This article is mentioned in:

Introduction

Acute myeloid leukemia (AML) is defined by an increase in undifferentiated myeloid cells in bone marrow (BM) with abnormal genetic changes, resulting in hematopoietic insufficiency (1). The cells of most leukemias, including AML, interact with the BM microenvironment (BMM), which influences their survival (2). In particular, leukemic blasts after chemotherapy are protected by factors in tumor environments and this may result in a relapse in leukemia. Because alterations in the BMM promote retention and survival of leukemic cells, targeting this niche is regarded as an advanced strategy to eradicate drug-resistant leukemic blasts (3,4). The interaction between hematopoietic cells and the BMM through various factors is critical for regulation of cell homing, proliferation, and differentiation. Several studies have reported that BM stromal cells protect leukemic cells from chemotherapy-induced apoptosis (5,6). Among many factors in the BMM, immune cells participate in crosstalk with hematopoietic stem cells (HSC) (7). The chemokine CXC motif ligand 12 (CXCL12), also known as stromal-derived factor-1 (SDF-1), is a strong attractant that recruits CXC receptor 4 (CXCR4)-expressing hematopoietic cells to BM. The interaction of SDF-1/CXCR4 plays pivotal roles in the cross-interaction between blasts and the BMM to prevent retention and mobilization of leukemic cells (8), as well as in normal hematopoiesis including the development of immune cells (9,10). Plerixafor (Mozobil™) rapidly induces mobilization of hematopoietic stem cells from BM into peripheral circulation by blocking SDF-1/CXCR4 (11,12). Because most primary AML retains a dependency on the BMM, plerixafor can function as a microenvironmental factor in leukemia, decreasing the resistance of leukemic cells by modulating the BMM and directly suppressing malignancies through modulating the expression of CXCR4 (13,14). The correlation between upregulation of CXCR4 after chemotherapy and poor outcomes has been shown by Sison et al (15). In addition, the inhibition of SDF-1/CXCR4 has been shown to enhance the sensitivity of leukemic cells to chemotherapeutic agents, as well as partly abolish their protection by the BMM (13,16). Based on these studies, we examined whether CXCR4 inhibition by plerixafor could activate the killing function of immune cells, resulting in the suppression of blasts in vivo. To answer this question, an established syngeneic leukemic mouse model using C1498 cells (a murine myelogenous leukemia cell line) was used (17). We found that plerixafor did not eradicate the leukemic blasts in vitro; however, it made leukemic blasts more sensitive to cytotoxic chemotherapy with cytosine arabinoside (Ara-C) in vivo, suggesting biological effects on the microenvironment through immune cell activation. Furthermore, we report an additional role for CXCR4 inhibition in tumors as a stimulator of immune cells, except migration capacity. The present study shows that CXCR4 inhibition induces the suppression of AML blasts with chemotherapy by the upregulation of cytokines to kill the cancerous cells. Further, it provides some clues to develop therapeutic strategies involving immune cell activation in the leukemic microenvironment.

Materials and methods

Human primary cells and cell lines

All experiments were performed with authorization from the Institutional Review Board for Human Research at the Catholic University of Korea. AML blood samples were obtained from the Catholic Blood and Marrow Transplantation Center at Seoul St. Mary's Hospital. A total of 19 AML samples were prospectively collected and examined. Mononuclear cells were separated from leukapheresed peripheral blood (LPB) by density gradient centrifugation using Ficoll Paque™ Plus (17-1440-03; GE Healthcare Life Sciences, Piscataway, NJ, USA). The clinical characteristics and experimental information of the AML patients enrolled in the present study are listed in Table I. The human AML cell line, Jurkat (TIB-152™; American Type Culture Collection, ATCC), and the murine AML cell line, C1498 (a murine myelogenous leukemia cell line, TIB-49™; ATCC), were used. All cells were cultured in the proper media at 37°C in a humidified atmosphere of 5% CO2, according to the supplier's suggestions.

Table I Clinical and laboratory features of the primary AML cells.

Table I

Clinical and laboratory features of the primary AML cells.

Patients	FAB subtype	Age at diagnosis	Gender	Cell source	WBC/mm3 at diagnosis	Cytogenetic anomalies
1	M3	53	M	PB	114,980	46,XY,t(15;17)(q22;q12)[20]
2	M4	65	M	PB	185230	46,XY[20]
3	M4	41	F	PB	100260	46,XX,t(6;11)(q27;q23)[30]
4	M4	23	F	PB	177420	48~49,XX,+1,der(1;14)(q10;q10), t(7;11)(q32;p15),+8,+8,t(9;11) (p22;q23),t(12;20)(q12;q13.1), del(19)(p13.1),+mar[cp2]/46,XX[28]
5	M1	48	M	PB	115550	47,XY,+11[29]/46,XY[1]
6	M5	27	M	PB	40	46,XY[20]
7	M3	32	F	PB	53.98	46,XX,t(15;17)(q22;q12)[28]/46,XX[2]
8	M3	28	M	PB	121900	46,XY[20]
9	M1	50	F	PB	123140	46,XX,15ps+[20]
10	M5b	41	F	PB	143720	46,XX,t(6;11)(q27;q23)[20]
11	M5	82	F	PB	109540	46,XX[20]
12	M4	39	M	PB	141200	47,XY,+mar[3]/46,XY[22]
13	M2	25	M	PB	185000	46,XY[20]
14	M4	45	M	PB	71820	46,XY,inv(16)(p13.1q22)[20]
15	M5b	28	F	PB	128020	46,XX,t(6;11)(q27;q23)[19]/46,XX[1]
16	M4	36	F	PB	240640	46,XX[20]
17	M0	58	M	PB	317620	46,XY[20]
18	M1	79	F	PB	207970	46,XX,t(11;12)(p15;q13),del(3)(q12q22)[20]
19	M2	31	F	PB	129700	46,XX[20]

[i] AML, acute myeloid leukemia; FAB, French American British; WBC, white blood cell; PB, peripheral blood.

Leukemic mouse model

C57Bl/6J mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA) and bred under pathogen-free conditions in the Department of Laboratory Animals at the Catholic University of Korea. All of the animal experiments were approved by the Institutional Animal Care and Use Committee of the Catholic University of Korea. For the syngeneic model, 2×106 C1498 cells were suspended in 200 µl phosphate-buffered saline (PBS) and were intravenously injected into the 7-week-old mice. For the treatment, plerixafor (Mozobil™, 2.5 mg/kg; Sanofi Oncology) were subcutaneously injected 2 h before and 2 h after intraperitoneal injection of Ara-C (100 mg/kg; Sigma) into the mice administered C1498 cells, as described in Fig. 3A (schematic diagram). Peripheral blood (PB) was obtained from a facial vein and samples from organs were obtained from the sacrificed mice until day 30 post-injection.

Figure 3 Plerixafor with Ara-C synergistically suppresses the leukemic blasts in vivo. (A) Schematic diagram of the in vivo study. (B) The sections show infiltrated leukemic blasts in tissues including BM, liver, and spleen. Panels clearly show suppression of C1498 infiltration in the P+A group, compared to other groups. Insets (magnification, ×40) show enlargement of cells within the main images (magnification, ×10). (C) Statistical analysis for panel B. Bars represents mean ± SE, and the asterisks depict statistically significant differences compared to the P+A group (**P<0.01; ***P<0.001).

Cell migration assay

Approximately 3×105 C1498 cells and human primary cells were pretreated with serially diluted plerixafor in DMEM with 10% fetal bovine serum (FBS) for 2 h. After washing, total cells were resuspended in 500 µl of Dulbecco's modified Eagle's medium (DMEM) with 1% FBS and placed in the upper chamber of Transwell plates (3 µm membrane pore size; Corning). Inserts were placed in the lower chamber containing the same medium, with or without SDF-1α (100 ng/ml; R&D Systems, Minneapolis, MN, USA). Migration assays were performed at 37°C for 4 h. The migrated cells in the lower chamber were counted by an automated cell counter (Luna™, LB-L10001).

Cell apoptosis assay

C1498 cells (2×105) were pretreated in 0 or 5 µM CXCR4, plerixafor, in DMEM with 10% FBS at 37°C for 2 h. Then, cells were cultured for 24 h at 37°C in DMEM with 10% FBS with or without Ara-C (40 ng/ml) and SDF-1α (100 ng/ml). Annexin V+ apoptotic cells were stained (ApoScan; BioBud) and were counted by flow cytometry.

Flow cytometry

PB, spleen and BM cells were flushed from mouse femurs, suspended in 200 µl of PBS, and incubated with antibodies. After washing, cells were analyzed using a FACSCalibur flow cytometer equipped with CellQuest® software (BD Biosciences, San Diego, CA, USA). The antibodies used to detect mouse cells included FITC-conjugated anti-mouse CD4 (clone: GK1.5, 553729), PE-Cy™5-conjugated anti-mouse CD8 (clone: 53-6.7, 553034), and PE-conjugated anti-mouse NK1.1 (clone: PK136, 553165) (all from BD Pharmingen™), biotin-conjugated anti-mouse CXCR4 (clone: REA107, 130-102-021; Miltenyi Biotec), APC-conjugated streptavidin (17-4317-82; eBioscience), for human cells, APC-conjugated anti-human CXCR4 (clone: 12G5, 555976; BD Pharmingen™). Flow cytometric data were analyzed using appropriate controls with proper isotype-matched IgG and unstained controls.

Histology

Liver, spleen, and BM from the each group were fixed in 4% paraformaldehyde. BM samples were fixed in paraformadehyde, decalcified with 5% formic acid, and embedded in paraffin. Prepared slides were counterstained with Meyer's hematoxylin. Hematoxylin and eosin (H&E) staining was used after fixation to confirm leukemic blast infiltration in tissues including BM, spleen, and liver. For immunohistochemistry, after antigen retrieval, prepared slides were blocked for endogenous peroxidase activity and were incubated with primary antibody anti-mouse IFN-γ (clone: DB-1, NB100-78214; Novus Biologicals). Proper secondary antibody (IH-8056-50; Gentaur, Brussels, Belgium) was used for immunohistochemistry and detected using the DAB chromogen/substrate system (HistoMouse™-MAX kit, 89-9551; Invitrogen, Camarillo, CA, USA). Slides were counterstained with Meyer's hematoxylin.

Quantitative real-time PCR (RT-qPCR)

Total RNA was extracted from BM cells, liver, and spleen of mice as described in the schematic diagram (Fig. 3A) at day 15. RNA (1 µg) was reverse transcribed into cDNA at 42°C for 60 min in a 20-µl reaction mixture using a Transcriptor First Strand cDNA Synthesis kit (04 897 030 001; Roche, Mannheim, Germany). The primers used in the study are listed in Table II. The RT-qPCR was performed with TaqMan probes by LightCycler® 480 (Roche). All data were normalized to the amount of GAPDH expression, with samples run in triplicate.

Table II Primer sequences for RT-PCR and RT-qPCR.

Table II

Primer sequences for RT-PCR and RT-qPCR.

Gene	Sequence	Method
Mouse CXCR4	F: TACCTCGCTATTGTCCACGC R: GTGCACGATGCTCTCGAAGT	RT-PCR
Mouse GAPDH	F: CGTGTTCCTACCCCCAATGT R: GGCCCTCAGATGCCTGCTTCAC
Mouse IFN-γ	F: CAGCCGATGGGTTGTACCTT R: GGCAGCCTTGTCCCTTGA P: TGAGCTCATCCGAGTGGTCC	RT-qPCR
Mouse perforin	F: GACTGCTGCCCACGACAGA R: TGCCCGGAAATTGCTTACC P: CTTGGCCCATTTGG
Mouse granzyme B	F: CCCAGGCGCAATGTCAAT R: CCCCAACCAGCCACATAGC P: TGAAGCCAGGAGATGTG
Mouse GAPDH	F: CGTGTTCCTACCCCCAATGT R: TGTCATCATACTTGGCAGGTTTCT P: TCGTGGATCTGACGTGCCGC

[i] Direction: F, forward; R, reverse; P, probe.

Statistical analysis

The results are presented as the mean ± standard error (SE). Data were compared by the Mann-Whitney U test, and GraphPad Prism ver. 4 software (GraphPad Software, La Jolla, CA, USA) was used for the analyses. Image J was used for analysis of stained cells in slides. Percentage of stained area was calculated as the ratio of the stained area to the total area detected in the image. Values of P<0.05 were considered statistically significant.

Results

Levels of CXCR4 are decreased in plerixafor-treated leukemic cells

To examine the level of CXCR4 expressed by AML blasts and murine cells, 19 AML samples and murine C1498 and human Jurkat cells were subjected to FACS analysis. Data revealed that both normal human samples and AML mono-nuclear cells highly expressed CXCR4. CXCR4 expression in both groups was significantly decreased by CXCR4 inhibition, when treated with 5 µM plerixafor (normal, 79.7±14.2%; normal + plerixafor, 8.4±2.6%; AML, 68.6±5.9%; AML + plerixafor, 30.8±7.2%; Fig. 1A). In addition, CXCR4 expression in C1498 cells was ~31.29%, compared to 99.7% in the CXCR4 + Jurkat cell line and RNA expression was also confirmed (Fig. 1B and C).

Figure 1 CXCR4 is expressed in human cells and decreased by plerixafor in normal healthy donors and primary AML blasts. (A) Both normal and blast cells exhibited a significant reduction in CXCR4 expression following plerixafor treatment. Data shown represents the mean of independent experiments (normal, n=5; AML, n=19). Bars in (A) represent mean ± SE, and the statistical difference is presented in figures, compared to plerixafor treatment. (B) CXCR4 protein was clearly detected in C1498 cells by flow cytometry. The Jurkat cell line was used as a positive control. (C) RT-qPCR data show CXCR4 transcripts in C1498 cells.

Plerixafor inhibits SDF-1α-induced migration of leukemic cells, but has no effect on cell apoptosis in vitro

The role of CXCR4 in migration is well known. Osteoblasts and mesenchymal stromal cells (MSCs) in the BM niche produce cytokine SDF-1α, which is an attractant for CXCR4 + hematopoietic cells and encourages their migration. Because tumor cell migration into BM caused the recurrence of cancer in patients, we tested whether CXCR4 inhibition can block migration of C1498 cells under SDF-1α exposure. Consistent with previous studies (14), our migration assay clearly showed the inhibitory effect of plerixafor on SDF-1α-induced migration of primary AML and C1498 cells. Under SDF-1α conditions (100 ng/ml), C1498 cells were co-cultured with the plerixafor at various concentrations. Migrations of both C1498 and primary AML cells were similarly inhibited. While 42.8×102±18.1×102 migrated cells were detected without SDF-1α, SDF-1α induced 140.6×102±48×102 cells to migrate, showing an ~3.28-fold increase. Although there is individual variation in primary AML cells, plerixafor significantly inhibited migration at all indicated doses. Similarly, in C1498 cells, cell migration was significantly inhibited by plerixafor in a dose-dependent manner (Fig. 2A). Primary AML cells were counted to avoid the induction of apoptosis during the experiments (Fig. 2B). As expected, plerixafor effectively inhibited tumor cell migration in vitro, confirming the functional role of the SDF-1/CXCR4 interaction in AML migration. Next, although the anti-leukemic effects by the plerixafor are still debatable, studies continue to show that SDF-1/CXCR4 can protect AML blasts from chemotherapy and induce the apoptotic machinery of leukemic blasts under BMM disruption (8,18). Thus, to test the direct role of plerixafor in apoptosis, C1498 cells were cultured with or without Ara-C. At 24 h after co-culture, a FACS analysis was performed to evaluate the frequency of dead cells. A high number of apoptotic cells were observed following Ara-C treatment, compared to no apoptotic cells without Ara-C treatment. However, the Ara-C and plerixafor dual-treated group (termed P+A group) displayed no significant difference in apoptosis when compared to the Ara-C only group (without SDF-1α group: Plerixafor− Ara-C− cells, 3.6±0.1%; plerixafor+ Ara-C− cells, 3.2±0.2%; plerixafor− Ara-C+ cells, 18.4±2.5%; plerixafor+ Ara-C+ cells, 16.0±1.3%; and with SDF-1α group: plerixafor− Ara-C− cells, 3.3±0.3%; plerixafor+ Ara-C− cells, 3.8±0.3%; plerixafor− Ara-C+ cells, 20.0±2.0%; plerixafor+ Ara-C+ cells, 17.7±1.3%; Fig. 2C). Dual treatment, therefore, does not increase leukemic blast deaths, suggesting that apoptosis is exclusively controlled by Ara-C, but not plerixafor, in vitro.

Figure 2 Plerixafor inhibits cell migration with SDF-1α exposure in both primary AML cells and C1498 cells. (A) Migrated primary AML cells and C1498 cells were significantly decreased following plerixafor treatment under SDF-1α induction. Data shown represents the means of independent experiments (AML, n=8; C1498, n=3). Bars in (A) represent mean ± SE, and asterisks depict a statistically significant difference in comparison with no plerixafor treatment. (**P<0.01; ***P<0.001). (B) Representative panels show migrated human blasts in the lower chambers in (A). I, plerixafor and SDF-1α no treatment; II, plerixafor 0 µM and SDF-1α 100 µg/ml; III, plerixafor 5 µM and SDF-1α 100 µg/ml; IV, plerixafor 25 µM and SDF-1α 100 µg/ml; V, plerixafor 50 µM and SDF-1α 100 µg/ml (magnification, ×40). (C) No difference in apoptosis by plerixafor treatment was detected in vitro.

Significant suppression of blasts was detected in the plerixafor and Ara-C combination group in vivo

Because an in vitro system cannot recapitulate in vivo conditions, a syngeneic mouse model was used to further investigate the effects of plerixafor on blast suppression in a leukemic microenvironment. The protocol shown in Fig. 3A was used in experiments in vivo with tissues including liver, BM, and spleen from each group that were prepared and subjected to immunohistochemistry one month after C1498 injection. Results clearly displayed blast suppression in all tissues. Aberrant spindle-shaped C1498 cells distinguished these cells from normal HSC in BM, and leukemic clusters in the liver and spleen were detected. Leukemic blasts synergistically and significantly decreased in the P+A group, compared to those of the other groups (Fig. 3B). It also provided quantificational significance in P+A group, comparing the results to other groups (Fig. 3C) showing the following: In the BM control: 82.1±3.5%; plerixafor, 65.7±3.8%; Ara-C, 50.4±4.5%; and P+A, 36.1±4.4%. In the liver control, 67.4±4.6%; plerixafor, 58.2±2.5%; Ara-C, 58.7±2.9%; and P+A, 23.1±2.8%. In the spleen control, 75.9±2.1%; plerixafor, 64.4±3.4%; Ara-C, 47.4±3.5%; and P+A, 26.0±2.7%. These data suggested an unexpected role for plerixafor in leukemic blast suppression specifically in the AML niche.

The frequency of immune cells was not increased; however, cytotoxicity-related factors were significantly increased in the Ara-C and plerixafor dual-injected group in leukemia

To further examine whether immune cell inhibition by CXCR4 could diminish the number of leukemic blasts, we investigated CD3 leukocytes and NK cells, which express CXCR4 in functional cells distributed in the spleen and BM. PB cells from the Ara-C- and plerixafor-only groups and the P+A group were isolated and subjected to FACS analysis. The untreated C1498 injection only group and plerixafor treated group showed that CD4 and CD8 cells gradually decreased in a day-dependent manner, implying that plerixafor cannot independently alter the frequency of immune cells. However, the frequency of CD4 and CD8 cells was maintained in the P+A group, compared to the Ara-C-only and C1498 injected groups (Fig. 4A). To examine their functional capacity, real-time PCR was performed using primers for IFN-γ and cytotoxic-related factors. PCR results revealed a significant upregulation of IFN-γ expression and cytotoxic-related factors including perforin and granzyme B. IFN-γ, a main cytokine produced by cytotoxic T and NK cells, can help to kill target cells by immune system activation. As shown in Fig. 4B, the expression levels of IFN-γ, perforin, and granzyme B in the spleens of the P+A group were significantly increased, compared to those of the control (untreated C1498 injection only) group and the plerixafor only group. These results showed high level of genes in P+A group, compared to leukemia and single treated group (for IFN-γ; C1498 injected group vs. 28.0-fold, plerixafor vs. 17.7-fold, Ara-C vs. 2.0-fold, for perforin; C1498 injected group vs. 13.1-fold, plerixafor vs. 3.6-fold, Ara-C vs. 1.2-fold, for granzyme B; C1498 injected group vs. 6.0-fold, plerixafor vs. 3.9-fold), suggesting transcriptional activation in response to leukemic blasts (Fig. 4B). With the Ara-C treated group, a significant difference between the treated and P+A groups in expression of the IFN-γ and perforin gene, but not granzyme B, was detected. In protein level of spleen, high level of IFN-γ was detected in P+A group, compared to control, Ara-C- and plerixafor-only groups (Fig. 4C and D). Taken together, those results imply a role of functional relevance in immune cells for plerixafor, especially when combined with Ara-C.

Figure 4 Functional enhancement of immune cells in the plerixafor and Ara-C combination group. (A) Although most immune cells displayed a day-dependent decrease, the frequency of immune cells did not decrease in the P+A group. However, a significant difference was not detected. (B) Activated immune cells in the spleen were analyzed by RT-qPCR. Gene expression was normalized to that of GAPDH. Values represent the mean ± SE of three independent experiments, each of which was performed in triplicate. (*P<0.05; ***P<0.001). (C) High level of IFN-γ in P+A group was detected, compared to other groups (magnification, ×20). (D) Statistical analysis using Image J threshold for panel C. Bars represents mean ± SE, and asterisks depict statistically significant differences compared to the P+A group (*P<0.05).

Discussion

Previous studies suggested that CXCR4 is directly involved in tumor promotion and clinical outcomes (19,20). CXCR4 modulation is regarded as a promising strategy to eliminate tumor promotion in tumor environments as well as at the cellular level. Although many studies have shown the effect of plerixafor, the role of CXCR4 in the immune system still remains unclear. To test the antitumoral effects of plerixafor, we investigated whether plerixafor contributed to the suppression of leukemic cells both in vitro and in vivo. In contrast to our expectation, no direct antitumoral effect was found in vitro, regardless of whether the treatment was plerixafor alone or in combination with Ara-C. However, a remarkable suppression of leukemic blasts in vivo was detected in the P+A combination group, suggesting an unknown role for CXCR4 in the tumor microenvironment. Direct killing from chemotherapy and radiotherapy or through immune cells such as cytotoxic T cells and NK cells is usually regarded as the main strategy to eliminate tumor cells. Because there was no effective suppression of tumor cells in vitro but effective inhibition of blasts in vivo, we postulate that plerixafor has indirect effects, and that it can trigger factors such as immune cells to support the decrease in blasts.

Recently, de Oliveira et al reported the correlation between IFN-γ and high CXCR4 expression in immunopathogenesis and suggested that IFN-γ induces high levels of CXCR4 and its ligand, resulting in the migration of tumor cells and metastasis, but not exerting antitumor effects (21). In contrast, our data showed a high level of IFN-γ mRNA expression in the P+A group. Moreover, cytotoxic factors, perforin and granzyme B, were highly expressed in the P+A group, and their expression was significantly different from that of the C1498 injection only group as a control and plerixafor injection only group, suggesting enhanced killing of immune cells by inhibition of CXCR4 with chemotherapy in leukemia. The function and frequency of immune cells and the level of IFN-γ overall has been shown to be decreased in leukemia (17). To exclude pathologic conditions, we performed a FACS analysis using normal mononuclear cells (MNCs) with the Ara-C and plerixafor combination treatment in vitro and examined the expression of IFN-γ, perforin, and granzyme B. However, no significant difference in immune cell activation was detected in the P+A group (data not shown), implying that immune activation by CXCR4 inhibition may require another mediator in vivo. For a better understanding of the correlation between CXCR4 and immune cells, further functional studies on the precise mechanism induced at the immune cell level as well as in tissues should be undertaken. Niche-focused in vivo studies of CXCR4 and immune cells are needed to clarify this interaction in leukemia.

The BMM is important for the progression of AML and maintenance of minimal residual disease through soluble factors that are associated with leukemic cell resistance to chemotherapy (22). The centrally located vascular niche of BM is a site that induces differentiation and eventually mobilization of hematopoietic cells to the peripheral blood (23). Remarkably, mature megakaryocytes are located adjacent to sinusoidal endothelial cells (SEC) within BM and migrate to the peripheral circulation through SEC (24,25). We also found high numbers of megakaryocytes around the SEC and decreased circulating leukemic blasts inside the BM sinusoidal capillary (data not shown). In addition, the SEC capillary morphology returned to that of wild-type when plerixafor was injected together with Ara-C (data not shown). This suggests that plerixafor can also support the reconstitution of BM architecture with conventional chemotherapy. While this is not directly relevant to leukemia elimination, we cannot rule out the possibility that niche rearrangement by plerixafor can inhibit engraftment of leukemia.

Not all pathological conditions need proper CXCR4 expression to develop and activate lymphocytes. In WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome with rare combined immunodeficiency disorder in BM, a strong response to CXCL12 and displayed chronic non-cyclic leukopenia was shown. Specifically, in the case of CXCR+/1013 mutant mice presenting WHIM syndrome, CXCR4 desensitization with plerixafor reversed lymphoneutropenia that had disturbed leukocyte homeostasis (26). This indicates that the microenvironment is governed by diverse pathologic conditions that cause it to differ from an in vitro system.

In summary, we provide clues for the CXCR4 function accompanied with high level of cytotoxicity related factors in leukemic microenvironments that may suggest an advanced therapeutic strategy for leukemia through the modulation of immune cells or their niche by plerixafor.

Acknowledgments

This study was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2014R1A1A2053407).

References