This article is mentioned in:

Introduction

Breast cancer is one of the leading causes of death among women worldwide due mainly to its ability to metastasize and develop chemoresistance. It has been estimated that one-third of breast cancer patients relapse at some point and that 25% of all cases are resistant to therapy (1). Chemoresistance is complex and involves several cellular and molecular events including alterations in the cell cycle, apoptosis or DNA damage repair pathways and a greater capacity to excrete chemotherapeutic drugs (2). The cell cycle regulator p21, which historically has been considered as a suppressor protein in normal cells, was recently linked to cancer progression and chemoresistance (3). For instance, the Nrf2-p21 axis has been associated with an increase in the resistant tumor cell population, activation of antioxidant mechanisms and chemoresistance in MCF-7, MDA-MB-231 and T47D cells (4). Moreover, ErbB2-dependent overexpression of p21 correlates with resistance to the chemotherapeutic drug Taxol in breast cancer (5), suggesting that in pathological conditions this cell arrest mechanism is triggered to protect the tumor cells from toxic treatments commonly used to target DNA division and/or induction of apoptosis. In recent years, drug expulsion has been considered another key mechanism of chemoresistance. The ATP-binding cassette (ABC) transporter family with its 49 members present in the human genome is one of the largest and oldest known protein families (6). One feature common to all members of this family is that they are membrane transporters that, by consuming ATP, are able to expel from cells a wide spectrum of substrates, including vitamins, lipids, hormones, metabolic waste products and xenobiotics such as toxins and drugs. Their expression and activity, in fact, are correlated with a decrease in the cytoplasmic concentration of drugs and consequent failure of therapy (7). In addition, in an analysis of cellular and population composition, the onset of chemoresistance has been linked to cancer stem cells (CSCs). CSCs are a cancer cell subpopulation that has been demonstrated to possess tumor-initiating properties and metastatic potential, and they are intrinsically chemoresistant (8). CSCs have been already described and characterized in several hematologic and solid tumors including breast cancer, where the CD44+/CD24− surface marker profile has been considered a canonical CSC characteristic (9); although emerging evidence indicates that this profile is not exclusive to mammary cancer cells with CSC properties (10). Moreover, the origin of the CSC population is still controversial, and some other cellular events are associated with their stem-like profile as is the case for epithelial-mesenchymal transition (EMT). EMT in cancer is well documented and is characterized by a reversible conversion of cells with a polarized epithelial pattern into cells with a mesenchymal profile (11). At the molecular level, during EMT, epithelial cells lose adhesion molecules such as E-cadherin, lose their epithelial differentiation markers and acquire high motility by induction of vimentin and N-cadherin proteins. In fact, this transformation highly correlates with the CD44+/CD24− profile and chemoresistance (12).

Several researchers have focused on improving chemotherapeutic treatment using natural molecules to limit chemoresistance and avoid significant increases in toxicity. Molecular iodine (I2) is a chemical form of iodine that exerts significant antineoplastic effects on several types of cancer cells, and its actions could be mediated by multiple mechanisms. At moderately high concentrations, iodine induces a strong depolarization of mitochondrial membranes triggering mitochondrion-mediated apoptosis (13). Furthermore, I2 is able to react with lipids and proteins producing several iodinated compounds. Among all the iodolipids 5-hydroxy-6-iodo-8,11,14,eicosatrienoic δ-lactone, also called 6-iodolactone (6-IL), has been confirmed to be an agonist of the peroxisome proliferator-activated receptor type γ (PPARγ). IL-6 promotes differentiation by decreasing the expression of specific markers associated with invasiveness and metastasis (14,15). Moreover, previous studies from our laboratory showed that when co-administered with doxorubicin (DOX), I2 significantly improves conventional mammary cancer treatment in both women and rodents, and it diminishes the chemoresistance response (16,17). In the present study we developed a cell line resistant to low doses of DOX as a model to analyze in-depth how the I2 supplement affects the chemoresistance response. DOX is an anthracycline antibiotic and is the most widely used chemotherapeutic drug in breast cancer treatment. Our results showed that after 30 days of exposure to 10 nM of DOX, MCF-7/D cells exhibited the same proliferation rate but higher expression of the p21, Bcl-2 and MDR-1 proteins associated with chemoresistance mechanisms in comparison with MCF-7/W. The molecular iodine supplement maintained its apoptotic effect in both types of cells, indicating that I2 and DOX exert antineoplastic effects by different mechanisms. In addition, I2 increased the intracellular retention of DOX and exerted a differential down-selection of the highly tumorigenic CD44+/CD24+ and E-cad+/vim+ subpopulations. The I2 + DOX-selected cells showed a reserved tumorigenic competence in xenografts suggesting that the chemoresistance and invasive mechanisms were defective. All these I2 actions were associated with a significant increase in PPARγ expression.

Materials and methods

Cell culture and I2 + DOX treatment

The MCF-7 cell line was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and cultured in Dulbeccos modified Eagles medium (DMEM) (Gibco, Thermo Fisher Scientific, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS) and maintained at 37°C in a 5% CO2 atmosphere. Adriblastin® (Pfizer Inc., New York, NY, USA) was the source of DOX at a concentration of 35.4 ng/ml, equivalent to 10 nM DOX. The MCF-7/D cell line was generated by treating MCF-7/W cells for 30 days with 10 nM DOX. Both types of cells were authenticated follow the ATCC protocol by short tandem repeat analysis. Molecular iodine was prepared with 13 g of crystalline iodine (Macron-Avantor, Center Valley, PA, USA) and 60 g of potassium iodide (Sigma-Aldrich, St. Louis, MO, USA) in one liter of ddH2O. The iodine concentration was confirmed by titration with a solution of 0.1 N sodium thiosulfate. A working concentration of 200 µM I2 was employed in all assays.

Proliferation assay

Cells (25,000) were seeded into 6-well plates and left to recover for 24 h in DMEM before treatments. Medium and treatments were replaced daily before counting. Cell counting was performed using a Neubauer chamber. The coefficient of drug interaction (CDI) was calculated as reported by Gong et al (18) with the follow equation: CDI = (I2 + DOX) × nt/(I2 × DOX), where (I2 + DOX) is proliferation of the co-treated culture, nt is proliferation of the non-treated cells, while I2 and DOX represent the proliferation of cultures treated with each alone. Values <0.7 are considered as synergic interaction; values in the range 0.7–1.3 indicate additive interaction, and values >1.3 indicate an inhibitory effect.

RT-qPCR

Total RNA was extracted using TRIzol® (Invitrogen, Carlsbad, CA, USA) as suggested by the manufacturer. Reverse transcription (RT) was performed using M-MLV Reverse Transcriptase (Promega Corp., Fitchburg, WI, USA) and antisense specific primers according to the manufacturer's protocol. Quantitative PCR was performed as follows: 0.5 µl of cDNA solution was added together with 0.4 µl 10 µM-specific primer mix (forward and reverse), 5 µl Maxima SYBR-Green/ROX qPCR Master Mix (Fermentas, Burlington, ON, Canada) and 4.1 ddH2O. The reaction was performed using a Corbett research 3,000 rotor-gene. The thermal profile used was: 95°C for 10 min as hot-start step followed by 35 repetitions of the amplification cycle (melting at 95°C for 15 sec, annealing at 60°C for 30 sec, elongation at 72°C for 30 sec). Lastly, the melting curve was analyzed to check amplification specificity. Absolute gene quantifications were normalized to β-actin levels. Table I summarizes the primers used in the present study.

Table I. Primer details.

Table I.

Primer details.

Gene name	Accession no.	Forward primer sequences	Reverse primer sequences	bp
ABCg2	NM_001257386.1	AGTGTTTCAGCCGTGGAACT	GCATCTGCCTTTGGCTTCAA	194
BAX	NM_001291428.1	AAGCTGAGCGAGTGTCTCAAGCGC	TCCCGCCACAAAGATGGTCACG	327
Bcl-2	NM_000633.2	GTGGAGGAGCTCTTCAGGGA	AGGCACCCAGGGTGATGCAA	306
Survivin (Birc5)	NM_001168.2	TTCTCAAGGACCACCGCATC	CCAAGTCTGGCTCGTTCTCA	126
E-cadherin	NM_004360.3	TGCCCAGAAAATGAAAAAGG	GTGTATGTGGCAATGCGTTC	200
MDR-1	NM_000927.4	GAGAGATCCTCACCAAGCGG	ATCATTGGCGAGCCTGGTAG	122
p21	NM_000389.4	GACCATGTGGACCTGTCACT	GCGGATTAGGGCTTCCTCTT	176
Vimentin	NM_003380.3	GAGAACTTTGCCGTTGAAGC	GCTTCCTGTAGGTGGCAATC	163
β-actin	NM_001101.3	CCATCATGAAGTGTGACGTTG	ACAGAGTACTTGCGCTCAGGA	175

[i] Gene names and accession no., primer sequences and length of amplicon expressed as base pairs (bp).

Flow cytometry

CD44 and CD24 staining was performed as follows. After a 72-h treatment, cells were washed with phosphate-buffered saline (PBS) and detached with 0.05% EDTA/PBS. Cells (1–2×106) were incubated in PBS containing 0.05% EDTA + 0.05% BSA, and then for 1 h in ice with antibodies against CD24 (coupled to PE; diluted 1:50; Abcam, Cambridge, UK) and CD44 (coupled to FITC; diluted 1:50; BD Biosciences, San Jose, CA, USA). After a wash with PBS, cells were fixed using 2% formaldehyde in PBS for 10 min. After washing again with PBS, the cells were re-suspended with 1 ml PBS and analyzed.

Due to the cytoplasmic location of their epitope, E-cadherin (E-cad) and vimentin (vim) were stained as follows. After detaching using trypsin + 0.05% EDTA solution and washing with 0.05% EDTA/PBS, the cells were fixed with 2% formaldehyde in PBS for 10 min on ice. Cells were permeabilized using a 1:1 methanol/acetone solution at −20°C for 1 min. After a PBS wash, the cells were incubated for 1 h on ice with antibodies to E-cad coupled to Alexa 647 (diluted 1:2,000) and to vim coupled to PE (diluted 1:20) (both from BD Biosciences). After a last PBS wash, cells were re-suspended in 1 ml PBS. A BD Biosciences Accuri C6 flow cytometer was used to analyze the population. VirtualGain® was applied to normalize background fluorescence among treatments. Data were acquired and visualized using BD Biosciences Accuri C6 software.

DOX retention assay

After a 72-h pretreatment with 200 µM I2, cells were incubated with 20 or 500 nM DOX as follows. The medium was replaced with fresh DMEM, and the cells were incubated for 1 h. An appropriate volume of concentrated DOX was added directly to the culture, which was incubated for another 1.5 h. At this point the cells were detached with trypsin + 0.05% EDTA solution. A sample containing 1–2×106 cells was fixed with 2% formaldehyde in PBS. DOX fluorescence was detected by BD Biosciences Accuri C6 cytometer with excitation at 488 nM; emission filter 585/40. Data were acquired and visualized using BD Biosciences Accuri C6 software.

Tumorogenic capacity

Female athymic homozygotic (Foxn1nu/nu, Harlan, Indianapolis, IN, USA) mice were housed in a temperature-controlled room (21±1°C) with a 12-h/12-h light/dark schedule. They were given food (Purina certified rodent chow; Ralston Purina Co., St. Louis, MO, USA) and water ad libitum. All of the procedures followed the Animal Care and Use Program of the National Institutes of Health (NIH) (Bethesda, MD USA), and were approved by the Committee on Ethics in Investigation from INB (Protocol #035). When homozygotic animals were 6-weeks old, each animal was injected subcutaneously with 2×106 MCF-7/D cells in 50 µl PBS and 50 µl Matrigel. All animals were monitored daily for 20 days; any xenografts were detected and measured with an automatic Vernier, and their volume was calculated using the ellipsoid formula (19). On day 20, the presence of a tumor mass was corroborated by the use of a thermograph camera FLIR E40 (parameters are summarized in Table II), and digital processing software was implemented in MATLAB and FLIR Tools to calculate tumor temperature (MathWorks, Natick, MA, USA).

Table II. Camera parameters.

Table II.

Camera parameters.

Temperature range	–20 to 650°C
Thermal sensitivity	<0.07 to 30°C
Detector type	Focal plane array (FPA); uncooled microbolometer 160×120 pixels
Field of view	Focus 25° × 19°
Spectral range	7.5–13 µm

Statistical analyses

One- or two-way ANOVA was performed to determine the significance of differences between groups, followed by Tukey's test for the significance of differences among multiple experimental groups. DOX retention data were analyzed by Student's t-test. Tumor progression was calculated by linear regression analysis.

Results

Initial characterization of the low-dose DOX-resistant model showed that at 10 nM DOX, the MCF-7/W cell culture maintained its proliferation rate at 60% of the untreated control, whereas 20 nM DOX induced a total block of proliferation at 96 h (Fig. 1A). The established DOX-resistant model required two and four times longer (8 and 14 days) to reach 80% confluence after the first and second subcultures (passages), but within 30 days, the duplication rate had returned to the control value (Fig. 1B). The acute treatment (96 h) with 10 nM DOX decreased the proliferation rate (% change) only in MCF-7/W cells (Fig. 1C). DOX adaptation was accompanied by significant increases in the expression of the chemoresistance markers p21, Bcl-2 and MDR-1 (Fig. 1D, MCF-7/D DOX). Removal of chronic DOX treatment from MCF-7/D cells decreased p21 and MDR-1 expression (MCF-7/D n.t.).

Figure 1. Doxorubicin (DOX)-resistant model characterization. (A) DOX dose-response after 96 h of treatment of wild-type MCF-7 cells (MCF-7/W). (B) Sub-selection of MCF-7/D cells. Time and passages required to reach 80% confluence in comparison with MCF-7/W (control). (C) Proliferation rate (% change) after 96 h of 10 nM DOX in wild-type (MCF-7/W) and DOX-resistant cells (MCF-7/D). (D) Gene expression after 72 h of treatment of p21 (cell cycle arrest), Bcl-2 (antiapoptotic) and MDR-1 (ABC membrane transporter) as measured by RT-qPCR; n.t., non-treated cells. Data are expressed as mean ± SD (n=3 independent assays); the asterisks indicate significant differences with respect to the control (**P<0.01, ***P<0.001), and different letters indicate significant differences between groups (P<0.05).

Fig. 2 shows the effect of 200 µM I2 alone or co-administered with 10 nM DOX. Iodine alone inhibited proliferation similarly in both types of cells, and the magnitude of this inhibition was also similar to that observed in the MCF-7/W cells treated with 10 nM DOX. Co-administration of I2 + DOX exerted an additive effect on both cellular populations, as indicated by the coefficients of drug interaction (CDI). Gene analysis (Fig. 3) showed that the antineoplastic effect of I2 per se was associated with a decrease in Bcl-2 and an increase in PPARγ expression in both the MCF-7/W and MCF-7/D cells. These effects were also observed with I2 + DOX, but in this case I2 also impaired cell cycle arrest (canceled the increase caused by DOX) and intensified the decrease in Bcl-2 expression, thereby enhancing apoptosis induction (BAX/Bcl-2 index). Survivin expression did not show any change.

Figure 2. Proliferation assay. Cell count after 96 h of treatment with 200 µM I2, 10 nM doxorubicin (DOX) and co-treatment (I2 + DOX) of both cell lines. The coefficient of drug interaction (CDI) was calculated as described in the Materials and methods section. Data are expressed as mean ± SD (n=3 independent assays); different letters indicate significant differences between groups (P<0.05).

Figure 3. Gene expression. RT-qPCR analysis of genes related to cell cycle arrest (p21), apoptosis (BAX, Bcl-2 and survivin) and differentiation (PPARγ) after 72 h of treatment of both cell lines with 200 µM I2, 10 nM doxorubicin (DOX) and the combination (I2 + DOX). n.t., non-treated cells. Data are expressed as mean ± SD (n=3 independent assays); different letters indicate significant differences between groups (P<0.05).

Fig. 4 shows the effect of I2 on the expression of two of the most important drug expulsion membrane transporters. Iodine did not modify the expression of MDR-1 in the MCF-7/W cells but blocked its induction by DOX in the MCF-7/D cells. In contrast, the I2 supplement showed significant induction of ABCg2 transporter expression in all conditions (Fig. 4A). The DOX functional retention assay showed an increase in the intracellular concentration of DOX (fluorescence) when I2 was administered for 72 h, with a tendency observed at low concentrations, but a clear and significant increase at 500 nM DOX (Fig. 4B).

Figure 4. Expression and function of ABC transporter. (A) RT-qPCR analysis of MDR-1 and ABCg2 membrane transporter proteins after a 72-h incubation with 200 µM I2, 10 nM doxorubicin (DOX) and the combination (I2 + DOX) in both cell lines. (B) DOX intracellular retention measured by DOX fluorescence (Ex., 488 nm; Em. filter, 585/40) in non-treated (n.t.) or 200 µM I2-treated MCF-7/D cells after exposure to 20 or 500 nM DOX for 1.5 h. Data are expressed as mean ± SD (n=3 independent assays); different letters indicate significant differences between groups (P<0.05), and asterisks indicate significant differences between the untreated control (P<0.05).

Phenotypes of mammary CSCs (CD44/CD24) and the EMT process (E-cad/vim) were analyzed in MCF-7/D cells. Fig. 5 shows a significant decrease in the CD44+/CD24+ population in favor of the double-negative cell population in I2-treated cells with and without DOX. The CD44+/CD24− phenotype, which is the scarcest subtype (<4%) observed in these resistant cells, showed a modest but significant increase (6%) after I2 treatment. Fig. 6 shows that in terms of EMT classification, the most abundant population in the MCF-7/D cells corresponded to E-cad+. Iodine treatment was accompanied by a significant decrease in E-cad+/vim+ in favor of E-cad+/vim−, and again, this was independent of DOX presence. RT-PCR analysis show that the I2 supplement diminished vimentin expression (Fig. 6B).

Figure 5. Cancer stem cell (CSC) subpopulation composition in MCF-7D cells. (A) Representative flow cytometric analysis of CSC markers (CD44 and CD24). (B) CSC subpopulation as a percentage of the total MCF-7/D cells after a 72-h treatment with 200 µM I2, 10 nM doxorubicin (DOX) and the combination (I2 + DOX). n.t., non-treated cells. Data are expressed as mean ± SD (n=3 independent assays); different letters indicate significant differences between groups (P<0.05).

Figure 6. Characterization of MCF-7D cell subpopulations for EMT. (A) Representative flow cytometric analysis of EMT markers: E-cadherin (E-cad) and vimentin (vim); and percentage of subpopulations in the MCF-7/D culture after 72 h of treatment with 200 µM I2, 10 nM doxorubicin (DOX) and combination (I2 + DOX). (B) Gene expression (RT-qPCR) of E-cad and vim after 72 h of the same treatment. n.t., non-treated cells. Data are expressed as mean ± SD (n=3 independent assays); different letters indicate significant differences between groups (P<0.05).

To analyze the in vivo tumorigenic capacity of MCF-7/D subpopulations, athymic mice were inoculated with DOX-resistant cells pre-incubated for 96 h with 10 nM DOX (MCF-7/D) or 200 µM I2 + 10 nM DOX (MCF-7/I2 + D). Each animal was inoculated with both subpopulations on the left or right side, respectively. Fig. 7 shows that MCF-7/D cells induced xenograft beginning on day 4 and maintained a rapid growth until day 12, whereas with MCF-7/I2 + D, its growth rate and tumor size were significantly less.

Figure 7. Xenograft generation and thermograph analysis of tumoral mass. Female athymic homozygotic (Foxn1nu/nu) mice were inoculated with 2×106 DOX-resistant cells pre-incubated for 96 h with 10 nM doxorubicin (DOX) or the combination 200 µM I2 + 10 nM DOX (I2 + DOX). Each animal was inoculated with both subpopulations, on each side (n=6). (A) Image and (B and C) thermophotographs of nude mice. Circles indicate sites of xenografts in A. (D) Tumor volume growth of the xenograft tumors. Data are expressed as mean ± SD, and the asterisks indicate significant differences between groups (P<0.05).

Discussion

The multistep protocol has been commonly used to establish in vitro models to study chemoresistance. Based on this method, resistant cells are selected by treating with a sequence of increasing DOX concentrations starting from low to over 1 mM depending on the author. However, in some cases this multi-step selection is accompanied by a loss of identity of cellular origin (20,21) or has only a weak correlation with clinical reality, where tumors undergo neither such step-by-step exposure nor such high DOX concentrations (22,23). For that reason, we used a single-step treatment extended for one month, a period that resembles the interval that separates one treatment cycle from the next. In our experience, DOX at a low concentration (10 nM) favors drug adaptation, as suggested by cell proliferation to a normal rate and decreasing sensitivity to DOX. At the molecular level, the antineoplastic effect of DOX results from a variety of actions; the best known are its ability to intercalate into DNA and to form a complex with topoisomerase II and DNA which triggers apoptosis, apparently via the p53-caspase pathway (24). In agreement, numerous studies indicate that DOX-resistant cells respond by decreasing topoisomerase II expression and increasing the expression of membrane drug transporters and the anti-apoptotic signal (22,25,26). Some of these mechanisms were observed in our MCF-7/D cells, such as cell cycle arrest (p21 upregulation), efficient drug expulsion (upregulated MDR-1 expression), and apoptosis evasion (BAX/Bcl-2 ratio decrease), indicating that these DOX-adapted cells can be considered as a chemoresistant cell model. The apparently paradoxical increase in p21 expression in response to DOX in both cell types agrees with recent studies showing that p21 can exert both anti- and pro-apoptotic effects in response to antitumor drugs, depending on cell type and cellular context (3). Cytotoxic drugs commonly act in mitotically active cells where they trigger apoptosis by inducing DNA damage (27). From this, it is reasonable to assume that early cellular alterations in reaction to such drugs may include apoptosis evasion and quiescence. Although the general observation that MCF-7/D cells return to the same proliferative rate as the wild-type, careful analysis reveals that these DOX-resistant cells include several subpopulations that could have different proliferation rates. Studies in our laboratory designed to confirm this hypothesis are now in progress.

The primary objective of the present study was to analyze for the first time the effect of iodine on the chemoresistance acquisition to DOX. Previous studies from our laboratory and others have shown that I2 exerts antiproliferative and apoptotic effects in different models of cancer (16,17,28,29). Specifically, in mammary cell lines it has been demonstrated that cancerous (MCF-7, MDA-MB134, MDA-MB157 and MDA-MB436) and normal (MCF-10, MCF-12F) lines exhibit different sensitivity to I2, but they all have a lower rate of proliferation when iodine is present (28,29). The most sensitive cell line is MCF-7, which is the focus of the present study as it represents the most frequent breast cancer in women (luminal, estrogen-positive) (30). Molecular iodine exerts a direct apoptotic effect by mitochondrial membrane depolarization and/or an indirect action via 6-iodolactone (6-IL). This iodolipid is generated by iodination of arachidonic acid; by activating PPARγ, 6-IL induces apoptosis and differentiation effects in MCF-7 cells (16,17). In the present study, I2 maintained its apoptotic effect independent of the DOX-resistance mechanisms acquired by the cells. Several studies have shown that DOX-adaptation confers resistance to other drugs, due mainly to the overexpression of ABC transporters (22). It is possible that these membrane transporters cannot expel iodine. Indeed, our results showed that I2 alone inhibited MDR-1 expression only weakly, but it significantly impaired MDR-1 upregulation by DOX treatment in MFC-7/D cells, suggesting that the changes associated with I2 treatment were capable of interfering with the installation of DOX-resistance. One interesting observation is the significant increase in ABCg2 expression in both types of cells treated with I2. It is well documented that PPARγ activation inversely modulates MDR-1 and ABCg2. Although the MDR-1 gene does not contain response elements to PPARs, these receptors can inhibit the Wnt/β-catenin pathway, which is directly involved in MDR-1 regulation (31). In contrast, ABCg2 is directly stimulated by PPARγ agonists (32) and although these transporters are overexpressed in some tumor types, they have also been detected in several normal tissues such as intestine, liver, brain, placenta and mammary glands (7). Moreover, this breast cancer resistance protein (ABCg2) is strongly induced in the mammary gland during pregnancy and lactation and is responsible for pumping vitamin B2 into milk, suggesting a physiological role in differentiated mammary cells (33). These facts, along with the observation that I2 treatment is accompanied by significantly higher intracellular retention of DOX, suggest that the antineoplastic effect of iodine could be related to PPARγ activation resulting in maintaining drug sensitivity (downregulation of MDR-1 and, therefore, lower drug expulsion) and the induction of cell differentiation. It is well established that MCF-7 cells can respond to synthetic agonists of PPARγ by increasing lipid accumulation, terminating cell growth and undergoing changes characteristic of a less malignant state (14,34,35). These re-differentiation responses were also described by our group in mammary (MCF-12 and MCF-7), prostate (RWPE-1, LNCaP and DU-145) and neuroblastoma (SKN-AS and SKN-SH5Y) cell lines after I2 or 6-IL administration (28,36,37). In this context, it is possible that the significant increase in the ABCg2 transporter corresponds more to an induction of differentiation than of chemoresistance. The analysis of CSC and EMT markers showed that the canonic CSC profile CD44+/CD24− expected to be enriched in drug-resistant cells was poorly represented (<4%) in MCF-7/D cells, whereas the most abundant populations were the CD44+/CD24+ and CD44−/CD24+ subtypes (~40% each). The supplementation with I2 showed a discrete increase in CD44+/CD24− (~6%), no change in CD44−/CD24+ and a clear differential selection against CD44+/CD24+ with a significant increase in the double-negative population (CD44−/CD24−). Previous studies have described that the canonic CD44+/CD24− profile is not the only profile that corresponds to an invasive phenotype. Indeed, in a recent study, using sphere-promoting (Mammocult; Stem Cell Technologies, Vancouver, BC, Canada) conditions, this double-positive subpopulation was found to be the most representative group in the MCF-7 CSC culture (30). Increases in the double-positive population were found to be associated with a worse outcome in salivary gland (38), pancreatic carcinomas (39), and in colorectal cancer this double-positive population represents the specific marker for CSCs (40). Controversial results have been reported in relation to the CD44−/CD24+ profile. In various studies, increases in CD24+ cells were found to be correlated with the most aggressive phenotype (41–43), whereas in others there was no correlation with prognosis (44,45). In contrast, the double-negative phenotype had no prognostic significance in breast cancer patients (45), and in preclinical studies these cells showed reduced capacity to induce tumor growth in soft agar and xenografts in mouse models (46), suggesting that these cells are less invasive. This less-aggressive profile found in I2 + DOX cells was confirmed by the enrichment of E-cad+/vim− cells. Indeed, the expected EMT profile (E-cad−/vim+) was absent in MCF-7/D cells, and the double-positive population was significantly diminished in favor of the E-cad+/vim− subpopulation when these cells were treated with I2. E-cadherin is a transmembrane glycoprotein involved in epithelial adherens junctions, and its loss could be sufficient to promote the invasion-metastasis cascade, activating specific downstream signal transduction pathways that bestow high motility on the cells by inducing vimentin and N-cadherin proteins (47). In contrast, vimentin which is the most commonly expressed and highly conserved member of the type III intermediate filament protein family is considered the main EMT marker. High vimentin expression is observed in several aggressive breast cancer cell lines. In MCF-7 cells, vimentin overexpression is accompanied by increases in motility and invasiveness. These characteristics were reduced by vimentin antisense oligos in MDA-MB-231 cells, which constitutively express this protein (48). Congruently, our results showed that I2-treated cells exhibited the lowest vimentin expression and that the I2 + DOX-treated subpopulation was powerless to initiate tumor xenografts, corroborating its weak invasive potential. The EMT process, which is triggered by factors such as transforming growth factor-β (TGF-β), SNAIL and TWIST, is reverted by PPARγ activation (49,50). Studies have shown the antineoplastic effects of PPARγ ligands in various preclinical models (51); however, agonists of these receptors used as monotherapy failed to exert therapeutic benefits in advanced stage breast patients (52). Notably, PPARγ agonists in combination with the conventional antineoplastic drugs, such as carboplatin or tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), showed synergistic effects, indicating that differentiation induced by PPARγ activation restored sensitivity to the cytotoxic drug (53,54). These synergistic effects were replicated in cells treated with DOX + I2 in both preclinical (16) and clinical studies (17), supporting the notion that some I2 effects are mediated by PPARγ activation.

In conclusion, the use of molecular iodine at a moderately high concentration restored the sensitivity of mammary cancer cells MCF-7/D to DOX. Impaired DOX expulsion and decreased expression of the chemoresistance markers p21, Bcl-2 and MDR-1 resulted in the selection of a less aggressive population, suggesting the potential of I2 as a clinically useful anti-chemoresistance agent.

Acknowledgements

We thank M. Juana Cárdenas-Luna, Felipe Ortiz, Adriana González and Michael Jeziorski for technical assistance, Leonor Casanova and Lourdes Lara for academic support, Dorothy Pless for proofreading and Martin Garcia-Servín and Alejandra Castillo for animal care advice. We extend special thanks to Mario Nava-Villalba and Silvia Angulo Barbosa for their contributions to scientific discussions and to Guadalupe Delgado, who will live forever in our memories, for technical and academic assistance. The present study was partially supported by grants: PAPIIT-UNAM, IN201516. Alexander Bontempo is a graduate student of UNAM in the PhD Program in Biomedical Sciences of the National Autonomous University of Mexico (Programa de Doctorado en Ciencias Biomédicas, Universidad Nacional Autónoma de México) and received fellowship 262489 from CONACYT.

References