This article is mentioned in:

Introduction

Colorectal cancer (CRC) is the most frequently diagnosed malignancy of the gastrointestinal tract. During recent decades, the incidence and mortality of CRC have been rapidly rising in China and the burden of this cancer will continue to be severe in the future (1,2). In spite of treatment combinations including surgery and adjuvant therapies, more than half of the cases with resected CRCs will finally result in tumor recurrence and metastasis. Current clinicopathological biomarkers are still incapable of accurately predicting tumor progression or further stratifying CRC patients with the same TNM stage. Therefore, it is necessary to develop new prognostic biomarkers for improving the stratification of CRC cases and for exploring original therapeutic alternatives.

MicroRNAs (miRNAs) are ~22 nucleotide, endogenous, non-coding RNAs that can induce translational suppression and mRNA degradation by binding to complementary sequences in the 3′untranslated regions (3′UTR) of the targeted mRNAs. Several studies revealed abundant miRNA expression abnormalities in CRC tissues compared with normal tissues. A number of miRNAs were proven to be involved in diverse biological processes of CRC such as cell proliferation, apoptosis, angiogenesis, invasion and metastasis. For example, the miR-143/145 cluster suppresses CRC cell growth through modulation of the KRAS signaling pathway (3,4). A positive feedback regulatory network exists between p53 and miR-34a, and the latter indirectly upregulates p53-dependent apoptosis in CRC (5,6). The c-Myc-mediated transcriptional suppression of miR-15-16 in hypoxia promotes tumor angiogenesis and hematogenous metastasis by upregulating FGF2 (7). Furthermore, a double-negative feedback loop between the miR-200 family and E-cadherin transcriptional suppressors ZEB1 and ZEB2 mediates epithelial-mesenchymal transition (EMT), subsequently regulating the metastatic behavior of CRC (8).

Growing evidence suggests miR-197 as a novel biomarker for various cancers (9). Several studies revealed that miR-197 may be an oncomiR in cancer cell invasion and metastasis. For example, miR-197 induces epithelial-mesenchymal transition in pancreatic cancer cells along with the downregulation of p120 catenin, an E-cadherin interacting protein (10). By targeting CD82, miR-197 may also play a vital role as an invasion and migration promoter in gastric cancer and hepatocellular cancer via the EGFR-ERK1/2-MMP7 signaling pathway (11,12). Our previous research revealed that miR-197 could influence the sensitivity of CRC cells to fluorouracil (5-FU) by modulating the expression of thymidylate synthase (TYMS); however it had no impact on cell proliferation and cell cycle regulation (13). However, it is unclear whether miR-197 exhibits other biological functions in CRC. Thus, in the present study, we intended to uncover the role of miR-197 in cell migration and invasion of CRC and the possible underlying mechanisms.

Materials and methods

Tumor cell culture

HCT8 (ileocecal colorectal adenocarcinoma), HCT116 (colorectal carcinoma) and SW480 (Dukes' type B, colorectal adenocarcinoma) cell lines were purchased from the Cell Resource Center, Institute of Basic Medical Sciences (IBMS), Chinese Academy of Medical Sciences and Peking Union Medical College (CAMS/PUMC) (Beijing, China). They were maintained in Gibco™ Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS) (both from Thermo Fisher Scientific, Inc., Waltham, MA, USA) in a humidified 5% CO2/95% air atmosphere at 37°C.

miRNA and siRNA transfection

The synthetic miR-197 mimic, miR-197 inhibitor, mimic control and inhibitor control were purchased from GenePharma Inc. (Shanghai, China), and their sequences are listed in Table I. The siRNAs for IGFBP3 and siRNA control were synthesized (Invitrogen; Thermo Fisher Scientific, Inc.) and the sequences are listed in Table II.

Table I. Sequences of microRNAs.

Table I.

Sequences of microRNAs.

Name	Sequences
miR-197 mimic	5′-UUCACCACCUUCUCCACCCAGC-3′
	5′-UGGGUGGAGAAGGUGGUGAAUU-3′
Mimic control	5′-UUCUCCGAACGUGUCACGUTT-3′
	5′-ACGUGACACGUUCGGAGAATT-3′
miR-197 inhibitor	5′-GCUGGGUGGAGAAGGUGGUGGUGAA-3′
Inhibitor control	5′-CAGUACUUUUGUGUAGUACAA-3′

Table II. IGFBP3 siRNA sequence.

Table II.

IGFBP3 siRNA sequence.

Name	Sense (5′-3′)	Antisense (5′-3′)
IGFBP3 siRNA	GUUGACUACGAGUCUCAGATT	UCUGAGACUCGUAGUCAACTT

In vitro migration and invasion assays

Transwell chambers (8-µm pore size; Costar; Corning Costar, Cambridge, MA, USA) were used in the in vitro migration assay. Colorectal cancer cells were transfected with the miR-197 mimic or the mimic control. Following 48 h, cells were detached with trypsin, washed with PBS and resuspended in serum-free medium. Two hundred microliters of cell suspension (1×105 cells/ml for miR-197 mimic and its control, 2×105 cells/ml for miR-197 inhibitor and its control) was added to the upper chamber, and 500 ml of complete medium was added to the bottom well. The cells that had not migrated were removed from the upper surfaces of the filters using cotton swabs, and the cells that had migrated to the lower surfaces of the filters were fixed with 4% paraformaldehyde solution and stained with crystal violet. Images of 3 random fields (×10 magnification) were captured from each membrane, and the number of migratory cells was counted as previously described (14). Similar inserts coated with Matrigel were used to determine the invasive potential.

RNA reverse transcription and RT-qPCR

Total RNA was extracted using the Invitrogen™ TRIzol total RNA isolation reagent (Thermo Fisher Scientific, Inc.) and purified with the Column DNA Erasol kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. mRNA levels were assessed with RT-qPCR using SYBR-Green I (Takara Biotechnology Co., Ltd., Dalian, China). The gene expression level was normalized to the endogenous reference gene GAPDH. The experiments were performed in triplicate. The primers for RT-qPCR are listed in Table III. The primers for miR-197 and U6 were purchased from Qiagen (Duesseldorf, Germany) (Table IV). Reverse transcription of miRNAs was performed with a miScript Reverse Transcription kit (Qiagen). The expression of mature miRNAs was determined using miRNA-specific quantitative RT-qPCR (Takara Biotechnology Co., Ltd.). The expression levels were normalized to the U6 endogenous control and assessed by the comparative Ct (ΔΔCq) method (15).

Table III. Primers (mRNA) for real-time PCR.

Table III.

Primers (mRNA) for real-time PCR.

Name	Forward primer (5′-3′)	Reverse primer (5′-3′)
GAPDH	GAAGGTGAAGGTCGGAGTC	AAGATGGTGATGGGATTTC
IGFBP3	GAGGGCGACACTGCTTTTTC	CCAGCTCCAGGAAATGCTAG

Table IV. Primers (miRNA) for real-time PCR.

Table IV.

Primers (miRNA) for real-time PCR.

miRNA	Primer sequence (5′-3′)
hsa-miR-197	TTCACCACCTTCTCCACCCAGC
U6	CAAGGATGACACGCAAATTCG

Prediction for target genes using bioinformatics web server

Since miRNAs commonly act on posttranscriptional regulation by targeting 3′UTRs of mRNAs of target genes, in order to ascertain the mechanism underlying the involvement of miR-197 in biological processes, we first searched for possible target genes of miR-197 in the database on the web server ‘Targetscan’ (http://www.targetscan.org/vert_71/). Subsequently, we determined the candidate genes for our study from this repertoire of target genes by carefully reviewing corresponding literature and selecting the most possible target genes which had been reported to participate in cell migration, invasion and tumor metastasis.

Dual-luciferase reporter gene construct and dual-luciferase reporter assay

Fragments from 3 candidate genes including ADAMTS5, CBL and IGFBP3 whose 3′-UTRs contained the predicted binding site for hsa-miR-197, and flanking sequences on each side were synthesized with a short extension containing cleavage sites for XhoI (5′-end) and NotI (3′-end) (Table V); second fragments containing mutated binding site sequences were also synthesized. The two constructs were termed WT (Gene-wild type) and MT (Gene-mutant). The fragments were cloned into the psiCHECK™-2 vector (Promega Corporation, Madison, WI, USA). Ten nanograms of WT, MT or control vector and 200 nmol/l miR-197 mimic were transfected into 293T cells (293T cells were supplied by the Cell Center of Institue of Basic Medical Sciences, Chinese Academy of Medical Sciences) using Invitrogen™ Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The cells were harvested 24 h following transfection and assayed for Renilla and firefly luciferase activities using the Dual-Luciferase Reporter Assay System (Promega Corporation).

Table V. Sequences of target genes and mutated target genes.

Table V.

Sequences of target genes and mutated target genes.

Target genes	Sequences
IGFBP3 wild-type	F 5′-TCGAGCAGCTGGCTACAGCCTCGATTTATATTTCTGTTTGTGGTGAACTGATTTTTTTTAAACCAAAGTTTAGAAAGAGGGC-3′
	R 5′-GGCCGCCCTCTTTCTAAACTTTGGTTTAAAAAAAATCAGTTCACCACAAACAGAAATATAAATCGAGGCTGTAGCCAGCTGC-3′
IGFBP3 mutated	F 5′-TCGAGCAGCTGGCTACAGCCTCGATTTATATTTCTGTTTCTGATTTTTTTTAAACCAAAGTTAGAAAGAGGGC-3′
	R 5′-GGCCGCCCTCTTTCTAAACTTTGGTTTAAAAAAAATCAGAAACAGAAATATAAATCGAGGCTGTAGCCAGCTGC-3′
ADAMTS5 wild-type	F 5′-TCGAGCAAAGATAACTGGAGGATTCAGCACTGATGCAGTCGTGGTGAACAGGAGGTCTACCTAACGCACAGAAAGTCATGCTTGC-3′
	R 5′-GGCCGCAAGCATGACTTTCTGTGCGTTAGGTAGACCTCCTGTTCACCACGACTGCATCAGTGCTGAATCCTCCAGTTATCTTTGC-3′
ADAMTS5 mutated	F 5′-TCGAGCAAAGATAACTGGAGGATTCAGCACTGATGCAGTCCAGGAGGTCTACCTAACGCACAGAAAGTCATGCTTGC-3′
	R 5′-GGCCGCAAGCATGACTTTCTGTGCGTTAGGTAGACCTCCTGGACTGCATCAGTGCTGAATCCTCCAGTTATCTTTGC-3′
CBL wild-type	F 5′-TCGAGAGCTATGAGGCACCTCCTACGTCTGTTTTCTGGCTGTGGTGACTTGGGATTTTTAACCTTATATATCTTTTTCCTTTGC-3′
	R 5′-GGCCGCAAAGGAAAAAGATATATAAGGTTAAAAATCCCAAGTCACCACAGCCAGAAAACAGACGTAGGAGGTGCCTCATAGCTC-3′
CBL mutated	F 5′-TCGAGAGCTATGAGGCACCTCCTACGTCTGTTTTCTGGCTCTTGGGATTTTTAACCTTATATATCTTTTTCCTTTGC-3′
	R 5′-GGCCGCAAAGGAAAAAGATATATAAGGTTAAAAATCCCAAGAGCCAGAAAACAGACGTAGGAGGTGCCTCATAGCTC-3′

[i] F, forward; R, reverse.

Western blot analysis

Following washing twice with PBS, cells were lysed in ice-cold Radio Immunoprecipitation Assay (RIPA) lysis buffer (Beyotime Institute of Biotechnology, Nanjing, China) and manually scraped from the culture plates. Proteins were separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels, electroblotted onto a polyvinylidene difluoride (PVDF) membrane and incubated with anti-IGFBP3 antibody (1:1,000 dilution; cat. no. sc-135947; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), anti-GAPDH antibody (1:1,000 dilution; cat. no. sc-47724; Santa Cruz Biotechnology, Inc.), followed by incubation with a secondary anti-rabbit or anti-mouse horseradish peroxidase-conjugated antibody (1:1,000; Zhongshan Golden Bridge Biotechnology, Beijing, China). Antibody-antigen complexes were detected using a chemiluminescent ECL reagent (EMD Millipore, Billerica, MA, USA).

Clinical samples

Fresh frozen samples of colorectal adenocarcinomas were collected from 21 patients who underwent surgery at Peking Union Medical College Hospital (PUMCH) from May 2015 to July 2015. All patients had signed written informed consents prior to enrolling in the study before admission. The use of human subjects in this study was also approved by the Ethics Committee at Peking Union Medical College Hospital (Beijing, China). This cohort includes 11 males and 10 females patients with average age of 60.5 (46–72 years). Basic clinicopathological features of these 21 patients are listed in Tables VI and VII.

Table VI. Relationship of miR-197 and IGFBP3 expression with clinicopathological factors.

Table VI.

Relationship of miR-197 and IGFBP3 expression with clinicopathological factors.

Clinicopathological features	miR-197 high expression ΔCT level (≤7.64) n (%)	miR-197 low expression ΔCT level (>7.64) n (%)	P-value	IGFBP3 Negative n (%)	IGFBP3 Positive n (%)	P-value
Tumor invasion			0.090			0.131
T2-3	7 (41.2)	10 (58.8)		9 (52.9)	8 (47.1)
T4	4 (100)	0 (0)		4 (100.0)	0 (0%)
N staging			0.635			0.336
N1	4 (66.7)	2 (33.3)		5 (83.3)	1 (16.7)
N2	7 (46.7)	8 (53.3)		8 (53.3)	7 (46.7)
Histology			0.149			0.325
Good and moderate	10 (62.5)	6 (37.5)		11 (66.8)	5 (31.2)
Poor	1 (20.0)	4 (80.0)		2 (40.0)	3 (60.0)
Lymphovascular invasion			0.890			0.776
No	8 (53.3)	7 (46.7)		9 (60.0)	6 (40.0)
Yes	3 (50.0)	3 (50.0)		4 (66.7)	2 (33.3)
Site			0.659			0.965
Colon	6 (46.2)	7 (53.8)		8 (61.5)	5 (38.5)
Rectum	5 (62.5)	3 (37.5)		5 (63.5)	3 (37.5)

Table VII. Clinicopathological features of the CRC patients.

Table VII.

Clinicopathological features of the CRC patients.

No.	Histology	Site	Stage	miR-197 (ΔCt)	IGFBP3 (−/+)
1	Adenocarcinoma	Rectum	IIIB (pT3N1)	7.69	Positive
2	Adenocarcinoma	Colon	IIIB (pT3N1)	7.69	Positive
3	Adenocarcinoma	Rectum	IIIC (pT4N2b)	7.38	Negative
4	Adenocarcinoma	Rectum	IIIB (pT3N1)	6.57	Negative
5	Adenocarcinoma	Colon	IIIB (pT3N1)	8.68	Positive
6	Adenocarcinoma	Rectum	IIIB (pT3N1)	7.72	Positive
7	Adenocarcinoma	Colon	IIIB (pT3N2a)	8.77	Negative
8	Adenocarcinoma	Colon	IIIB (pT4aN1)	2.20	Negative
9	Adenocarcinoma	Rectum	IIIA (pT2N1)	7.84	Positive
10	Adenocarcinoma	Colon	IIIB (pT3N1)	5.70	Negative
11	Adenocarcinoma	Colon	IIIB (pT3N2a)	4.34	Negative
12	Adenocarcinoma	Colon	IIIB (pT3N1)	7.94	Positive
13	Adenocarcinoma	Rectum	IIIB (pT3N1)	6.54	Negative
14	Adenocarcinoma	Colon	IIIC (pT3N2b)	2.37	Negative
15	Adenocarcinoma	Colon	IIIB (pT3N1)	8.75	Positive
16	Adenocarcinoma	Colon	IIIB (pT3N2a)	8.47	Negative
17	Adenocarcinoma	Rectum	IIIB (pT4aN1)	6.95	Negative
18	Adenocarcinoma	Rectum	IIIB (pT4aN1)	7.64	Negative
19	Adenocarcinoma	Colon	IIIB (pT3N1)	7.99	Negative
20	Adenocarcinoma	Colon	IIIB (pT3N2a)	7.22	Positive
21	Adenocarcinoma	Colon	IIIB (pT3N1)	7.00	Negative

Immunohistochemical staining (IHC)

IGFBP3 expression was evaluated by IHC staining. Briefly, after 5-µm sections were deparaffinized, antigen retrieval was performed by use of heat-induced epitoperetrieval with 10 mM citrate buffer. Sections were incubated with a monoclonal anitbody against IGFBP3 (cat. no. sc-135947 Santa Cruz Biotechnology, Inc.) at 1:250 dilution. The IGFBP3 antibody was detected using the avidin-biotin-peroxidase technique (Dako LSAB kit; Dako, Carpinteria, CA, USA). The expression levels of IGFBP3 were determined by a pathologist. The classification of ‘- and +’ was defined by the percentage of IGFBP3 positive cells at the level of <5 and ≥5%, respectively.

Statistical analysis

Comparisons between different groups in migration and invasion assays were analyzed using t-tests (two-sided). ANOVA followed by Dunnette's test was applied to compare intergroup differences in luciferase reporter assays. Correlation between miR-197 and IGFBP3 expression was determined by correlate bivariate Spearman assay. Chi-square Fisher's exact test were used to calculate differences of miR-197 expression between different groups of clinicopathological factors. All data were calculated using SPSS 19.0 (IBM Corp., Armonk, NY, USA) and two-sided P-value <0.05 was considered to indicate a statistically significant difference.

Results

miR-197 enhances migration and invasion in CRC cell lines in vitro

We first evaluated the efficacy of miR-197 overexpression and inhibition using synthetic miR-197 mimic, miR-197 inhibitor and corresponding controls in CRC cell lines (Fig. 1). We then investigated the effect of miR-197 on the migration and invasion in colorectal cell lines. HCT8, HCT116 and SW480 cells were transfected with either miR-197 mimic, mimic control, miR-197 inhibitor or inhibitor control and then subjected to cell migration and invasion assays (Fig. 2). In the HCT8 cell line, significantly more tumor cells in the miR-197 mimic group had migrated to the lower surface of the filter compared with the miR-197 mimic control group (33.50±4.65 vs. 18.00±3.91, P<0.05) in the migration assay and similarly, significantly more cells invaded to the lower surface in the miR-197 mimic group than its control group in the invasion assay (24.75±2.21 vs. 18.00±3.91, P<0.05, Fig. 2A). On the contrary, significant less HCT8 cells in miR-197 inhibitor group were found on the lower surface of the filter compared with its control group in the migration assay (32.25±2.98 vs. 47.25±3.20, P<0.05) and also in the invasion assay (31.00±3.16 vs. 46.75±4.42, P<0.05, Fig. 2A). Furthermore, similar results were also achieved in the HCT116 and SW480 cells (Fig. 2B and C), indicating that miR-197 could regulate migration and invasion in these 3 CRC cell lines in vitro.

Figure 1. Transfection efficiency of miR-197 mimic, miR-197 inhibitor and their controls in CRC cells by RT-qPCR. (A and B) In HCT8 cells and (C and D) HCT-116 cells, miR-197 expression was significantly increased in cells transfected with miR-197 mimics compared with its control and miR-197 expression was significantly reduced in cells transfected with miR-197 inhibitor compared with its control. Data are from 3 independent experiments. *P<0.05.

Figure 2. (A) The effect of miR-197 expression on the migration and invasion in HCT8 cells. Transwell migration (n=4) and invasion (n=4) assays revealed that HCT8 cells transfected with the miR-197 inhibitor had significantly lower invasive and migratory potentials than the control. On the contrary, HCT8 cells transfected with the miR-197 mimic had greater invasive and migratory potentials than the control. *P<0.05. (B and C) The effect of miR-197 expression on the migration and invasion in HCT-116 and SW480 cells, respectively: HCT-116 and SW480 cells transfected with the miR-197 inhibitor had lower invasive and migratory potentials than the control. Conversely, HCT-116 and SW480 cells transfected with the miR-197 mimic had greater invasive and migratory potentials than the control. *P<0.05.

miR-197 directly suppresses the expression of IGFBP3 by targeting its 3′UTR

The mRNAs which may be targeted by miR-197 were predicted, and genes associated with tumor invasion and metastasis were selected. According to this principle, we screened out 3 candidate target genes including IGFBP3, ADAMTS5 and CBL. Predicted miR-197 binding sites within the 3′UTR of mRNAs of these 3 genes are listed in Figs. 3A, 4B and D, respectively.

Figure 3. (A) Analysis of the 3′UTR sequence of the IGFBP3 gene by TargetScan revealed a putative miR-197 binding site. (B) The miR-197 binding site on IGFBP3-3′UTR was confirmed by luciferase assay in 293T cells (n=3). The luciferase activities of cells co-transfected with wild-type IGFBP3 3′UTR sequence (IGFWT) decreased significantly upon miR-197 overexpression compared to those of cells co-transfected with the control vector (*P<0.05) or mutant IGFBP3 3′UTR sequence (IGFMT) (*P<0.05). Luciferase activity of IGFMT was not significantly affected by miR-197 compared to the control group (P>0.05). NC, negative control; 197m, miR-197 mimic; INC, negative control inhibitor; 197i, miR-197 inhibitor. (C) Western blot assay showed that IGFBP3 protein expression was regulated by miR-197 in HCT8 cells. (D) Real-time PCR showed that the mRNA level of IGFBP3 was not significantly affected by miR-197.

Figure 4. The binding of miR-197 to the 3′UTR of ADAMTS5 and CBL genes are excluded by luciferase assay in 293T cells. (A and C) The luciferase activities of cells transfected with wild-type 3′ UTR of ADAMTS5 (ADAMTS5-1WT) and CBL (CBLWT) upon miR-197 overexpression did not differ from those of cells transfected with the control vector or mutant 3′UTRs. Data represent the mean ± SD of 3 independent experiments. (B and D) Analysis of the 3′UTR sequences of ADAMTS5 and CBL by TargetScan revealed putative miR-197 binding sites.

Compared to the control group, miR-197 mimic significantly decreased the luciferase activity when co-transfected with IGFBP3-WT reporter plasmid (Fig. 3B, P<0.05). However, this inhibitory effect on luciferase activity mediated by miR-197 mimic was abolished by mutant reporter plasmid (Fig. 3B, P<0.05). In addition, miR-197 overexpression had no effect on the luciferase activities of ADAMTS5 (P=0.974, Fig. 4A) and CBL (P=0.098, Fig. 4C). We decided to choose IGFBP3 as research target of our study due to its tight connection with CRC according to multiple studies.

To demonstrate whether miR-197 could exert a similar influence on IGFBP3 expression in CRC, we transfected HCT8 cell line again with the miR-197 mimic, miR-197 inhibitor or their corresponding controls, and then determined IGFBP3 expression at the RNA and protein levels, respectively. The protein level of IGFBP3 in HCT8 cells was obviously decreased following transfection with miR-197 mimic and increased following transfection with miR-197 inhibitor (Fig. 3C), while the alterations of IGFBP3 mRNA did not reach statistical significance upon overexpression and inhibition of miR-197 (P>0.05, Fig. 3D). These findings revealed that miR-197 suppressed the protein output of IGFBP3 rather than degrading its mRNA, indicating that IGFBP3 was regulated by miR-197 in CRC cells at the post-transcriptional level.

Downregulation of IGFBP3 boosts migration and invasion of CRC cell lines

We then investigated the role of IGFBP3 in CRC cell migration and metastasis. Small interfering RNA (siRNA) designed to target IGFBP3 was employed. The transfection of siRNA resulted in a significant reduction in IGFBP3 mRNA and protein level in HCT8 and HCT-116 cells compared to the siRNA-control (Fig. 5). Both cell lines were transfected with either IGFBP3 siRNA (si-IGFBP3) or siRNA-control, and then subjected to cell migration and cell invasion assay. In the migration assay, the number of migratory HCT8 cells in the si-IGFBP3 group was significantly greater than the migratory HCT8 cells in the si-control group (54.75±4.57 vs. 32.75±7.18, P<0.05, Fig. 6A and B). In addition, significantly more HCT8 cells in the si-IGFBP3 group had invaded to the lower surface of filters compared with those in si-control group (12.75±3.50 vs. 2.75±1.70, P<0.05) in the invasion assay (Fig. 6A and B). Similar results were also achieved in HCT-116 cells (Fig. 6C and D). Cell motility of both assays was significantly enhanced following IGFBP3 downregulation compared with the control in HCT-116 cells, with similar results in HCT8 cells, which indicated that IGFBP3 was a suppressor protein in the process of migration and invasion in CRC cells.

Figure 5. Efficiency of siRNA-mediated deletion of IGFBP3. (A) RT-PCR assay revealed the IGFBP3 expression at the mRNA level was significantly reduced in HCT8 and HCT-116 cells transfected with si-IGFBP3 compared with those transfected with siRNA control. *P<0.05; (B) Western blot assay revealed the IGFBP3 expression at the protein level in HCT8 and HCT-116 cells following transfection with si-RNA control and si-IGFBP3.

Figure 6. Efficacy of IGFBP3 RNA interference on cell migration and invasion in CRC cells. (A and B) Transwell migration (n=4) and invasion (n=4) assays revealed that HCT8 cells transfected with the IGFBP3 siRNA (200 nM) had greater invasive and migratory potentials than the control (siRNA control). n=4, *P<0.05. (C and D) Transwell migration (n=4) and invasion (n=4) assays showed that HCT-116 cells transfected with the IGFBP3 siRNA (200 nM) had greater invasive and migratory potentials than the control (siRNA control). n=4, *P<0.05.

Correlation of miR-197 with IGFBP3 in CRC patients

We assessed the miR-197 quantity of cancer tissues using RT-PCR in fresh frozen samples and IGFBP3 expression using IHC in corresponding paraffin samples in order to analyze the correlation between miR-197 and IGFBP3 expression in CRC patients. In this cohort of 21 stage III CRC patients, there were one stage IIIA cancer, 2 stage IIIC cancers, and 18 patients with stage IIIB cancer; 13 patients had colon cancer and 8 patients had rectum cancer. The median ΔΔCq value of miR-197 was 7.64 (2.2–8.77). We dichotomized IGFBP3 protein expression using ‘positive’ or ‘negative’ as displayed in Fig. 7. There were 8 IGFBP3-positive and 13 IGFBP3-negative tumors. We revealed that the miR-197 ΔΔCq level was significantly associated with the expression of IGFBP3 with statistical significance (P=0.026), so that miR-197 expression was negatively related to IGFBP3 protein expression in the CRC tumor tissues.

Figure 7. Immunohistochemistry (IHC) images of differential IGFBP3 expression. For exploring the association between IGFBP3 and miR-197 in colorectal cancer tissue, we dichotomized IGFBP3 protein expression using IHC. (A) Negative staining was defined as the staining of <5% target cells; (B) positive staining was defined as the staining of ≥5% target cells.

Furthermore, we divided miR-197 expression level into two groups using the median ΔΔCq value (≤7.64 vs. >7.64), and explored whether there was any difference in miR-197 expression between the different groups of clinicopathological factors. Although we discovered a trend that there were more miR-197 high expression tumors in the T4 group compared to the T2-3 group, it was not statistically significant (P=0.09), and thus were other factors such as lymph node stage, histology, lymphovascular involvement and tumor site (Table VI). In addition we did not detect any differences in the expression of IGFBP3 between different groups of pathological features (Table VI). Finally, we aimed to clarify the association between prognosis and differential expression of miR-197 plus IGFBP3, but we failed due to the limited events of recurrence and death. Basic clinical information of this cohort of CRC patients is listed in Table VII.

Discussion

The functions of miR-197 in tumorigenesis are complicated. Several studies have found that miR-197 plays controversial roles in the initiation and progression of different malignancies. It decreases apoptosis in p53 wild-type non-small cell lung cancer (NSCLC) (16), but has the opposite function in multiple myeloma (17). It inhibits proliferation in glioblastoma (18) but promotes invasion and metastasis in gastric (11), pancreatic (10) and hepatocellular cancer (HCC) (12). In colorectal cancer, our previous studies revealed that miR-197 had no influence on proliferation and cell cycle distribution, but it mediated the 5-FU response by targeting thymidylate synthase in stage IV CRC (13). In the present study, we observed a unanimous phenomenon in 3 different CRC cell lines that miR-197 upregulation promoted migration and invasion, while its downregulation hindered the same process. This phenomenon in CRC parallels that observed in other malignancies arising from the epithelium. To the best of our knowledge, we revealed for the first time the biological activities of miR-197 and the mechanism underlying its function in CRC.

Several studies have revealed that miR-197, alone or grouped with other miRNAs, may be a novel prognostic biomarker for several human tumors that arise from epithelial tissues. For example, miR-197 was found to be an unfavorable prognostic or metastatic predictor in NSCLC, and to be associated with larger tumors and squamous histology (19). Finally, meta-analysis displayed that a panel of multiple miRNAs may deliver much greater predicting efficacy than a single miRNA assay (20) and recently, 7 miRNA signatures including miR-197 have been presented to be a feasible survival indicator for CRC patients (21), which collaborates our assumption about the role of miR-197 in CRC prognosis. In order to clarify whether miR-197 may also regulate IGFBP3 in CRC tissues similar to the results we achieved in vitro, we detected the miR-197 level and protein expression of IGFBP3 in tumor tissues of 21 CRC patients, and discovered a negative association between miR-197 and IGFBP3. However, we failed to detect any differences in the miR-197 expression level between the different groups of clinicopathological characteristics. This may be due to the fact that our cohort was small and highly homogenous with stage III cancers. However a tendency of a greater proportion of miR-197 high expression tumors was observed in the T4 group compared to the T2-3 group, which may hint that the deeper the tumor invades, the more miR-197 is expressed. However, direct evidence of the association of miR-197 with disease-free survival and overall survival was not obtained, due to the fact that the majority of these CRC cases were not presented with disease recurrence and cancer-related death; therefore, there were not enough data to come to a conclusion about the effect of miR-197 on prognosis.

In the present study, we confirmed IGFBP3 as one of the targets of miR-197 and their inverse correlation in CRC patient samples. IGFBP3 is the most abundant IGFBP in circulation. It attenuates IGF1-induced IGFR1 signaling events by sequestering IGF1 away from IGF1R (22). To date, accumulating evidence revealed that the IGF1/IGF1R axis stimulates epithelial to mesenchymal transition and contributes to tumor metastasis including CRC (23,24). In addition, IGFBP3 may also affect migration and invasion in a complex intrinsic network, an IGFR-independent manner. For example, IGFBP3 inhibits intracellular adhesion in head and neck squamous cell carcinoma through blocking c-jun and c-fos transcription and integrin β4 expression (25). It also suppresses prostate cancer progression through degrading NF-κB signaling (26). In CRC, IGFBP3 has long been considered as a tumor suppressor (27). However, the biological role and mechanism of IGFBP3 in the progression and metastasis in CRC are poorly understood. We used in vitro assays and found that IGFBP3 decreased migration and invasion in the HCT8 and HCT-116 cell lines. It is not known yet whether this inhibitory effect correlates with disease progression, resembling the situation in breast cancer (28). Thus far, the cellular effects of IGFBPs were reported to be mediated post-translationally. Other than methylation and proteolysis, miRNA regulation may be another mode for IGFBP3 inactivation. For example, miR-21 enhances glioblastoma tumorigenesis by downregulating IGFBP3 (29); onco-miRs miR-155 and miR-125b also target IGFBP3, promoting migration and invasion in HCC and NSCLC through the IGF-II/IGF-1R axis (30) and downstream PI3K/AKT activation (31). miRNAs regulate complementary mRNAs by inducing translational suppression and mRNA destablization. Although IGFBP3 mRNA decay accounts for the majority of miRNA-mediated regulations in the above-mentioned studies, we speculated that miR-197 targets IGFBP3 to promote invasion and migration in CRC through a translational suppression manner, since the IGFBP3 mRNA level was only slightly altered while its protein expression was significantly suppressed upon miR-197 expression. One comparable scenario is the regulation of proliferation and invasion in CRC by miR-21 through the PTEN/PI-3K/Akt signaling pathway (32). Dissociation of translation initiation complex eIF4F was thought to be a mechanism underlying miRNA-mediated translational suppression (33). Reactivation of suppressed targets by degradation of RISC under certain contexts could also explain why target mRNA does not have to end up in degradation (34). However, future studies are needed to uncover how two silencing modes of miRNAs contribute to the overall silencing of target mRNAs.

Due to its critical role in the IGF1/IGF1R axis and various bioactivity, emerging clinical studies have attempted to apply the serum IGFBP3 level and IGFBP3 methylation status for prognostic prediction in CRC. An elevated serum IGFBP3 level was previously reported to be correlated with a significant reduction of CRC mortality (35). Recently, high IGFBP3 gene methylation in the primary tumor has been identified as an independent predictor for recurrence risk in stage II CRC (36). However, other studies using the same methodologies revealed quite contrary or insignificant results (37,38). These data indicated that the aforementioned IGFBP3 assessments may not be accurate reflections of the local situation or IGFBP3 may be regulated by an intricate system. We used IHC staining to evaluate local IGFBP3 protein expression in tumor tissues but still no associations were found with clinicopathological factors. Nevertheless, it is too soon to exclude local IGFBP3 protein expression from being a biomarker. In gastric cancer, IGFBP3 deficiency in IHC was found to be correlated with advanced lymph node stage and poor survival (39). It is still necessary and promising to probe the relationship of local IGFBP3 expression with other clinicopathological factors and CRC patient prognosis in a larger cohort with mature survival data.

In addition, we also explored two other possible genes targeted by miR-197 using luciferase reporter assay and found that miR-197 overexpression had no inhibitory effect on the luciferase activity of CBL and ADAMTS5. Therefore, we excluded these two genes as targets of miR-197. Attention should be drawn to the fact that we did not succeed in cloning and expressing full-length IGFBP3 because it is too large, which may compromise the role of IGFBP3 as a tumor suppressor in CRC cell lines and its relationship with miR-197 from the opposite angle.

In conclusion, in the present study, we revealed that miR-197 overexpression could boost migration and invasion in CRC cell lines. miR-197 directly regressed the expression of IGFBP3 in CRC cells through targeting its 3′UTR.

Acknowledgements

The authors thank all the patients who participated in this study.

Funding

The present study was supported by grants from the National Natural Science Foundation of China (nos. 81472785 and 61435001) and grants from The 2016 PUMCH Science Fund for Junior Faculty (Pumch-2016-1.13).

Availability of data and materials

The datasets used during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

NZ and ZS co-conceived the study, managed its design and drafted the manuscript. NL and YG participated in acquisition and analysis of clinical data. JZ and QH contributed to the design of the study and carried out the molecular biological assay. LZ and CB participated in revising the manuscript critically for important intellectrual content. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee at Peking Union Medical College Hospital (Beijing, China). All patients signed written informed consents prior to enrolling in the present study before admission.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References