Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
June 2013 Volume 29 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June 2013 Volume 29 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Arecoline suppresses HaCaT cell proliferation through cell cycle regulatory molecules

  • Authors:
    • Zhong-Su Zhou
    • Ming Li
    • Feng Gao
    • Jie-Ying Peng
    • Hai-Bo Xiao
    • Li-Xia Dai
    • Shi-Rong Lin
    • Rui Zhang
    • Long-Yu Jin
  • View Affiliations / Copyright

    Affiliations: Changsha Stomatological Hospital, Changsha, Hunan, P.R. China, The Third Xiangya Hospital of Central South University, Changsha, Hunan, P.R. China, Xiangya Hospital of Central South University, Changsha, Hunan, P.R. China, Taiwan Taipei Dental Sciences, Taipei, Taiwan, R.O.C.
  • Pages: 2438-2444
    |
    Published online on: March 22, 2013
       https://doi.org/10.3892/or.2013.2360
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Betel nut chewing is the most common cause of oral submucous fibrosis (OSF). Arecoline is the main component of the betel nut, and is associated with the occurrence and development of OSF through cytotoxicity, genotoxicity and DNA damage. Similar types of stimuli elicit differential responses in different cells. In the present study, we investigated the effects of arecoline on the HaCaT epithelial and Hel fibroblast cell lines. The data showed that arecoline affected HaCaT cell morphology. MTT assay revealed that arecoline suppressed HaCaT cell proliferation. Furthermore, we found that arecoline induced the cell cycle arrest of HaCaT cells. In comparison with the untreated control cells, following treatment with ≥75 µg/ml arecoline an increased percentage of HaCaT cells remained at the G0/G1 phase of the cell cycle, accompanied by a reduced percentage of cells in the S phase. However, arecoline treatment did not significantly alter Hel cell cycle distribution. In the HaCaT epithelial cells, arecoline downregulated expression of the G1/S phase regulatory proteins cyclin D1, CDK4, CDK2, E2F1 as determined by reverse transcription-PCR analysis and western blotting. In summary, arecoline inhibits HaCaT epithelial cell proliferation and survival, in a dose-dependent manner, and cell cycle arrest in the G1/S phase, while this is not obvious in the Hel fibroblast cells. Potentially, our findings may aid in the prevention of arecoline-associated human OSF.

Introduction

Oral submucous fibrosis (OSF) is a chronic insidious disease predisposing to cancer. The rate of carcinoma incidence in OSF cases reaches up to 7.6%. Areca nut (betel) chewing is one of the primary etiologic factors for OSF and carcinogenesis. The areca nut is indentified as a first class carcinogen by IARC (1,2). Histologically, most OSF is characterized by epithelial atrophy and progressive accumulation of collagen fibers in the lamina propria while a minority is characterized by epithelial atypical hyperplasia. In tissues with OSF-associated carcinogenesis, both epithelial atrophy and atypical epithelia can exist or coexist. There is abnormal expression of proteins related to cell cycle arrest and apoptosis in OSF and in tissues showing carcinogenesis. The role and mechanism of arecoline in epithelial atrophy and epithelial hyperplasia require further investigation (3–10).

Eukaryotic cell division is a precise and orderly process with multi-factorial controls. The cell cycle can be divided into the four phases known as G1, S, G2 and M, with two important restriction points. The restriction points are G1/S and G2/M phase, and only across these two limiting points can there be final completion of cell replication and division. Normal cells with DNA damage and cells affected by other external stimuli can undergo G1/S and/or G2/M phase blockage, delaying progression of the cell cycle. Yet, these normal cells win enough time to repair DNA damage before DNA replication and cell division (11). Cyclins and expression of cyclin-dependent-kinase (CDKs) form an active complex which positively regulates the cell cycle. CDK inhibitors (CKIs) combine with CDKs, and inhibit the activity of CDKs, thus playing a role as a negative regulator of the cell cycle. Cyclin D/CDK4/6 complexes are necessary to promote cell cycle through the G1/S phase restriction point. Cyclin E and cyclin A further promote the phosphorylation of Rb, induction of E2F1 in the intracellular accumulation, and promote a series of cyclins and cyclin-dependent protein kinases in the cell across the late G1 phase to S phase. The ultimate target of the G2 checkpoint signaling pathway is the cyclin-dependent kinase (CDK) complex, CDK1-cyclin B1. Deregulation of cell cycle machinery is an important step in malignant transformation. Cyclin D1 is one of the most important proto-oncogenes and cell cycle regulators. Its protein is known as cyclin D1 and is expressed in the G1 phase of the cell cycle (12,13).

Similar types of stimuli elicit different responses in different cells. In the present study, we investigated the effects of arecoline on the HaCaT epithelial and Hel fibroblast cell lines. First, human keratinocyte cells of the HaCaT cell line and human embryo lung fibroblasts of the Hel cell line were treated with high doses of arecoline for a short time to observe the survival rate, cell cycle distribution and apotosis. Secondly, the molecular mechanism of epithelium atrophy induced by arecoline was studied.

Materials and methods

Cell lines

Keratinocytes of the naturally immortalized normal cell line, HaCaT, were obtained from the Laboratory of Apoptosis, College of Life Science, Hunan Normal University, China. The human embryonic lung fibroblast cell line (human normal fibroblast cell line), Hel, was established by the Laboratory of Molecular Virology, College of Life Science, Hunan Normal University, China (14).

Cell proliferation assay

The impact of arecoline treatment on cell proliferation was measured by the MTT assay as described previously (15). Briefly, keratinocytes from the natural immortalized normal cells, HaCaT, and human embryonic lung fibroblast cells, Hel, (104 cells/well) were cultured in triplicate with 10% FCS RPMI-1640 in 96-well plates in the presence or absence of 25, 50, 75, 100 and 125 μg/ml arecoline for 0, 24, 48 and 72 h, respectively. The cells were then exposed to 5 mg/ml MTT for 4 h. The generated formazan was dissolved with dimethyl sulfoxide, and the absorbance was measured at 570 nm using an ELX-800 microplate reader (Bio Tek Instruments, Inc., Winooski, VT, USA).

Flow cytometric analysis of the cell cycle

The previously described keratinocytes and lung fibroblast cells were cultured in 10% FCS RPMI-1640 to ~70% confluence and then treated with, or without, 25, 50, 75, 100 and 125 μg/ml arecoline for 12 h, respectively. The adherent cells were trypsinized, harvested and fixed in 70% ethanol at 4°C. Subsequently, the cells were washed with cold PBS and stained with propidium iodide (PI) in working solution (0.5 mg/ml RNase, and 0.1 mg/ml PI in PBS). The cell cycle was characterized by flow cytometric analysis using a FACScan cytofluorimeter, and the data were analyzed by the CellQuest Pro Software (Becton-Dickinson, San Jose, CA. USA).

Reverse transcription-PCR analysis

Both cell lines were cultured in RPMI-1640 to 80% confluence and then treated with, or without, 25, 50, 75, 100 and 125 μg/ml arecoline for 12 h, respectively. The cells were harvested, and their total RNA was extracted. One microgram total RNA was reversely transcripted into cDNA, as described previously (15,16) and was subsequently used as the template for PCR reaction. The first step in the PCR reaction involved denaturing at 94°C for 5 min, followed by 30 cycles of 94°C for 45 sec, 55°C for 45 sec, and 72°C for 1 min, followed by 72°C for 7 min for CDK2, CDK4, cyclin A, cyclin B, cyclin D1, cyclin E, E2F1 and CDC2. The primers CDK2, CDK4, cyclin A, cyclin B, cyclin D1, cyclin E, E2F1, CDC2 and β-actin were synthesized as shown in Table I. All RT-PCR reactions were repeated at least three times with varying cycle numbers to avoid potentially false results. β-actin was used as an endogenous control for normalization. The PCR products were analyzed by agarose-gel electrophoresis and ethidium bromide staining.

Table I

Sequences of the primers for RT-PCR.

Table I

Sequences of the primers for RT-PCR.

GeneForward primerReverse primerProduct (bp)
CDK2 CCTGGAGATTCTGAGATTGA GGGAAACTTGGCTTGTAAT113
CDK4 GCATCCCAATGTTGTCCG AGGCAGCCCAATCAGGTC499
Cyclin A CCTGCGTTCACCATTCAT TCTTCTCCTACTTCAACTAACC383
Cyclin B TTGGTTGATACTGCCTCTC TCTGACTGCTTGCTCTTC204
Cyclin D1 GAACAGAAGTGCGAGGAG GCGGTAGTAGGACAGGAA477
Cyclin E TGGATGTTGACTGCCTTG TCTATGTCGCACCACTGA115
E2F1 CACTGAATCTGACCACCAA ACCATAACCATCTGCTCTG400
CDC2 AGAGTTCTTCACAGAGACT GGATGATTCAGTGCCATT488
β-actin CCGTGACCTGACTGACTACCTC ATACCGCAAGATTCCATACCC276

[i] RT-PCR, reverse transcription-PCR; CDK2, cyclin-dependent kinase 2; CDK4, cyclin-dependent kinase 4.

Western blotting

The ketatinocytes and the epithelial cells were cultured in RPMI-1640 up to 80% confluence and then treated with, or without, 25, 50, 75, 100 and 125 μg/ml arecoline for 12 h, respectively. The cells were harvested and lysed in the lysis buffer [1% Nonidet P-40, 50 mM Tris-HCl, pH 7.5, 50 mM NaF, 2 mM EDTA, 400 mM NaCl, 10% glycerol plus complete protease inhibitor mixture (Roche Diagnostics)]. The protein concentrations were determined using the bicinchoninic acid protein assay kit (Pierce Chemical, Rockford, IL, USA). The cell lysates (50 μg) from individual samples were separated by SDS-PAGE and transferred onto nitrocellulose membranes (HyClone Laboratories, Logan, UT, USA). The membranes were blocked with 5% nonfat milk in Tris-buffered saline/Tween-20 (25 mM Tris-HCl, 150 mM NaCl, pH 7.5, and 0.05% Tween-20) and probed with the primary antibody overnight at 4°C. After washing with Tris-buffered saline/Tween-20 three times, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), and the specific signals were visualized using ECL detection system. Antibodies against cyclin D1, CDK4, CDK2, E2F1, cyclin B, CDC2, cyclin A and cyclin E were purchased from Cell Signaling Technology Inc. (Beverly, MA, USA).

Statistical analysis

Differences in nonparametric variables were analyzed by the Fisher's exact test using the EPI software (EPI Info, version 3.2.2, www.CDC.gov/epiinfo/). Differences in the quantitative variables between groups were analyzed by the Student's t-test using SPSS 11.0 program (SPSS, Chicago, IL, USA). A P-value <0.05 was considered to indicate a statistically significant result.

Results

Effect of arecoline on HaCaT cell morphology

The HaCaT cell morphology was significantly altered following treatment of arecoline at different concentrations after 48 h. The outlines of the HaCaT cells were clear when treated with 0 and 25 μg/ml, but when the concentration of arecoline increased to 50 μg/ml, the boundaries of the HaCaT cells became indistinct and some of the cells were dead. There was massive cell death and a lack of boundaries between the cells when the concentration of arecoline was increased to 75, 100 and 125 μg/ml (Fig. 1). In contrast, the Hel cells were less affected by arecoline treatment. Only when the concentration of arecoline was increased to 100 and 125 μg/ml, did the Hel cell morphology begin to change slightly (Fig. 2).

Figure 1

Arecoline affects the morphology of HaCaT epithelial cells, and promotes cell death in a dose-dependent manner. Concentrations of arecoline: (A) 0 μg/ml, (B) 25 μg/ml, (C) 50 μg/ml, (D) 75 μg/ml, (E) 100 μg/ml and (F) 125 μg/ml (magnification, ×100).

Figure 2

Effect of arecoline on the cell morphology of Hel cells. Concentrations of arecoline: (A) 0 μg/ml, (B) 25 μg/ml, (C) 50 μg/ml, (D) 75 μg/ml, (E) 100 μg/ml and (F) 125 μg/ml (magnification, ×100).

Arecoline suppresses HaCaT cell proliferation

To further test whether arecoline modulates HaCaT cell growth, HaCaT and Hel cells were treated with 0, 25, 50, 75, 100 and 125 μg/ml arecoline, and their spontaneous proliferation was determined by MTT assays. Treatment with arecoline significantly inhibited the proliferation of HaCaT cells (Fig. 3A), but only slightly reduced Hel cell growth in vitro (Fig. 3B). Therefore, treatment with arecoline inhibited the proliferation of epithelial cells, but not fibroblasts in vitro.

Figure 3

(A) Arecoline inhibits epithelial cell proliferation (HaCaT). (B) Effect of arecoline treatment on the viability of fibroblast cells (Hel).

Arecoline induces the cell cycle arrest of HaCaT cells

Inhibition of cell proliferation usually is mediated by inducing cell cycle arrest. To test this possibility, HaCaT and Hel cells were treated with 0, 25, 50, 75, 100 and 125 μg/ml arecoline and the cell cycle distribution was determined by FACS analysis (Tables II and III). In comparison to the control cells without arecoline treatment, following treatment with ≥75 μg/ml arecoline a higher percentage of HaCaT cells remained at the G0/G1 phase of the cell cycle (from 49.02 to 73.00%) at 12 h, accompanied by a reduced percentage of cells in the S phase (from 32.05 to 20.50%). However, arecoline treatment did not significantly alter Hel cell cycling even after treatment with arecoline for 12 h. Hence, these data demonstrate that arecoline treatment induces cell cycle arrest by inhibiting the G1 to S phase transition of the cell cycle in epithelial cells in vitro.

Table II

Flow cytometric analysis of HaCaT cells following treatment with different concentrations of arecoline.

Table II

Flow cytometric analysis of HaCaT cells following treatment with different concentrations of arecoline.

Phase of the cell cyclea

Treatment G0-G1 (%)S (%)G2-M (%)
Arecoline (μg/ml)
049.0232.0518.93
2551.0631.9417.00
5053.6230.6915.69
7573.0020.506.50
10091.235.613.16
12589.675.135.20

a Numbers indicate the percentage of cells in the different phases of the cell cycle.

Table III

Flow cytometric analysis of Hel cells following treatment with different concentrations of arecoline.

Table III

Flow cytometric analysis of Hel cells following treatment with different concentrations of arecoline.

Phase of the cell cyclea

Treatment G0-G1 (%)S (%)G2-M (%)
Arecoline (μg/ml)
052.5233.3514.13
2549.0934.0216.89
5050.0430.1719.79
7551.7530.2118.04
10054.0231.6414.34
12554.8630.9214.22

a Numbers indicate the percentage of cells in the different phases of the cell cycle.

Arecoline regulates the transcription level of cell cycle regulatory molecules in the HaCaT epithelial cells

To reveal the possible mechanism of the effect of arecoline on epithelial cells in vitro, the levels of mRNA transcripts of several cell cycle regulatory molecules (CDK2, CDK4, cyclin A, cyclin B, cyclin D1, cyclin E, E2F1, CDC2) were determined by semi-quantitative RT-PCR. Cyclin D1 mRNA expression was downregulated following arecoline stimulation, while there was no significant concentration gradient dependence. The mRNA expression of cyclin B was upregulated. Low concentrations of arecoline stimulated CDK4 expression. However, its expression was suppressed following treatment with high concentrations of arecoline. Cyclin A expression level was increased in the HaCaT cells following treatment with arecoline. Cyclin E expression level was decreased with an increase in arecoline concentrations. CDK2 had the same tendency as cyclin E. There was no significant difference in CDC2 levels (Fig. 4).

Figure 4

Arecoline regulates the transcription level of cell cycle regulatory molecules in the epithelial HaCaT cells.

Arecoline regulates the protein levels of cell cycle regulatory molecules in the HaCaT epithelial cells

To confirm the change mechanism of cell cycle regulatory molecules, we tested the protein levels of CDK2, CDK4, cyclin A, cyclin B, cyclin D1, cyclin E, E2F1 and CDC2 by western blotting. The expression levels of cyclin D1, CDK4, CDK2 and E2F1 were significantly downregulated. Expression of cyclin A and cyclin E was slightly upregulated in HaCaT cells following arecoline stimulation. There was no significant difference in cyclin B and CDC2 expression (Fig. 5).

Figure 5

Arecoline affects the protein expression level of cell cycle regulatory molecules in HaCaT epithelial cells. Lane 1, 0 μg/ml arecoline; lane 2, 25 μg/ml; lane 3, 50 μg/ml; lane 4, 75 μg/ml; lane 5, 100 μg/ml; lane 6, 125 μg/ml.

Discussion

Betel nut chewing is the most common cause of OSF. Arecoline is the main component of the betel nut, and it is associated with the occurrence and development of OSF through cytotoxicity, genotoxicity and DNA damage. Arecoline inhibits oral keratinocytes and vascular endothelial cell growth (17,18). However, using identical arecoline stimulation, OSF epithelial tissues became atrophic and presented vascular occlusion, and showed the beginning of the accumulation of fibroblasts and collagen fibers. Similar types of stimuli elicit differential responses in different cell types. In the present study, we studied the effects of arecoline on HaCaT epithelial cells and Hel fibroblasts.

Our data demonstrated the effects of arecoline on HaCaT cell morphology. The cell morphologies were significantly different dependent on the arecoline concentration after 48 h of treatment. In contrast, the Hel cells showed no effects following arecoline treatment. MTT assay revealed that arecoline suppressed HaCaT cell proliferation. Treatment with arecoline significantly inhibited the proliferation of HaCaT cells, but only slightly reduced Hel cell growth in vitro. Therefore, treatment with arecoline inhibited the proliferation of epithelial cells, but not fibroblasts, in vitro. Our results confirmed our hypothesis: different cells have differential responses to similar types of stimuli.

Cell cycle checkpoints are biochemical pathways that ensure the orderly and timely progression and completion of critical events, such as DNA replication and chromosome segregation (9,19). In the present study, we found that arecoline induced HaCaT cell cycle arrest. In comparison with control cells without arecoline treatment, following treatment with ≥75 μg/ml arecoline a higher percentage of HaCaT cells remained at the G0/G1 phase of the cell cycle, accompanied by a reduced percentage of cells in the S phase. However, arecoline treatment did not significantly alter Hel cell cycling. Huang et al(13) found that arecoline decreased interleukin-6 production and induced apoptosis and cell cycle arrest in human basal cell carcinoma cells. Arecoline, a major alkaloid of the areca nut, was found to inhibit p53, repress DNA repair, and trigger DNA damage response in human epithelial cells (21). Cyclin D1 expression and its possible regulation in chewing tobacco have been shown to mediate oral squamous cell carcinoma progression (22).

To reveal the possible mechanism of arecoline effect on epithelial cells in vitro, the levels of mRNA transcripts of cell cycle regulatory molecules were determined by semi-quantitative RT-PCR and western blotting. Short-term high-dose arecoline exerted little effect on Hel fibroblast cell growth, but significantly inhibited HaCaT epithelial cell growth and arrested HaCaT cells at the G1/S phase, which was mainly through decreased protein expression and gene transcription of cyclin D1, CDK4, CDK2, E2F1, but had no obvious effects on cyclin B/CDC2 which is related to the G2/M phase. Thus, epithelial atrophy in OSF is mainly attibuted to cell cycle arrest and imbalance of proliferation and apoptosis induced by arecoline. Studies have shown that expression of the transcription factor E2F1 was increased in tumors and proliferative diseases (11,17,18,23–25). When cells cross the G1/S restriction point, the cell cycle path becomes irreversible with autonomy until the end of the cell cycle (26–29). Arecoline had no significant effect on fibroblasts in the G1/S phase, which may explain the reasons for subcutaneous fibroblast proliferation-induced submucosa collagen accumulation (28,29).

In summary, arecoline inhibits HaCaT epithelial cell proliferation and survival, in a dose-dependent manner with cell cycle arrest in the G1/S phase, while this observation is not obvious in Hel fibroblast cells. Arecoline downregulates the expression of G1/S phase regulatory proteins cyclin D1, CDK4, CDK2 and E2F1 in HaCaT epithelial cells. Potentially, our findings may aid in the prevention of arecoline-associated human OSF.

Figure 1

Arecoline affects the morphology of HaCaT epithelial cells, and promotes cell death in a dose-dependent manner. Concentrations of arecoline: (A) 0 μg/ml, (B) 25 μg/ml, (C) 50 μg/ml, (D) 75 μg/ml, (E) 100 μg/ml and (F) 125 μg/ml (magnification, ×100).

Figure 2

Effect of arecoline on the cell morphology of Hel cells. Concentrations of arecoline: (A) 0 μg/ml, (B) 25 μg/ml, (C) 50 μg/ml, (D) 75 μg/ml, (E) 100 μg/ml and (F) 125 μg/ml (magnification, ×100).

Figure 3

(A) Arecoline inhibits epithelial cell proliferation (HaCaT). (B) Effect of arecoline treatment on the viability of fibroblast cells (Hel).

Figure 4

Arecoline regulates the transcription level of cell cycle regulatory molecules in the epithelial HaCaT cells.

Figure 5

Arecoline affects the protein expression level of cell cycle regulatory molecules in HaCaT epithelial cells. Lane 1, 0 μg/ml arecoline; lane 2, 25 μg/ml; lane 3, 50 μg/ml; lane 4, 75 μg/ml; lane 5, 100 μg/ml; lane 6, 125 μg/ml.

Table I

Sequences of the primers for RT-PCR.

Table I

Sequences of the primers for RT-PCR.

GeneForward primerReverse primerProduct (bp)
CDK2 CCTGGAGATTCTGAGATTGA GGGAAACTTGGCTTGTAAT113
CDK4 GCATCCCAATGTTGTCCG AGGCAGCCCAATCAGGTC499
Cyclin A CCTGCGTTCACCATTCAT TCTTCTCCTACTTCAACTAACC383
Cyclin B TTGGTTGATACTGCCTCTC TCTGACTGCTTGCTCTTC204
Cyclin D1 GAACAGAAGTGCGAGGAG GCGGTAGTAGGACAGGAA477
Cyclin E TGGATGTTGACTGCCTTG TCTATGTCGCACCACTGA115
E2F1 CACTGAATCTGACCACCAA ACCATAACCATCTGCTCTG400
CDC2 AGAGTTCTTCACAGAGACT GGATGATTCAGTGCCATT488
β-actin CCGTGACCTGACTGACTACCTC ATACCGCAAGATTCCATACCC276

[i] RT-PCR, reverse transcription-PCR; CDK2, cyclin-dependent kinase 2; CDK4, cyclin-dependent kinase 4.

Table II

Flow cytometric analysis of HaCaT cells following treatment with different concentrations of arecoline.

Table II

Flow cytometric analysis of HaCaT cells following treatment with different concentrations of arecoline.

Phase of the cell cyclea

Treatment G0-G1 (%)S (%)G2-M (%)
Arecoline (μg/ml)
049.0232.0518.93
2551.0631.9417.00
5053.6230.6915.69
7573.0020.506.50
10091.235.613.16
12589.675.135.20

a Numbers indicate the percentage of cells in the different phases of the cell cycle.

Table III

Flow cytometric analysis of Hel cells following treatment with different concentrations of arecoline.

Table III

Flow cytometric analysis of Hel cells following treatment with different concentrations of arecoline.

Phase of the cell cyclea

Treatment G0-G1 (%)S (%)G2-M (%)
Arecoline (μg/ml)
052.5233.3514.13
2549.0934.0216.89
5050.0430.1719.79
7551.7530.2118.04
10054.0231.6414.34
12554.8630.9214.22

a Numbers indicate the percentage of cells in the different phases of the cell cycle.

Acknowledgements

The study was supported by the International Cooperation Program Funds of the China Hunan Provincial Science and Technology Department (project no. 2012WK4005) and the Research Programe from the Science and Technology Department of Hunan Province, China (project no. 2012FJ4076). We would like to thank Dr Fred Bogott for his excellent English editing of the manuscript.

Abbreviations:

OSF

oral submucous fibrosis

MTT

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

E2F1

E2F transcription factor 1

CDK4

cyclin-dependent kinase 4

CDK2

cyclin-dependent kinase 2

References

1 

Chaturvedi P, Vaishampayan SS, Nair S, et al: Oral squamous cell carcinoma arising in background of oral submucous fibrosis: A clinicopathologically distinct disease. Head Neck. Sep 13–2012.(Epub ahead of print). View Article : Google Scholar

2 

Mehrotra D and Kumar S, Agarwal GG, Asthana A and Kumar S: Odds ratio of risk factors for oral submucous fibrosis in a case control model. Br J Oral Maxillofac Surg. Aug 27–2012.(Epub ahead of print).

3 

Khan S, Chatra L, Prashanth SK, Veena KM and Rao PK: Pathogenesis of oral submucous fibrosis. J Cancer Res Ther. 8:199–203. 2012. View Article : Google Scholar

4 

Kothari MC, Hallur N, Sikkerimath B, Gudi S and Kothari CR: Coronoidectomy, masticatory myotomy and buccal fat pad graft in management of advanced oral submucous fibrosis. Int J Oral Maxillofac Surg. 41:1416–1421. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Ranganathan K and Kavitha R: Proliferation and apoptosis markers in oral submucous fibrosis. J Oral Maxillofac Pathol. 15:148–153. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Khan I, Agarwal P, Thangjam GS, Radhesh R, Rao SG and Kondaiah P: Role of TGF-β and BMP7 in the pathogenesis of oral submucous fibrosis. Growth Factors. 29:119–127. 2011.

7 

Tadakamadla J, Kumar S and Mamatha GP: Evaluation of serum copper and iron levels among oral submucous fibrosis patients. Med Oral Patol Oral Cir Bucal. 16:e870–e873. 2011. View Article : Google Scholar

8 

Wang YC, Tsai YS, Huang JL, et al: Arecoline arrests cells at prometaphase by deregulating mitotic spindle assembly and spindle assembly checkpoint: implication for carcinogenesis. Oral Oncol. 46:255–262. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Lee PH, Chang MC, Chang WH, et al: Prolonged exposure to arecoline arrested human KB epithelial cell growth: regulatory mechanisms of cell cycle and apoptosis. Toxicology. 220:81–89. 2006.PubMed/NCBI

10 

Lu SY, Chang KW, Liu CJ, Tseng YH, Lu HH, Lee SY and Lin SC: Ripe areca nut extract induces G1 phase arrests and senescence-associated phenotypes in normal human oral keratinocyte. Carcinogenesis. 27:1273–1284. 2006.PubMed/NCBI

11 

Tu HF, Liu CJ, Chang CS, Lui MT, Kao SY, Chang CP and Liu TY: The functional (−1171 5A→6A) polymorphisms of matrix metalloproteinase 3 gene as a risk factor for oral submucous fibrosis among male areca users. J Oral Pathol Med. 35:99–103. 2006.

12 

Chiu CJ, Chiang CP, Chang ML, et al: Association between genetic polymorphism of tumor necrosis factor-alpha and risk of oral submucous fibrosis, a pre-cancerous condition of oral cancer. J Dent Res. 80:2055–2059. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Huang LW, Hsieh BS, Cheng HL, Hu YC, Chang WT and Chang KL: Arecoline decreases interleukin-6 production and induces apoptosis and cell cycle arrest in human basal cell carcinoma cells. Toxicol Appl Pharmacol. 258:199–207. 2012. View Article : Google Scholar

14 

Tsai YS, Lee KW, Huang JL, et al: Arecoline, a major alkaloid of areca nut, inhibits p53, represses DNA repair, and triggers DNA damage response in human epithelial cells. Toxicology. 249:230–237. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Mishra R and Das BR: Cyclin D1 expression and its possible regulation in chewing tobacco mediated oral squamous cell carcinoma progression. Arch Oral Biol. 54:917–923. 2009. View Article : Google Scholar

16 

Liu L, Xie H, Chen X, Shi W, Xiao X, Lei D and Li J: Differential response of normal human epidermal keratinocytes and HaCaT cells to hydrogen peroxide-induced oxidative stress. Clin Exp Dermatol. 37:772–780. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Zhou Y, Zeng Z, Zhang W, et al: Lactotransferrin: a candidate tumor suppressor-Deficient expression in human nasopharyngeal carcinoma and inhibition of NPC cell proliferation by modulating the mitogen-activated protein kinase pathway. Int J Cancer. 123:2065–2072. 2008. View Article : Google Scholar

18 

Zhou Y, Zeng Z, Zhang W, et al: Identification of candidate molecular markers of nasopharyngeal carcinoma by microarray analysis of subtracted cDNA libraries constructed by suppression subtractive hybridization. Eur J Cancer Prev. 17:561–571. 2008. View Article : Google Scholar

19 

Kuo FC, Wu DC, Yuan SS, et al: Effects of arecoline in relaxing human umbilical vessels and inhibiting endothelial cell growth. J Perinat Med. 33:399–405. 2005.PubMed/NCBI

20 

Bartek J, Lukas J and Bartkova J: Perspective: defects in cell cycle control and cancer. J Pathol. 187:95–99. 1999. View Article : Google Scholar

21 

Malumbres M: Cyclins and related kinases in cancer cells. J BUON. 12(Suppl 1): S45–S52. 2007.

22 

van den Heuvel S: Cell-cycle regulation. WormBook. 1–16. 2005.

23 

Chen HZ, Tsai SY and Leone G: Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9:785–797. 2009.PubMed/NCBI

24 

Kwong RA, Nguyen TV, Bova RJ, et al: Overexpression of E2F-1 is associated with increased disease-free survival in squamous cell carcinoma of the anterior tongue. Clin Cancer Res. 9:3705–3711. 2003.

25 

Luo X, Pan Q, Liu L, et al: Genomic and proteomic profiling II: comparative assessment of gene expression profiles in leiomyomas, keloids and surgically-induced scars. Reprod Biol Endocrinol. 5:352007. View Article : Google Scholar : PubMed/NCBI

26 

Calonge TM and O'Connell MJ: Turning off the G2 DNA damage checkpoint. DNA Repair. 7:136–140. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Miyazaki T and Arai S: Two distinct controls of mitotic cdk1/cyclin B1 activity requisite for cell growth prior to cell division. Cell Cycle. 6:1419–1425. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Yu Y, Kovacevic Z and Richardson DR: Tuning cell cycle regulation with an iron key. Cell Cycle. 6:1982–1994. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Nakayama KI and Nakayama K: Ubiquitin ligases: cell-cycle control and cancer. Nat Rev Cancer. 6:369–381. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhou Z, Li M, Gao F, Peng J, Xiao H, Dai L, Lin S, Zhang R and Jin L: Arecoline suppresses HaCaT cell proliferation through cell cycle regulatory molecules. Oncol Rep 29: 2438-2444, 2013.
APA
Zhou, Z., Li, M., Gao, F., Peng, J., Xiao, H., Dai, L. ... Jin, L. (2013). Arecoline suppresses HaCaT cell proliferation through cell cycle regulatory molecules. Oncology Reports, 29, 2438-2444. https://doi.org/10.3892/or.2013.2360
MLA
Zhou, Z., Li, M., Gao, F., Peng, J., Xiao, H., Dai, L., Lin, S., Zhang, R., Jin, L."Arecoline suppresses HaCaT cell proliferation through cell cycle regulatory molecules". Oncology Reports 29.6 (2013): 2438-2444.
Chicago
Zhou, Z., Li, M., Gao, F., Peng, J., Xiao, H., Dai, L., Lin, S., Zhang, R., Jin, L."Arecoline suppresses HaCaT cell proliferation through cell cycle regulatory molecules". Oncology Reports 29, no. 6 (2013): 2438-2444. https://doi.org/10.3892/or.2013.2360
Copy and paste a formatted citation
x
Spandidos Publications style
Zhou Z, Li M, Gao F, Peng J, Xiao H, Dai L, Lin S, Zhang R and Jin L: Arecoline suppresses HaCaT cell proliferation through cell cycle regulatory molecules. Oncol Rep 29: 2438-2444, 2013.
APA
Zhou, Z., Li, M., Gao, F., Peng, J., Xiao, H., Dai, L. ... Jin, L. (2013). Arecoline suppresses HaCaT cell proliferation through cell cycle regulatory molecules. Oncology Reports, 29, 2438-2444. https://doi.org/10.3892/or.2013.2360
MLA
Zhou, Z., Li, M., Gao, F., Peng, J., Xiao, H., Dai, L., Lin, S., Zhang, R., Jin, L."Arecoline suppresses HaCaT cell proliferation through cell cycle regulatory molecules". Oncology Reports 29.6 (2013): 2438-2444.
Chicago
Zhou, Z., Li, M., Gao, F., Peng, J., Xiao, H., Dai, L., Lin, S., Zhang, R., Jin, L."Arecoline suppresses HaCaT cell proliferation through cell cycle regulatory molecules". Oncology Reports 29, no. 6 (2013): 2438-2444. https://doi.org/10.3892/or.2013.2360
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team