di Celle PF, Messa E, Messa E, et al: Core binding factor acute myeloid leukaemia and c-KIT mutations. Oncol Rep 29: 1867-1872, 2013.
APA
Riera, L., Marmont, F., Toppino, D., Frairia, C., Sismondi, F., Audisio, E. ... Pich, A. (2013). Core binding factor acute myeloid leukaemia and c-KIT mutations. Oncology Reports, 29, 1867-1872. https://doi.org/10.3892/or.2013.2328
MLA
Riera, L., Marmont, F., Toppino, D., Frairia, C., Sismondi, F., Audisio, E., Di Bello, C., D'Ardia, S., Di Celle, P. F., Messa, E., Inghirami, G., Vitolo, U., Pich, A."Core binding factor acute myeloid leukaemia and c-KIT mutations". Oncology Reports 29.5 (2013): 1867-1872.
Chicago
Riera, L., Marmont, F., Toppino, D., Frairia, C., Sismondi, F., Audisio, E., Di Bello, C., D'Ardia, S., Di Celle, P. F., Messa, E., Inghirami, G., Vitolo, U., Pich, A."Core binding factor acute myeloid leukaemia and c-KIT mutations". Oncology Reports 29, no. 5 (2013): 1867-1872. https://doi.org/10.3892/or.2013.2328
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team