TRIB2 knockdown as a regulator of chemotherapy resistance and proliferation via the ERK/STAT3 signaling pathway in human chronic myelogenous leukemia K562/ADM cells

  • Authors:
    • Xiancheng Ma
    • Xue Zhou
    • Haiyan Qu
    • Ying Ma
    • Zhen Yue
    • Wenjing Shang
    • Pingyu Wang
    • Shuyang Xie
    • Youjie Li
    • Yunxiao Sun
  • View Affiliations

  • Published online on: February 7, 2018     https://doi.org/10.3892/or.2018.6249
  • Pages: 1910-1918
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Acquired resistance to chemotherapy plays a critical role in human drug treatment failure in many tumor types. Multidrug resistance (MDR) to Adriamycin (ADM) also limits the efficacy of therapy in human chronic myelogenous leukemia (CML). The overexpression of drug efflux transporters is one mechanism uderlying MDR. In particular, the consistent activation of MDR1 and MDR‑associated protein 1 (MRP1) is involved in drug resistance. In the present study, ADM‑resistant human CML K562/ADM cells were stably transfected with a Tribbles homolog 2 (TRIB2)‑targeted vector. A CCK‑8 assay showed that the half maximal inhibitory concentration (IC50) of ADM and the cell proliferation were lower in the transfected cells compared with that in the parental K562/ADM cells. The mRNA and protein expression levels of MDR1 and MRP1 were determined by reverse transcription‑polymerase chain reaction (RT‑PCR), RT‑quantitative PCR and western blot analysis. The results showed that the expression of MDR1 and MRP1 was significantly reduced in K562/ADM cells transfected with pGPU6/GFP/Neo‑TRIB2. Due to the downregulation of MDR1 and MRP1, the intracellular accumulation of ADM was increased in the transfected cells compared with that in the parental K562/ADM cells. Therefore, the sensitivity of the K562/ADM cells to ADM was enhanced and proliferation was inhibited. Our research revealed that protein expression of the ERK signaling pathway was inhibited by downregulating TRIB2, indicating that the ERK pathway was involved in cell drug resistance and proliferation. Furthermore, we used the ERK‑specific blocker U0126 to demonstrate this phenomenon. In summary, our research suggested that knockdown of TRIB2 could slow cell growth and reverse resistance, implying that TRIB2 is a potential therapy target for resistant human CML.

Introduction

Chronic myeloid leukemia (CML) is one of the most prevalent types of myeloproliferative neoplasm, and its multidrug resistance (MDR) is usually associated with a poor clinical outcome (1,2). MDR1 and MDR-associated protein 1 (MRP1) belong to the protein family of ATP-binding cassette transporters, which use the energy released by ATP hydrolysis to bind drugs and export them from the cell (3,4). Adriamycin-resistant CML K562 (K562/ADM) cells reportedly overexpress MDR1 and MRP1 (5), meaning that the resistance of this cell line is associated with abnormalities in drug efflux. In the present study, we found that the proliferation of K562/ADM cells was significantly inhibited upon knockdown of the Tribbles homolog 2 (TRIB2) gene, compared with that noted in the untreated cells. The reason for this growth inhibition in the resistant cell line may be associated with cell drug-resistance reversal. It is known that TRIB2 is expressed in mammals. TRIB protein family members encode pseudo-kinase proteins that are highly conserved in evolution, and act as adaptors in signaling pathways for important cellular processes (6,7). Previous studies have focused on the pathological role of TRIB2 in various diseases, including CML, and metabolic and neurological diseases, in which it has been identified as a critical signaling modulator and mediator (8,9). Related reports suggest that TRIB2 overexpression can indeed promote tumor resistance by activating relevant cell pathways (10). However, little is known concerning the effects of TRIB2 gene knockdown on drug-resistant proteins.

Previous studies have found that the downregulation of drug-resistance proteins may partly depend on inhibition of the ERK pathway in cancer (1113). In the present study, we explored changes in the ERK signaling pathway after knockdown of the TRIB2 gene in K562/ADM cells. The aim of the present study was to explore the effect of the downregulation of TRIB2 expression on the chemotherapy resistance and proliferation of K562/ADM cells. The results provide a novel basis for the treatment of clinical drug resistance mechanisms, and potential routes for therapeutic strategies in CML.

Materials and methods

Cell lines and cell culture

Human CML K562 cells and the MDR sub-cell line K562/ADM cells were obtained from the Institute of Medical Molecular Genetics of Binzhou Medical University (Yantai, China). The cells were maintained in RPMI-1640 basic medium (1X) supplemented with 10% fetal bovine serum (FBS; both from Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C in a humidified atmosphere containing 5% CO2. K562/ADM cells were maintained in the presence of 7 µM ADM (Wanle, Shenzhen, China). Prior to the experiment, the cells were cultured in drug-free medium for 1 week. In addition, K562/ADM and K562/ADM-TRIB2 cells were pretreated for 24 h with 10 µM U0126 (Shanghai Selleck Chemicals Co., Ltd., Shanghai, China) in order to study the ERK pathway.

Cell transfection

A pair of vector sequences targeting TRIB2 were generated and named pGPU6/GFP/Neo-shNC, pGPU6/GFP/Neo-TRIB2 and pGPU6/GFP/Neo-TRIB2-1. Firstly, cells were seeded at a density of 0.9–4×105/well into a 6-well plate with 1.6 ml 10% FBS-containing RPMI-1640 medium the day before transfection. After incubation for 24 h, cell confluence was 40–80% on the day of transfection. DNA (0.4 µg) was dissolved in TE buffer and added to 3.2 µl Enhancer; 10 µl Effectene Transfection reagent (Qiagen China Co., Ltd., Shanghai, China) was added after 5 min of incubation. After incubating for a further 6–18 h, the medium was removed and replaced with fresh medium. Transfection efficiency was determined using fluorescence microscopy and the non-transfected K562/ADM cells were used as the control. After 48 h of transfection, G418 (500 ng/ml; Thermo Fisher Scientific, Inc.) was added to the medium. Stable positive clones were obtained after 4 weeks of selection. Administration of G418 was halted at 2 weeks prior to the experiment.

Cell proliferation assay

K562/ADM cells (8×103) with or without knockdown of TRIB2 were divided into 0, 24, 48 and 72 h experimental groups, seeded into 96-well plates and incubated with medium containing 10% FBS. Each group consisted of five parallel wells, with parental K562/ADM cells serving as the control. Then, 10 µl CCK-8 (Dojindo Molecular Technologies, Inc., Shanghai, China) solution was added to each well and incubated for a further 4 h. Then, the absorbance at 450 nm was measured using a fluorescence spectrophotometer (F-7000; Hitachi, Ltd., Tokyo, Japan). The absorbance values were collected for processing using GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA).

CCK-8 analysis of the half maximal inhibitory concentration (IC50)

The CCK-8 was used to determine the inhibition ratio of cells incubated with various concentrations of ADM (0–16 µM for the K562 cells; 15–120 µM for the K562/ADM cells, K562/ADM-Con cells or K562/ADM-TRIB2 cells). After dilution in RPMI-1640 medium for 24 h, 10 µl CCK-8 solution was added to each well and incubated for 4 h. The absorbance was then measured at 450 nm with a microplate reader. A blank well containing only medium and ADM was used as a control. The concentration of ADM that resulted in the IC50 was calculated. Resistant fold=IC50 K562/ADM/IC50 K562. Reversal fold=IC50 K562/ADM-TRIB2 group/IC50 control.

Flow cytometry

K562, K562/ADM, and cells transfected with pGPU6/GFP/Neo-TRIB2 and pGPU6/GFP/Neo-shNC were seeded into a 6-well plate at a density of 5×105 cells/well. The non-transfected group was defined as the blank control. A total of 5 µM ADM was applied to the wells. After incubation for 1 h, the cells were harvested via centrifugation and washed twice with ice-cold PBS. The cell-associated mean fluorescence intensity (MFI) of ADM was detected using a FACSCalibur flow cytometer (FACS FC500; Beckman Coulter, Inc., Brea, CA, USA), with excitation/emission wavelengths of 485/580 nm.

Reverse transcription-polymerase chain reaction (RT-PCR) and RT-quantitative PCR (RT-qPCR)

According to the manufacturer's instructions, total RNA was isolated using TRIzol reagent (Thermo Fisher Scientific, Inc.) and assessed at a ratio of A260/A280 by spectrophotometry (Nano Drop 2000; Nano Drop Technologies, Inc., Wilmington, DE, USA). RNA (1–2 µg) was used to synthesize the first-strand cDNA. The primers used in this experiment were designed and synthesized by Shanghai GenePharma, Co., Ltd. (Shanghai, China) and are presented in Table I. Prime Script™ RT reagent kit with gDNA Eraser (Takara Bio, Inc., Otsu, Japan) was used to perform the RT reaction. Then, Premix Taq™ (Takara Bio, Inc.) was used to perform PCR amplification on the Eppendorf Mastercycler Personal system (Eppendorf China Ltd., Hong Kong, China). The reaction system contained forward primer, reverse primer, Premix Taq and template cDNA. The PCR products were separated on 1% agarose gels (Takara Bio, Inc.), stained with G-Red nucleic acid dyes (1:10,000; BioTeke Corporation, Beijing, China). The images were captured with a Tanon gel imaging system (Tanon, Shanghai, China). The parental non-transfected K562/ADM cells were used as the blank control. GAPDH served as an internal standard for quality control and quantification of target genes.

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction.

GenePrimer sequenceProduct length (bp)
MDR1Forward: 5′-GGAGCCTACTTGGTGGCACATAA-3′121
Reverse: 5′-TGGCATAGTCAGGAGCAAATGAAC-3′
MRP1Forward: 5′-CAGCCCTTCCTGACAAGCTA-3′133
Reverse: 5′-GTGGCCTCATCCAACACAAG-3′
TRIB2Forward: 5′-CTCCGAACTTGTCGCATTG-3′233
Reverse: 5′-CACATAGGCTTTGGTCTCAC-3′
GAPDHForward: 5′-CAGCCCTTCCTGACAAGCTA-3′133
Reverse: 5′-GTGGCCTCATCCAACACAAG-3′

[i] MDR1, multidrug resistance 1; MRP1, MDR-associated protein 1; TRIB2, Tribble homologue 2.

RT-qPCR was performed with a Step One™ Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and SYBR Premix Ex Taq™ (Takara Bio, Inc.). The reaction system of PCR contained SYBR Premix Ex Taq™, the forward primer, the reverse primer, template cDNA and nuclease-free distilled water. The results were calculated using the 2−ΔΔCq value.

Western blot analysis

Cells cultured in 6-well plates were harvested and washed with cold PBS three times. A total of 120 µl RIPA lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China) was added to extract the proteins. Protein samples were separated via 10 or 6% SDS-PAGE (Beyotime Institute of Biotechnology) with a constant voltage of 80 V for 0.5 h, which was then switched to 120 V for a further 1 h. Proteins were then transferred onto polyvinylidine difluoride membranes (EMD Millipore, Billerica, MA, USA). The membranes were blocked with 5% skimmed dry milk in 1X Tris-buffered saline with Tween-20 (pH 8.0) at room temperature for 2 h, and then incubated overnight at 4°C with six styles of primary antibodies respectively. The primary antibodies were rabbit polyclonal anti-TRIB2 (1:500; cat. no. 204119; Abcam, Cambridge, UK), anti-MDR1 (1:500; cat no. 0563R; BIOSS, Beijing, China), anti-MRP1 (1:500; cat. no. 0657R; BIOSS), anti-STAT3 (1:500; cat. no. 1141R; Bioworld Technology, Inc., Nanjing, China), anti-p-ERK (1:500, cat. no. 5016; Bioworld Technology, Inc.) and anti-GAPDH (1:1,000; cat. no. AP0063; Bioworld Technology, Inc.). Following this, the membranes were incubated with a horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (1:5,000; cat no. 13278; Bioworld Technology, Inc.) for 2 h. Finally, images were captured using a FluorChem FC2 gel imaging system (Protein Simple, San Jose, CA, USA). The intensity of each band was normalized to GAPDH in the respective lane, and the K562/ADM cells were as control.

Data analysis

Statistical analyses were performed using SPSS 21.0 software (IBM Corp., Armonk, NY, USA). Independent two-sample t-tests were used to analyze differences between two groups. One-way analysis of variance (ANOVA) was used to analyze differences among three or more groups. A post-hoc test of ANOVA was conducted by performing a Tukey's test. Data are expressed as the mean ± standard deviation. Statistical significance was accepted at P<0.05.

Results

Calculation of the level of ADM drug-resistance in the K562 and K562/ADM cell groups

The IC50 was calculated by performing a CCK-8 spectrophotometric assay. The data from the K562/ADM cells were markedly higher compared with K562 cells, with a resistance ratio of 26.22 for K562/ADM to K562 cells (Table II). There was a significant difference in intracellular ADM accumulation between the K562/ADM group and the K562 group (Fig. 1). All values were statistically significant (P<0.01).

Table II.

IC50 values for K562/ADM cells and K562 cells toward ADM by CCK-8 assay (means ± SD; n=5).

Table II.

IC50 values for K562/ADM cells and K562 cells toward ADM by CCK-8 assay (means ± SD; n=5).

IC50 ± SD (µM)

TreatmentK562K562/ADMRF
Adriamycin3.219± 0.921 84.801±0.0183a26.22

a P<0.01 vs. K562 group. RF, Resistant fold; ADM, Adriamycin.

Determination of relative protein expression in K562 and K562/ADM cells

We evaluated MDR1, MRP1 and TRIB2 expression in the non-resistant K562 cells and the ADM-resistant K562/ADM cells. The results indicated that the K562 and K562/ADM cells both showed high expression levels of all three proteins. The K562/ADM cells exhibited higher mRNA expression of TRIB2, MDR1 and MRP1, compared with the K562 cells (Fig. 2A and B). Western blot analyses revealed the same expression trends at the protein level (Fig. 2C and D).

Construction of a stable TRIB2 transfection cell system

To evaluate the functional changes in the K562/ADM cells following silencing of TRIB2, we transfected pGPU6/GFP/Neo-shNC, pGPU6/GFP/Neo-TRIB2 and pGPU6/GFP/Neo-TRIB2-1 (Table III) into K562/ADM cells, with untreated K562/ADM cells serving as the control. Green fluorescence is only detected in cells successfully transfected with GFP. Therefore, cells with green fluorescence indicate a high efficiency of transfection. After 4 weeks of G418 selection, we successfully obtained stable positive clones (Fig. 3A). RT-PCR, RT-qPCR and western blot analyses revealed that TRIB2 expression was markedly decreased in the K562/ADM-TRIB2 group and the K562/ADM-TRIB2-1 group at the transcription and translation levels, compared with that in the K562/ADM group. TRIB2 expression in the K562/ADM-Con group was not significantly different from the negative control group (Fig. 4).

Table III.

Construction of the expression vector and its interference sequence (5′-3′).

Table III.

Construction of the expression vector and its interference sequence (5′-3′).

Vector constructionInterference sequence
pGPU6/GFP/Neo-shNC GTTCTCCGAACGTGTCACGT
pGPU6/GFP/Neo-TRIB2 TAGCGAGATATGGGAGATC
pGPU6/GFP/Neo-TRIB2-1 CTTGTCGCATTGCGTTTCTTG
TRIB2 knockdown inhibits cell proliferation

A CCK-8 assay was performed to evaluate cell proliferation (Fig. 3B). According to the growth curve, we found that the proliferation of cells treated with pGPU6/GFP/Neo-TRIB2 and pGPU6/GFP/Neo-TRIB2-1 was markedly inhibited, while cells transfected with pGPU6/GFP/Neo-shNC exhibited no significant difference. The results also showed that pGPU6/GFP/Neo-TRIB2 was more effective than pGPU6/GFP/Neo-TRIB2-1. Then, pGPU6/GFP/Neo-TRIB2 was used to explore the effect of the downregulation of TRIB2 expression on the chemotherapy resistance and proliferation of K562/ADM cells.

TRIB2 knockdown decreases IC50 and increases intracellular ADM accumulation

The IC50 value was calculated by performing a CCK-8 spectrophotometric assay. The IC50 of the K562/ADM-Con group was not observed to be significantly different compared with the K562/ADM cells, while a reduction in the IC50 value was obvious in the K562/ADM-TRIB2 group, with a reversal fold of 12.12 (Table IV). The intracellular ADM accumulation in K562/ADM-TRIB2 cells was considerably higher than that in the K562/ADM cells and K562/ADM-Con cells (Fig. 5). All values were statistically significant (P<0.01).

Table IV.

IC50 values of K562/ADM cells, K562/ADM-Con and K562/ADM-TRIB2 cells toward Adriamycin by CCK-8 assay (means ± SD of triplicate experiments).

Table IV.

IC50 values of K562/ADM cells, K562/ADM-Con and K562/ADM-TRIB2 cells toward Adriamycin by CCK-8 assay (means ± SD of triplicate experiments).

IC50 ± SD (µM)

TreatmentK562/ADMK562/ADM-ConK562/ADM-TRIB2RF
Adriamycin   84.012±0.037   75.946±0.134 39.041±0.321a12.12

a P<0.01, vs. K562/ADM and K562/ADM-Con group. RF, reversal fold; ADM, Adriamycin.

Decreased expression of MDR1 and MRP1 by TRIB2 knockdown

MDR1 and MRP1 are ABC transporters overexpressed in many drug-resistant tumor cells, which contribute to the development of MDR. Therefore, we assessed whether TRIB2 knockdown could influence the expression of MDR1 and MRP1. Notably, western blotting, RT-PCR and RT-qPCR analyses (Fig. 6) illustrated that the expression levels of MDR1 and MRP1 were lower in the K562/ADM-TRIB2 cells, compared with levels in the control cells. This indicated that TRIB2 may be involved in key steps of MDR development in CML.

Inhibition of the ERK pathway in K562/ADM-TRIB2 cells

The expression of p-ERK and STAT3 in K562/ADM cells was higher compared with that noted in the K562 cells. However, after treatment with U0126, p-ERK and STAT3 expression was significantly decreased (Fig. 7A-C). These results suggested that expression of the ERK pathway was active in CML K562/ADM cells and U0126 could specifically block this pathway. Furthermore, the expression of p-ERK and STAT3 was clearly downregulated in the K562/ADM-TRIB2 cells. After treatment with U0126, the expression of p-ERK and STAT3 in K562/ADM-TRIB2 cells was significantly decreased, indicating that TRIB2 knockdown may act by blocking ERK pathway activity (Fig. 7D-F). These results suggest that downregulation of TRIB2 affects cell resistance by altering the expression of p-ERK and STAT3 in CML K562/ADM cells.

Discussion

MDR is a major clinical obstacle for effective tumor chemotherapy, and its impact on chemotherapy in the clinic is worsening. Therefore, novel targeted therapeutic approaches are being explored in order to increase the efficacy of chemotherapy against blood cancers and diseases (14). We observed that TRIB2, MDR1 and MRP1 expression levels were higher in K562/ADM cells, compared with levels in the K562 cells, at both the protein and mRNA levels. This indicated that TRIB2 was involved in the development of MDR in K562/ADM cells.

Numerous studies have shown that the HOX gene family plays an important role in tumor resistance. Knockdown of HOXA5, HOXA10 or HOXB4 was found to reverse multidrug resistance of human CML K562/ADM cells (2,1517). Related studies have also shown that miR-3142 and miR-146a are overexpressed in K562/ADM cells compared with that noted in K562 cells, which promotes normal cell proliferation and enhanced resistance to ADM in vitro (18,19). Similarly, knockdown of miR-224 and let-7i was shown to reverse the MDR of human CML K562/ADM cells (20). It has been reported that TRIB2 expression is significantly increased in tumor tissues from patients, correlating with the increased phosphorylation of AKT, FOXO3a, MDM2 and C/EBPα (10,21). We found that the knockdown of TRIB2 could decrease MDR1 and MRP1 activity in human CML K562/ADM cells, and also reverse intracellular drug accumulation. In the present study, we first focused on evaluating the association between TRIB2 knockdown and the expression of resistance proteins. Our results indicated that the expression levels of drug-resistant proteins were inhibited by suppressing TRIB2, which reduced the efflux of intracellular ADM and reversed cell resistance. In summary, TRIB2 repression could partially reverse the MDR of K562/ADM cells by inhibiting cellular efflux functions and downregulating the expression levels of MDR1 and MRP1, thus elevating intracellular chemotherapeutic accumulation.

To further investigate the mechanism underlying the role of TRIB2 knockdown in reducing cell resistance, we examined the activity of the ERK pathway. ERK1 and ERK2 constitute the ERK1/2 signal transduction pathway. This is mainly composed of the RAS/RAF/MEK/ERK signal transduction cascade, which can be stimulated by various external stimuli (22,23). Expression of the ERK signal transduction pathway and drug efflux proteins in hepatocellular carcinoma, gastric cancer and breast cancer cells is reported to be significantly higher compared with the corresponding controls (2426). Numerous studies have shown that excessive activation of ERK is positively correlated with the presence of numerous resistant tumors, the mechanism of which may be modulated by the overexpression of resistance-related genes and proteins (27,28). We detected that the expression levels of p-ERK and STAT3 in K562/ADM cells were higher when compared with the levels in K562 cells. Meanwhile, knockdown of TRIB2 in normal K562/ADM cells resulted in the reduced activity of p-ERK and STAT3. To test our hypothesis, the ERK signal transduction pathway inhibitor U0126 was used to downregulate ERK phosphorylation. U0126 is an inhibitor of mitogen-activated protein kinase 1 and 2 (MEK1/2), which blocks phosphorylation and activation of ERK1/2 (2931). In the present study, western blotting showed that p-ERK was significantly inhibited in K562/ADM cells treated with U0126. This indicated that the gene encoding ERK was involved in the effects of TRIB2 knockdown.

Furthermore, this study investigated the ERK downstream product STAT3, which correlates with cell proliferation (32). STAT3-targeted therapy can reverse drug resistance in CML (33). Our results showed that the activity of STAT3 in K562/ADM cells following TRIB2 knockdown was also lower compared with that noted in the control group. While these initial findings are promising, more comprehensive and detailed studies need to be conducted, including in vivo animal models and more precise ERK1/2 pathway assays. Nevertheless, we demonstrated that decreased expression of resistant proteins is associated with inhibition of the ERK pathway through the knockdown of TRIB2, thereby reversing cell MDR.

Acknowledgements

The present study was supported by the National Natural Science Foundation (grant no. 31371321), the Shandong Science and Technology Committee (grant nos. ZR2014HQ079, ZR2014HL056 and ZR2013HL003), the Foundation of Shandong Educational Committee (grant nos. J17KA121 and J13LE11) and Young Backbone Teacher Development Support Project of Binzhou Medical University.

Competing interests

The authors declare no competing interests.

Glossary

Abbreviations

Abbreviations:

CML

chronic myeloid leukemia

CCK-8

Cell Counting Kit-8

GFP

green fluorescent protein

RT-qPCR

reverse transcription-quantitative polymerase chain reaction

SDS-PAGE

sodium dodecyl sulphate-polyacrylamide gel electrophoresis

TRIB2

tribble homologue 2

MDR1

multidrug resistance 1

MRP1

multidrug resistance-associated protein 1

References

1 

Clarke CJ and Holyoake TL: Preclinical approaches in chronic myeloid leukemia: From cells to systems. Exp Hematol. 47:13–23. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Cheng Z, Yang N, Liang W, Yan X, Li L and Pan L: Effect of phosphatase and tensin homology deleted on chromosome 10 (PTEN) gene transfection on reversal of multidrug resistance in K562/ADM cells. Leuk Lymphoma. 53:1383–1389. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Yin J and Zhang J: Multidrug resistance-associated protein 1 (MRP1/ABCC1) polymorphism: From discovery to clinical application. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 36:927–938. 2011.PubMed/NCBI

4 

Reznicek J, Ceckova M, Ptackova Z, Martinec O, Tupova L, Cerveny L and Staud F: MDR1 and BCRP transporter-mediated drug-drug interaction between rilpivirine and abacavir and effect on intestinal absorption. Antimicrob Agents Chemother. 61:e00837–17. 2017. View Article : Google Scholar : PubMed/NCBI

5 

Chen JR, Jia XH, Wang H, Yi YJ, Wang JY and Li YJ: Timosaponin A-III reverses multi-drug resistance in human chronic myelogenous leukemia K562/ADM cells via downregulation of MDR1 and MRP1 expression by inhibiting PI3K/Akt signaling pathway. Int J Oncol. 48:2063–2070. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Liang KL, O'Connor C, Veiga JP, McCarthy TV and Keeshan K: TRIB2 regulates normal and stress-induced thymocyte proliferation. Cell Discov. 2:150502016. View Article : Google Scholar : PubMed/NCBI

7 

Gilby DC, Sung HY, Winship PR, Goodeve AC, Reilly JT and Kiss-Toth E: Tribbles-1 and −2 are tumour suppressors, down-regulated in human acute myeloid leukaemia. Immunol Lett. 130:115–124. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Yokoyama T and Nakamura T: Tribbles in disease: Signaling pathways important for cellular function and neoplastic transformation. Cancer Sci. 102:1115–1122. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Hannon MM, Lohan F, Erbilgin Y, Sayitoglu M, O'Hagan K, Mills K, Ozbek U and Keeshan K: Elevated TRIB2 with NOTCH1 activation in paediatric/adult T-ALL. Br J Haematol. 158:1–634. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Hill R, Madureira PA, Ferreira B, Baptista I, Machado S, Colaco L, Santos M, Liu NS, Dopazo A, Ugurel S, et al: TRIB2 confers resistance to anti-cancer therapy by activating the serine/threonine protein kinase AKT. Nat Commun. 8:146872017. View Article : Google Scholar : PubMed/NCBI

11 

Chen T, Wang C, Liu Q, Meng Q, Sun H, Huo X, Sun P, Peng J, Liu Z, Yang X and Liu K: Dasatinib reverses the multidrug resistance of breast cancer MCF7 cells to doxorubicin by downregulating P-gp expression via inhibiting the activation of ERK signaling pathway. Cancer Biol Ther. 16:106–114. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Yuan WQ, Zhang RR, Wang J, Ma Y, Li WX, Jiang RW and Cai SH: Asclepiasterol, a novel C21 steroidal glycoside derived from asclepias curassavica, reverses tumor multidrug resistance by down-regulating P-glycoprotein expression. Oncotarget. 7:31466–31483. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Sheng Y, You Y and Chen Y: Dual-targeting hybrid peptide-conjugated doxorubicin for drug resistance reversal in breast cancer. Int J Pharm. 512:1–13. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Jacobs RW, Awan FT, Leslie LA, Usmani SZ and Ghosh N: The shrinking role of chemotherapy in the treatment of chronic lymphocytic leukemia. Expert Rev Hematol. 9:1177–1187. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Li N, Jia X, Wang J, Li Y and Xie S: Knockdown of homeobox A5 by small hairpin RNA inhibits proliferation and enhances cytarabine chemosensitivity of acute myeloid leukemia cells. Mol Med Rep. 12:6861–6866. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Wang H, Jia XH, Chen JR, Yi YJ, Wang JY, Li YJ and XIE SY: HOXB4 knockdown reverses multidrug resistance of human myelogenous leukemia K562/ADM cells by downregulating P-gp, MRP1 and BCRP expression via PI3K/Akt signaling pathway. Int J Oncol. 49:2529–2537. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Yi YJ, Jia XH, Wang JY, Li YJ, Wang H and Xie SY: Knockdown of HOXA10 reverses the multidrug resistance of human chronic mylogenous leukemia K562/ADM cells by downregulating P-gp and MRP-1. Int J Mol Med. 37:1405–1411. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Zhao L, Shan Y, Liu B, Li Y and Jia L: Functional screen analysis reveals miR-3142 as central regulator in chemoresistance and proliferation through activation of the PTEN-AKT pathway in CML. Cell Death Dis. 8:e28302017. View Article : Google Scholar : PubMed/NCBI

19 

Liu W, He J, Yang Y, Guo Q and Gao F: Upregulating miR-146a by physcion reverses multidrug resistance in human chronic myelogenous leukemia K562/ADM cells. Am J Cancer Res. 6:2547–2560. 2016.PubMed/NCBI

20 

Zhou H, Li Y, Liu B, Shan Y, Li Y, Zhao L, Su Z and Jia L: Downregulation of miR-224 and let-7i contribute to cell survival and chemoresistance in chronic myeloid leukemia cells by regulating ST3GAL IV expression. Gene. 626:106–118. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Keeshan K, He Y, Wouters BJ, Shestova O, Xu L, Sai H, Rodriguez CG, Maillard L, Tobias JW, Valk P, et al: Tribbles homolog 2 inactivates C/EBPα and causes acute myelogenous leukemia. Cancer Cell. 10:401–411. 2006. View Article : Google Scholar : PubMed/NCBI

22 

McCubrey JA, Steelman LS, Chappell WH, Abrams SL, Wong EW, Chang F, Lehmann B, Terrian DM, Milella M, Tafuri A, et al: Roles of the Raf/MEK/ERK pathway in cell growth, malignant transformation and drug resistance. Biochim Biophys Acta. 1773:1263–1284. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Yang S and Liu G: Targeting the Ras/Raf/MEK/ERK pathway in hepatocellular carcinoma. Oncol Lett. 13:1041–1047. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Guo Y, Ding Y, Zhang T and An H: Sinapine reverses multi-drug resistance in MCF-7/dox cancer cells by downregulating FGFR4/FRS2alpha-ERK1/2 pathway-mediated NF-kappaB activation. Phytomedicine. 23:267–273. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Buonato JM and Lazzara MJ: ERK1/2 blockade prevents epithelial-mesenchymal transition in lung cancer cells and promotes their sensitivity to EGFR inhibition. Cancer Res. 74:309–319. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Zhao YY, Yu L, Liu BL, He XJ and Zhang BY: Downregulation of P-gp, Ras and p-ERK1/2 contributes to the arsenic trioxide-induced reduction in drug resistance towards doxorubicin in gastric cancer cell lines. Mol Med Rep. 12:7335–7343. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Fan DP, Zhang YM, Hu XC, Li JJ and Zhang W: Activation of AKT/ERK confers non-small cell lung cancer cells resistance to vinorelbine. Int J Clin Exp Pathol. 7:134–143. 2013.PubMed/NCBI

28 

Ochi N, Takigawa N, Harada D, Yasugi M, Ichihara E, Hotta K, Tabata M, Tanimoto M and Kiura K: Src mediates ERK reactivation in gefitinib resistance in non-small cell lung cancer. Exp Cell Res. 322:168–177. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Droebner K, Pleschka S, Ludwig S and Planz O: Antiviral activity of the MEK-inhibitor U0126 against pandemic H1N1v and highly pathogenic avian influenza virus in vitro and in vivo. Antiviral Res. 92:195–203. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Shukla V, Coumoul X, Wang RH, Kim HS and Deng CX: RNA interference and inhibition of MEK-ERK signaling prevent abnormal skeletal phenotypes in a mouse model of craniosynostosis. Nat Genet. 39:1145–1150. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Tong Y, Huang H and Pan H: Inhibition of MEK/ERK activation attenuates autophagy and potentiates pemetrexed-induced activity against HepG2 hepatocellular carcinoma cells. Biochem Biophys Res Commun. 456:86–91. 2015. View Article : Google Scholar : PubMed/NCBI

32 

Gu FM, Li QL, Gao Q, Jiang JH, Huang XY, Pan JF, Fan J and Zhou J: Sorafenib inhibits growth and metastasis of hepatocellular carcinoma by blocking STAT3. World J Gastroenterol. 17:3922–3932. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Gleixner KV, Schneeweiss M, Eisenwort G, Berger D, Herrmann H, Blatt K, Greiner G, Byrgazov K, Hoermann G, Konopleva M, et al: Combined targeting of STAT3 and STAT5: A novel approach to overcome drug resistance in chronic myeloid leukemia. Haematologica. 102:1519–1529. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

April-2018
Volume 39 Issue 4

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Ma X, Zhou X, Qu H, Ma Y, Yue Z, Shang W, Wang P, Xie S, Li Y, Sun Y, Sun Y, et al: TRIB2 knockdown as a regulator of chemotherapy resistance and proliferation via the ERK/STAT3 signaling pathway in human chronic myelogenous leukemia K562/ADM cells. Oncol Rep 39: 1910-1918, 2018.
APA
Ma, X., Zhou, X., Qu, H., Ma, Y., Yue, Z., Shang, W. ... Sun, Y. (2018). TRIB2 knockdown as a regulator of chemotherapy resistance and proliferation via the ERK/STAT3 signaling pathway in human chronic myelogenous leukemia K562/ADM cells. Oncology Reports, 39, 1910-1918. https://doi.org/10.3892/or.2018.6249
MLA
Ma, X., Zhou, X., Qu, H., Ma, Y., Yue, Z., Shang, W., Wang, P., Xie, S., Li, Y., Sun, Y."TRIB2 knockdown as a regulator of chemotherapy resistance and proliferation via the ERK/STAT3 signaling pathway in human chronic myelogenous leukemia K562/ADM cells". Oncology Reports 39.4 (2018): 1910-1918.
Chicago
Ma, X., Zhou, X., Qu, H., Ma, Y., Yue, Z., Shang, W., Wang, P., Xie, S., Li, Y., Sun, Y."TRIB2 knockdown as a regulator of chemotherapy resistance and proliferation via the ERK/STAT3 signaling pathway in human chronic myelogenous leukemia K562/ADM cells". Oncology Reports 39, no. 4 (2018): 1910-1918. https://doi.org/10.3892/or.2018.6249