Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
March-2019 Volume 41 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2019 Volume 41 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

17β‑hydroxysteroid dehydrogenase 4 induces liver cancer proliferation‑associated genes via STAT3 activation

  • Authors:
    • Xin Lu
    • Lingyu Kong
    • Xi Wang
    • Weiran Liu
    • Panpan Ma
    • Lingling Jiang
  • View Affiliations / Copyright

    Affiliations: Department of Clinical Laboratory, Tangshan Maternal and Children Hospital, Tangshan, Hebei 063000, P.R. China, College of Integrative Chinese and Western Medicine, Hebei Medical University, Shijiazhuang, Hebei 050017, P.R. China, Department of Endocrinology, The Third Affiliated Hospital of Hebei Medical University, Shijiazhuang, Hebei 050017, P.R. China, Department of Chinese Medicine, Tangshan Maternal and Children Hospital, Tangshan, Hebei 063000, P.R. China, Department of Blood Transfusion, Hebei Provincial People's Hospital, Shijiazhuang, Hebei 050017, P.R. China, Department of Biochemistry and Molecular Biology, The Key Laboratory of Neurobiology and Vascular Biology, Hebei Medical University, Shijiazhuang, Hebei 050017, P.R. China
  • Pages: 2009-2019
    |
    Published online on: January 23, 2019
       https://doi.org/10.3892/or.2019.6981
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Accumulating evidence has implicated that the activation of signal transducer and activator of transcription 3 (STAT3) contributes to the progression of liver cancer by affecting the expression of proliferation‑associated genes. A previous study reported that elevated levels of 17β‑hydroxysteroid dehydrogenase 4 (HSD17B4) are observed in patients with liver cancer. The current study investigated how upregulated HSD17B4 expression promoted the expression of proliferation‑associated genes in rats with liver cancer. HSD17B4 expression in rats with liver cancer was significantly increased compared with the control group as determined by reverse transcription‑quantitative polymerase chain reaction and western blot assays. Immunohistochemical results revealed that STAT3 activation was positively correlated with increased HSD17B4 expression in tumor tissues from patients with liver cancer. Western blot results further suggested that HSD17B4 overexpression increased STAT3 activation via the protein kinase B and the mitogen‑activated protein kinase/extracellular‑signal‑regulated kinase signaling pathways in HepG2 cells. The present study suggested that overexpression may promote HepG2 proliferation by enhancing expression of various downstream targets of STAT3. Targeted inhibition of HSD17B4 may describe a novel approach in the prevention and treatment of liver cancer.

Introduction

Liver cancer is the third most fatal cancer in the world, with mortality rates of ≤0.49‰ and poor prognosis within the last 5 years (1–3). Although the underlying mechanisms of liver cancer development remains to be investigated, accumulating evidence has implicated that tumor cell proliferation contributes to the process of oncogenesis (4). Signal transducer and activator of transcription 3 (STAT3) is a nuclear transcription factor that promotes tumorigenesis, mediates the occurrence of liver cancer and serves a role in liver cancer development (5–7). STAT3 is phosphorylated upon activation, translocates into the nucleus and contributes to the process of oncogenesis by modulating the expression of various genes involved in proliferation (4). Inactivation of STAT3 leads to an inhibition of proliferation in liver cancer cell lines (8–10). The identification of genes regulating STAT3 activation may provide novel approaches for the treatment of liver cancer.

17β-Hydroxysteroid dehydrogenase 4 (HSD17B4) is widely distributed in peroxisomes of mammalian cells, with the highest levels reported for the liver (11–13). Previous studies have reported an increase in HSD17B4 expression in prostate and breast cancer and further tissues and cells (14,15). A recent study reported that HSD17B4 is upregulated in patients with liver cancer and HSD17B4 overexpression promotes HepG2 proliferation by enhancing cyclin D1 expression (16). It was demonstrated that STAT3 induces the transcription of cyclin D1 and serves an important role in hepatocyte proliferation (6,7). It is suggested that HSD17B4 may enhance STAT3 activation to promote tumor cell proliferation in liver cancer. However, the mechanism by which HSD17B4 promotes STAT3 activation in liver cancer requires to be investigated.

The current study investigated HSD17B4 upregulation and the correlation of HSD17B4 and the expression of various proliferation-associated genes in a liver cancer rat model, which was chemically induced using diethylnitrosamine (DEN). To understand how HSD17B4 promoted liver cancer cell proliferation, HSD17B4 and STAT3 levels were evaluated and a positive correlation between HSD17B4 and phosphorylated (p)-STAT3 in patients with liver cancer was observed. A connection to the protein kinase B (Akt) and the mitogen-activated protein kinase (MEK)/extracellular-signal-regulated kinase (ERK) signaling pathways was further established. The findings suggested that HSD17B4 promoted liver cancer cell proliferation via STAT3 activation and HSD17B4 inhibition may inspire liver cancer treatment in the future.

Materials and methods

Isolation of liver tissue from patients with liver cancer

Human liver tissues were obtained from 16 male patients (age, 40–70 years) with liver cancer during surgical resection in The Second and The Third Affiliated Hospital of Hebei Medical University (Shijiazhuang, China) between August 2012 and December 2013. Written informed consent was obtained from each patient prior to resection and experiments were approved by the Ethics Committee of Hebei Medical University (Shijiazhuang, China). Patients with metastatic liver cancer were excluded from the current study. Tumor and adjacent (1 cm from tumor) liver tissues were identified according to pathology results. Tissues were fixed in 10% neutral-buffered formalin overnight at 4°C and embedded in paraffin fro 1 h at 60–62°C.

Animals

All animal studies were approved by the Institutional Animal Care and Use Committee of Hebei Medical University (approval no. HebMU20080026; Shijiazhuang, China) and efforts were made to minimize suffering. A total of 16 male Wistar rats (age, 4–5 weeks; weight, 100–120 g) were obtained from the Central Laboratorial Animal Facility at the Faculty of Medicine of Hebei University (Shijiazhuang, China). Rats were housed in cages under controlled environmental conditions at 25°C with 55–65% humidity, a 12-h light/dark cycle and had free access to food and water. Following acclimatization for 1 week, rats were divided into two groups (8/group) as follows: Control group (NC), not receiving DEN, injected with an equal volume of saline; and DEN group (Cancer), receiving a weekly intraperitoneal dose of DEN (70 mg/kg) for 10 weeks. All animals were sacrificed at 20 weeks (17) by exsanguination through cardiac puncture under urethane anesthesia (20%; 1.2 g/kg; intraperitoneally). Livers were isolated and fixed for histopathological analysis.

Histopathological evaluation

Human and rat specimens were processed routinely in 10% formalin buffer overnight at 4°C and embedded in paraffin 1 h at 60–62°C. Tissue sections (4-µm) were obtained and stained with hematoxylin and eosin 2–3 min/each at room temperature. Histopathological examinations were performed under a light microscope (magnification, ×200).

Western blotting

Precut rats livers were placed in Total Protein Isolation Buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP-40, 0.1% SDS, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM Na3VO4 and 1 mM NaF) containing protease inhibitors (leupeptin and aprotinin, 1 µg/ml each), homogenized using an ice-chilled glass homogenizer with Teflon pestle and lysed for 40 min on ice with vortex mixing every 10 min. Supernatants were collected (15,000 × g; 30 min; 4°C), the protein concentration was determined using the Lowry method and samples were aliquoted and stored at −70°C until further analysis.

Cells were lysed in lysis buffer (50 mM PBS pH 7.5, 200 mM NaCl, 0.5 mM EDTA pH 8.0, 2 mM β-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride and 0.5% Tween-20) for protein extraction. Following incubation on ice for 30 min, cell lysates were centrifuged (12,000 × g; 20 min; 4°C), the protein concentration was determined as indicated above and the supernatants were stored at −20°C until use.

A total of 20 or 40 µg protein was used in the analysis of HSD17B4 overexpressing or knockdown samples, respectively. Proteins were separated on 10% SDS-PAGE gels and transferred to polyvinylidene fluoride membranes. Membranes were blocked with 5% skim milk powder for 1 h at room temperature and incubated overnight at 4°C with the following primary antibodies: Mouse anti-HSD17B4 (cat. no. sc-365167; 1:1,000; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), rabbit anti-cyclin D1 (cat. no. 2922S; 1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA), rabbit antiproliferating cell nuclear antigen (PCNA; cat. no. 13110; 1:1,000; Cell Signaling Technology, Inc.), mouse anti-β-actin (cat. no. sc-47778; 1:1,000; Santa Cruz Biotechnology, Inc.), rabbit anti-p-STAT3 (cat. no. sc-135649; 1:500; Santa Cruz Biotechnology, Inc.), rabbit anti-STAT3 (cat. no. sc-482; 1:500; Santa Cruz Biotechnology, Inc.), rabbit anti-p-Akt (cat. no. sc-7985; 1:500; Santa Cruz Biotechnology, Inc.), rabbit anti-Akt (cat. no. sc-8312; 1:500; Santa Cruz Biotechnology, Inc.), rabbit anti-p-MEK (cat. no. sc-101733; 1:500; Santa Cruz Biotechnology, Inc.), rabbit anti-MEK (cat. no. sc-9259; 1:50; Santa Cruz Biotechnology, Inc.), rabbit anti-p-ERK (cat. no. sc-23759; 1:500; Santa Cruz Biotechnology, Inc.), rabbit anti-ERK (cat. no. sc-292838; 1:500; Santa Cruz Biotechnology, Inc.), rabbit anti-p-c-Jun N-terminal kinase (JNK; cat. no. sc-135642; 1:500; Santa Cruz Biotechnology, Inc.), rabbit anti-JNK (cat. no. sc-571; 1:500; Santa Cruz Biotechnology, Inc.), rabbit anti-p-p38 (cat. no. sc-101759; 1:500; Santa Cruz Biotechnology, Inc.), and rabbit anti-p38 (cat. no. sc-156091; 1:500; Santa Cruz Biotechnology, Inc.). Following incubation with goat anti-mouse or anti-rabbit IgG horseradish peroxidase (HRP)-conjugated secondary antibody (cat. nos. 610-703-002 and 611-142-002, respectively; 1:5,000; Rockland Immunochemicals Inc., Limerick, Pennsylvania, USA) for 1 h at room temperature, bands were visualized using an enhanced chemiluminescence kit (Fuazon Fx; Vilber Lourmat, Marne-la-Vallée, France). Images were captured and processed by FusionCapt Advance Fx5 (Vilber Lourmat). The relative gray scale indicated the expression of various genes, with β-actin as the protein loading control.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from rat livers using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. cDNA was synthesized using a SuperScript Reverse Transcription kit (Invitrogen; Thermo Fisher Scientific, Inc.) with the following protocol: 5 min at 65°C, 2 min at 37°C, 10 min at 25°C, 50 min at 37°C and 15 min at 70°C. cDNA was used as a template for qPCR with a SYBR Green PCR Master Mix kit (Takara Biotechnology Co., Ltd., Dalian, China). qPCR was performed using a Rotor-Gene 3000 Detection System (GeneBio Systems, Inc., Oakville, ON, Canada) using the following protocol: Initial denaturation step at 95°C for 30 sec, followed by 40 cycles of denaturation for 5 sec at 95°C, annealing for 30 sec at 55°C and elongation for 20 sec at 72°C. 18S ribosomal RNA was used as internal control and for normalization. All reactions were performed in triplicate. Relative mRNA expression was determined using the 2−ΔΔCq method (18). Primer details are presented in Table I.

Table I.

Polymerase chain reaction primers.

Table I.

Polymerase chain reaction primers.

Primer sequence (5′-3′)

GeneForwardReverse
18S rRNA (M11188) CGCCGCTAGAGGTGAAATTC CCAGTCGGCATCGTTTATGG
HSD17B4 (NM_024392) GGTGGTAAAGAAAGTAAATG AATTGTGATGGTCGTGTC
cyclin D1 (NM_171992.4) GGAGCAGAAGTGCGAAGA GGGTGGGTTGGAAATGAA
PCNA (NM_022381.3) ACAGAGCATGGATTCGTCTCAC AGAAAACTTCACCCCGTCCTTT

[i] HSD17B4, 17β-hydroxysteroid dehydrogenase 4; PCNA, proliferating cell nuclear antigen; r, ribosomal.

Immunohistochemistry (IHC) assays

Immunohistochemistry was performed with paraffin-embedded human or rat tissue sections (4-µm) as previously described (19). Briefly, liver sections were blocked with goat serum (1:1; OriGene Technologies, Inc., Rockville, MD, USA) at 37°C in a wet box for 30 min and incubated with a mouse anti-HSD17B4 antibody (cat. no. PA1727; 1:1,000; Santa Cruz Biotechnology, Inc.) and rabbit anti-STAT3 antibody (cat. no. sc-135649; 1:500; Santa Cruz Biotechnology, Inc.) overnight at 4°C in moist chambers. Following washing with 0.01 mol/l PBS (pH 7.2) three times, slides were incubated with a biotinylated secondary anti-mouse (cat. no. PV-6000; 1:1; OriGene Technologies, Inc.) or anti-rabbit antibodies (cat. no. PV-9000; 1:1; OriGene Technologies, Inc.) for 30 min at 37°C. Samples were then incubated with HRP-avidin D (cat. no. A-2004; Vector Laboratories, Inc.; Maravai LifeSciences, San Diego, CA, USA) at 37°C for 30 min and developed using a diaminobenzidine kit (Vector Laboratories, Inc.; Maravai LifeSciences). Sections were counterstained with hematoxylin for 30 sec at room temperature. Staining intensities were determined by measuring the integrated optical density (IOD) with light microscopy (magnification, ×200) with associated software (SPOT Basic™ image capture software version 3.2.4; cat. no. SPOT53BE; SPOT Imaging; Diagnostic Instruments, Inc., Sterling Heights, MI, USA).

Cell culture and treatment

The human liver cancer cell line HepG2 was obtained from the American Type Culture Collection (cat. no. HB-8065; Manassas, VA, USA). HepG2 cells were maintained in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum (FBS; Abgent Biotech Co., Ltd., Suzhou, China), penicillin and streptomycin (100 U/ml, each) in a humidified environment at 37°C with 5% CO2. For inhibitor studies, all inhibitors were dissolved in dimethyl sulfoxide (DMSO) and control experiments were performed with equal volumes of DMSO. Cells were treated for 2 h with MEK inhibitor PD98059 (5 µmol/; Calbiochem; Merck KGaA, Darmstadt, Germany) or phosphoinositide 3-kinase (PI3K) inhibitor LY294002 (5 µmol/l; Calbiochem; Merck KGaA) prior to transformation with the HSD17B4 overexpression plasmid.

Cell proliferation assay

HepG2 cell proliferation assays were performed using a bromodeoxyuridine (BrdU) Cell Proliferation Assay kit (Millipore; Merck KGaA) according to the manufacturer's instructions. Cells were labeled with BrdU for 6 h at 24 h following HSD17B4 plasmid transfection. Optical density readings were performed at 450 nm to measure the incorporation of BrdU. All groups were evaluated with ≥3 separate wells/experiment.

Plasmid constructs and transfection

HSD17B4 cDNA was cloned into the pLL3.7 vector (Addgene, Inc., Cambridge, MA, USA). HepG2 cells were plated at 5×106/well in 6-well culture dishes for 18 h to reach ~70% confluence in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS without antibiotics. Cells were washed twice with serum-free RPMI-1640 and 1 ml serum-free Opti-MEM I (Gibco; Thermo Fisher Scientific, Inc.) was added to each well. A DNA-Lipofectamine 2000 complex was prepared according to the manufacturer's instructions (Invitrogen; Thermo Fisher Scientific, Inc.). A total of 6 µg transfected plasmid and 30 µl Lipofectamine reagent were added to each reaction. The empty vector control is indicated using ‘−’ and the HSD17B4 plasmid is highlighted using ‘+’ in the following. Cells were incubated at 37°C for 6 h. Following transfection, cells were maintained in DMEM containing 1% FBS for 24 h and the transfection efficiency was determined using western blotting. Cells were collected for further analysis.

Small interfering (si) RNA transfection

siRNA targeting HSD17B4 (siHSD17B4; forward, 5′-GUACCUUUGUAUUUGAGGAdTdT-3′ and reverse, 5′-UCCUCAAAUACAAAGGUACdTdT-3′) and non-specific siRNA (siNC; forwards, 5′-UUCUCCGAACGUGUCACGUTT-3′ and reverse, 5′-ACGUGACACGUUCGGAGAATT-3′), were purchased from Sigma-Aldrich (Merck KGaA). Transfections with 10 µmol/l siRNA (siNC as ‘−’ and siHSD17B4 as ‘+’) were performed using the Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions, when cells reached 50–60% confluence. Following 24 h of transfection, the transfection efficiency was determined using western blotting. Cells were harvested and lysed as described for RT-qPCR and western blotting.

Statistical analysis

Data are presented as the mean ± standard deviation of ≥3 independent experiments. All statistical analyses were performed using SPSS 13.0 (SPSS, Inc., Chicago, IL, USA). Statistical differences between groups were assessed using a one-way analysis of variance, followed by Dunnett's or Bonferroni's multiple comparison tests. Correlation analysis was performed using the Pearson's correlation. P<0.05 was considered to indicate a statistically significant difference.

Results

HSD17B4 expression is increased in tissues from rats with liver cancer

To evaluate HSD17B4 expression during liver cancer development, rats with DEN-induced liver cancer were investigated. All rats in the Cancer group developed liver cancer while the livers of rats in the NC group exhibited a normal lobular architecture with central vein and radiating hepatic cords (Fig. 1A and B). Hepatocytes were polyhedral in shape and the cytoplasm was granulated with small uniform nuclei. The Cancer group exhibited extensive cell swelling and single cell necrosis; necrotic cells were small with basophilic nuclei and dark cytoplasm (Fig. 1B). These results suggested that the rat liver cancer model using DEN was successfully established.

Figure 1.

HSD17B4 expression is increased in rats with liver cancer. (A) Images of livers isolated from rats of the NC or the Cancer group. (B) Hematoxylin and eosin analysis of rat livers of the NC or the Cancer group (magnification, ×200). (C) HSD17B4 expression in rat liver tissues determined by western blotting (n=8/group). (D) HSD17B4 mRNA expression determined by reverse transcription-quantitative polymerase chain reaction. (E) Immunohistochemistry analysis of HSD17B4 expression in rat livers (magnification, ×200). Cancer, rats with diethylnitrosamine-induced liver cancer; NC, negative control; HSD17B4, 17β-hydroxysteroid dehydrogenase 4; IOD, integrated optical density.

HSD17B4 expression in the liver tissues of the rats was determined. HSD17B4 protein and mRNA levels were significantly increased in the Cancer compared with the NC group (P<0.05; Fig. 1C and D). DEN administration resulted in HSD17B4 accumulation in the cytoplasm of liver tissues from rats with liver cancer (Fig. 1E). Compared with the NC, the IOD was significantly increased in the Cancer group (P<0.01; Fig. 1E). The results indicated that HSD17B4 expression was increased during liver cancer development.

HSD17B4 enhances proliferation and expression of proliferation-associated genes

To evaluate an association between HSD17B4 expression and proliferation-associated genes, mRNA levels of cyclin D1 and PCNA were evaluated. It was observed that expression was significantly increased in rats with liver cancer compared with the NC group (P<0.05; Fig. 2A and B). The correlation analysis between HSD17B4 and cyclin D1 or PCNA mRNA expression revealed a positive correlation (P<0.01; Fig. 2C and D).

Figure 2.

HSD17B4 promotes liver cancer proliferation by enhancing expression of proliferation-associated genes. mRNA expression of (A) cyclin D1 and (B) PCNA in liver tissues isolated from rats of the NC or the Cancer group determined by reverse transcription-quantitative polymerase chain reaction. Correlation analyses of HSD17B4 mRNA expression and (C) cyclin D1 or (D) PCNA mRNA expression in liver tissues isolated from rats. Cyclin D1, PCNA and HSD17B4 protein expression in HepG2 cells treated with (E) HSD17B4 overexpression vector or (F) with siHSD17B4 determined by western blotting. (G) Proliferation of HepG2 cells (G) overexpressing HSD17B4 or (H) treated with siHSD17B4 assessed using the BrdU incorporation assays. Cancer, rats with diethylnitrosamine-induced liver cancer; NC, negative control; HSD17B4, 17β-hydroxysteroid dehydrogenase 4; PCNA, proliferating cell nuclear antigen; si, small interfering RNA; Empty, cells transfected with empty pLL3.7 vector.

Protein expression of HSD17B4, cyclin D1 and PCNA was determined in HepG2 HSD17B4 overexpression and knockdown cells. Compared with the empty vector, cyclin D1 and PCNA levels were increased in the HSD17B4 overexpressing cells (Fig. 2E). In the siHSD17B4-treated cells cyclin D1 and PCNA expression was downregulated compared with the siNC (Fig. 2F). The results indicated that HSD17B4 expression affected proliferation-associated genes in HepG2 cells.

To further investigate the role of HSD17B4 in proliferation, BrdU incorporation assays were performed with HSD17B4 overexpression and knockdown HepG2 cells. Proliferation of the HSD17B4 overexpressing cells was significantly increased compared with the empty vector control (P<0.05; Fig. 2G) and BrdU incorporation was significantly decreased in the siHSD17B4-treated cells compared with the siNC (P<0.05; Fig. 2H). The results indicated that HSD17B4 promoted HepG2 proliferation by affecting proliferation-associated genes.

STAT3 activation is increased in liver tissues from rats with liver cancer

STAT3 phosphorylation contributes to liver cancer progression (5–7). STAT3 phosphorylation was significantly increased in the Cancer compared with the NC group (P<0.05; Fig. 3A). As STAT3 is involved in various signaling pathways (20,21), proteins associated with the Akt and the MEK/ERK signaling pathways were investigated. Western blot analysis revealed that levels of p-Akt, p-ERK and p-MEK were significantly increased in tissues from the Cancer compared with the NC group (P<0.05; Fig. 3B).

Figure 3.

STAT3 activation is increased in liver tissues from rats with liver cancer. (A) STAT3 expression and phosphorylation in liver tissues isolated from rats of the NC or the Cancer group determined (n=8/group). (B) Expression and activation of the Akt, MEK and ERK determined by western blotting. Cancer, rats with diethylnitrosamine-induced liver cancer; NC, negative control; HSD17B4, 17β-hydroxysteroid dehydrogenase 4; Akt, protein kinase B; MEK, mitogen-activated protein kinase; ERK, extracellular-signal-regulated kinase.

HSD17B4 overexpression increases STAT3 activation

A recent study revealed that HSD17B4 is upregulated in patients with liver cancer and HSD17B4 over-expression promotes HepG2 proliferation (16). To determine whether HSD17B4 serves a role in liver cancer progression, HSD17B4 expression in adjacent and tumor tissues from patients with liver cancer were evaluated. IHC images revealed that HSD17B4 expression was increased in tumor tissues compared with adjacent normal tissues obtained from patients with liver cancer and the determined IOD was significantly increased in the cancerous tissues (P<0.01; Fig. 4A).

Figure 4.

HSD17B4 expression induces STAT3 activation. (A) IHC staining targeting HSD17B4 in liver tumor and adjacent normal tissues from patients with liver cancer (n=16; magnification, ×200). (B) STAT3 activation in HepG2 cells treated with HSD17B4 overexpression vector or treated with siHSD17B4 determined by western blotting (n=3/group). (C) IHC analysis of HSD17B4 and p-STAT3 levels in liver tumor and adjacent normal tissues from patients with liver cancer (n=16; magnification, ×200) and Pearson's correlation analysis of IODs. HSD17B4, 17β-hydroxysteroid dehydrogenase 4; IOD, integrated optical density; si, small interfering RNA; p, phosphorylated; STAT3, signal transducer and activator of transcription 3; NC, negative control; -, transfected empty vector or siNC; +, transfected HSD17B4 vector or siHSD17B4.

An association between HSD17B4 expression and activation of STAT3 was evaluated in HSD17B4 overexpression and knockdown HepG2 cells. As presented in Fig. 4B, HSD17B4 overexpression significantly increased STAT3 phosphorylation in HepG2 cells compared with the empty vector group (P<0.05). In contrast, p-STAT3 levels were significantly decreased in the siHSD17B4-treated cells compared to the siNC group (P<0.05; Fig. 4B).

To verify these finding, HSD17B4 and p-STAT3 expression in tumor and adjacent normal tissues of patients liver cancer were evaluated using IHC. IODs determined for HSD17B4 and p-STAT3 suggested a positive correlation between the HSD17B4 expression and STAT3 activation (P<0.01; Fig. 4C). The results suggested that HSD17B4 expression induced STAT3 activation.

HSD17B4 expression induces Akt and MEK/ERK activation

To determine the mechanism by which HSD17B4 promotes STAT3 activation in liver cancer, activation of various signaling pathways involved in liver cancer progression were assessed. HSD17B4 overexpression increased the phosphorylation of Akt, MEK and ERK in HepG2 cells compared with the empty vector group (P<0.05; Fig. 5A). In siHSD17B4-treated cells, Akt, MEK and ERK phosphorylation was significantly decreased compared with the siNC group (P<0.05; Fig. 5A). Activation of JNK and p38 were not affected by the induction or knockout of HSD17B4 expression (P>0.05; Fig. 5A). The results suggested that activation of the Akt and the MEK/ERK signaling pathways was associated with HSD17B expression.

Figure 5.

HSD17B4 expression is associated the Akt and the MEK/ERK signaling pathways. (A) Expression and activation of the Akt, MEK, ERK, JNK and p38 in HepG2 cells treated with HSD17B4 overexpression vector or treated with siHSD17B4 determined by western blotting (n=3/group). (B) HSD17B4 overexpressing HepG2 cells were pretreated with LY294002 and PD98059 inhibitors and HSD17B4 expression and STAT3 activation were assessed by western blotting (n=3/group). HSD17B4, 17β-hydroxysteroid dehydrogenase 4; si, small interfering RNA; p, phosphorylated; STAT3, signal transducer and activator of transcription 3; Akt, protein kinase B; MEK, mitogen-activated protein kinase; ERK, extracellular-signal-regulated kinase; JNK, c-Jun N-terminal kinase; LY294002, phosphoinositide 3-kinase inhibitor; PD98059, MEK inhibitor; NC, negative control; -, transfected empty vector or siNC; +, transfected HSD17B4 vector or siHSD17B4.

To investigate which signaling pathways are involved in STAT3 activation, HepG2 cells were incubated with PD98059 and LY294002, inhibitors of the MEK/ERK and the PI3K/Akt signaling pathway, respectively, prior to transfection with the HSD17B4 overexpression plasmid (22). STAT3 phosphorylation was determined and it was observed that levels significantly decreased in HSD17B4 overexpressing cells in the presence of MEK/ERK and PI3K/Akt signaling pathway inhibitors compared with the DMSO treated cells and a significant decrease was further observed for empty vector-transfected cells in the presence of inhibitors compared with the DMSO-treated cells (P<0.05; Fig. 5B). The results suggested HSD17B4 expression promoted STAT3 activation via the PI3K/Akt and the MEK/ERK signaling pathways.

Discussion

As an important oxidoreductase, HSD17B4 is widely distributed in peroxisomes of mammalian cells (11–13). HSD17B4 is ubiquitous and increased levels were detected in mammalian liver, heart, brain and prostate tissues under normal physiological conditions (12,13). Initial research focused on HSD17B4 function associated with the inactivation of the estrogen metabolism (23,24). It was further discovered that HSD17B4 is an important enzyme in the fatty acid β-oxidation pathway in peroxisomes; it is involved in the oxidative decomposition of very long-chain fatty acids and branched-chain fatty acids and in the biosynthesis of docosahexaenoic acid (25). An increase of HSD17B4 was observed in a variety of tumor cells and tissue suggesting that HSD17B4 may serve a role in tumor development (26–28).

In a previous study, it was demonstrated that HSD17B4 expressed is increased in patients with liver cancer (16). In the current study, it was observed that HSD17B4 expression was upregulated rats with liver cancer compared with healthy control animals. It was revealed that HSD17B4 overexpression and knockdown in HepG2 increased and decreased expression of proliferation-associated genes, respectively. The current study further revealed a positive correlation between HSD17B4 and cyclin D1 and PCNA mRNA expression in rats with liver cancer. The results suggested that HSD17B4 may promote liver cancer proliferation and may serve a crucial role in liver cancer development.

STAT3 is a nuclear transcription factor that binds to specific sequences of target gene promoters (29,30) and induces cancer cell proliferation by upregulating the expression of various genes (4,31). STAT3 promotes liver tumor formation by mediating multiple cellular processes and enhancing the development of liver cancer (32,33). With accumulating research, STAT3 has become an attractive target for the treatment and prevention of human liver cancer (34,35). The current study suggested that HSD17B4 upregulation mediated STAT3 activation and a correlation was determined between these factors in tumor and adjacent normal tissues from patients with liver cancer.

STAT3 is active in liver tumor cells and is involved in various signaling pathways (20,21). STAT3 phosphorylation is involved the MEK and mitogen-activated protein kinase kinase 4 signaling cascade and is induced independently of ERK-1 or JNK-1 activity by interleukin-6 (36). Sorafenib inhibits liver cancer growth by blocking the MEK/ERK/STAT3 and the PI3K/Akt/STAT3 signaling pathways, independent of Janus kinase 2 and tyrosine-protein phosphatase non-receptor type 11 activation (37). Various studies have confirmed that the MEK/ERK/STAT3 and the PI3K/Akt/STAT3 signaling pathways serve important roles in promoting liver cancer cell proliferation (37,38). Experiments using HepG2 revealed that HSD17B4 induced STAT3 phosphorylation through the MEK/ERK and the PI3K/Akt signaling pathways without affecting the JNK and the p38 signaling pathways. The specific mechanism by which HSD17B4 affects the signal pathways requires further investigation.

In conclusion, the data collected in the current study indicated that HSD17B4 may be a novel proliferation-promoting protein and the following mechanism is proposed: HSD17B4 overexpression promotes activation of STAT3 via the PI3K/Akt and the MEK/ERK signaling pathways, which stimulate STAT3 binding to the response element. In turn, cell proliferation is promoted via cyclin D1 and PCNA upregulation (Fig. 6). The presented results may describe an experimental basis for novel approaches in the prevention and treatment of liver cancer using HSD17B4.

Figure 6.

Proposed mechanism for the involvement of HSD17B4, STAT3 and proliferation-associated genes in liver cancer. HSD17B4, 17β-hydroxysteroid dehydrogenase 4; p, phosphorylated; STAT3, signal transducer and activator of transcription 3; Akt, protein kinase B; MEK, mitogen-activated protein kinase; ERK, extracellular-signal-regulated kinase; PCNA, proliferating cell nuclear antigen.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

XL and PM performed the majority of the experiments, collected the clinical samples and acquired patients' information. LK, XW and WL made substantial contributions to acquisition, analysis and interpretation of data. LJ conceived, designed the study and revised the manuscript. All authors read and approved the final version of the manuscript.

Ethical approval and consent to participate

Experiments involving human samples and animal experiments were approved by the Ethics Committee of Hebei Medical University (Shijiazhuang, China). All experiments were conducted according to relevant national and international guidelines. Written informed consent was obtained from all participants included in the study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Shukla SK, Singh G, Shahi KS, Bhuvan and Pant P: Staging, treatment, and future approaches of gallbladder carcinoma. J Gastrointest Cancer. 49:9–15. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Cervello M, Augello G, Cusimano A, Emma MR, Balasus D, Azzolina A, McCubrey JA and Montalto G: Pivotal roles of glycogen synthase-3 in hepatocellular carcinoma. Adv Biol Regul. 65:59–76. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Kang KJ and Ahn KS: Anatomical resection of hepatocellular carcinoma: A critical review of the procedure and its benefits on survival. World J Gastroenterol. 23:1139–1146. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Aggarwal BB, Kunnumakkara AB, Harikumar KB, Gupta SR, Tharakan ST, Koca C, Dey S and Sung B: Signal transducer and activator of transcription-3, inflammation, and cancer: how intimate is the relationship? Ann NY Acad Sci 1171. 59–76. 2009. View Article : Google Scholar

5 

Calvisi DF, Ladu S, Gorden A, Farina M, Conner EA, Lee JS, Factor VM and Thorgeirsson SS: Ubiquitous activation of Ras and Jak/Stat pathways in human HCC. Gastroenterology. 130:1117–1128. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Barre B, Avril S and Coqueret O: Opposite regulation of myc and p21waf1 transcription by STAT3 proteins. J Biol Chem. 278:2990–2996. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Wang HY, Cheng Z and Malbon CC: Overexpression of mitogen-activated protein kinase phosphatases MKP1, MKP2 in human breast cancer. Cancer Lett. 191:229–237. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Johnson FM, Saigal B, Tran H and Donato NJ: Abrogation of signal transducer and activator of transcription 3 reactivation after Src kinase inhibition results in synergistic antitumor effects. Clin Cancer Res. 13:4233–4244. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Oh SB, Hwang CJ, Song SY, Jung YY, Yun HM, Sok CH, Sung HC, Yi JM, Park DH, Ham YW, et al: Anti-cancer effect of tectochrysin in NSCLC cells through overexpression of death receptor and inactivation of STAT3. Cancer Lett. 353:95–103. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Carie AE and Sebti SM: A chemical biology approach identifies a beta-2 adrenergic receptor agonist that causes human tumor regression by blocking the Raf-1/Mek-1/Erk1/2 pathway. Oncogene. 26:3777–3788. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Moeller G and Adamski J: Multifunctionality of human 17beta-hydroxysteroid dehydrogenases. Mol Cell Endocrinol. 248:47–55. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Peltoketo H, Luu-The V, Simard J and Adamski J: 17beta-hydroxysteroid dehydrogenase (HSD)/17-ketosteroid reductase (KSR) family; nomenclature and main characteristics of the 17HSD/KSR enzymes. J Mol Endocrinol. 23:1–11. 1999. View Article : Google Scholar : PubMed/NCBI

13 

Markus M, Husen B, Leenders F, Jungblut PW, Hall PF and Adamski J: The organelles containing porcine 17 beta-estradiol dehydrogenase are peroxisomes. Eur J Cell Biol. 68:263–267. 1995.PubMed/NCBI

14 

Rasiah KK, Gardiner-Garden M, Padilla EJ, Möller G, Kench JG, Alles MC, Eggleton SA, Stricker PD, Adamski J and Sutherland RL: HSD17B4 overexpression, an independent biomarker of poor patient outcome in prostate cancer. Mol Cell Endocrinol. 301:89–96. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Maleki J, Nourbakhsh M, Shabani M, Korani M, Nourazarian SM, Ostadali DM and Moghadasi MH: 17β-estradiol stimulates generation of reactive species oxygen and nitric oxide in ovarian adenocarcinoma cells (OVCAR 3). Iran J Cancer Prev. 8:e23322015. View Article : Google Scholar : PubMed/NCBI

16 

Lu X, Ma P, Shi Y, Yao M, Hou L, Zhang P and Jiang L: NF-κB increased expression of 17beta-hydroxysteroid dehydrogenase 4 promotes HepG2 proliferation via inactivating estradiol. Mol Cell Endocrinol. 401:1–11. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Kim NH, Heo JD, Kim TB, Rho JR, Yang MH and Jeong EJ: Protective effects of ethyl acetate soluble fraction of Limonium tetragonum on diethylnitrosamine-induced liver fibrosis in rats. Biol Pharm Bull. 39:1022–1028. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Bookout AL and Mangelsdorf DJ: Quantitative real-time PCR protocol for analysis of nuclear receptor signaling pathways. Nucl Recept Signal. 1:e0122003. View Article : Google Scholar : PubMed/NCBI

19 

Fishbein MC, Wang T, Matijasevic M, Hong L and Apple FS: Myocardial tissue troponins T and I. An immunohistochemical study in experimental models of myocardial ischemia. Cardiovasc Pathol. 12:65–71. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Song H, Wang R, Wang S and Lin J: A low-molecular-weight compound discovered through virtual database screening inhibits Stat3 function in breast cancer cells. Proc Natl Acad Sci USA. 102:4700–4705. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Jia H, Li Y, Zhao T, Li X, Hu J, Yin D, Guo B, Kopecko DJ, Zhao X, Zhang L, et al: Antitumor effects of Stat3-siRNA and endostatin combined therapies, delivered by attenuated Salmonella, on orthotopically implanted hepatocarcinoma. Cancer Immunol Immunother. 61:1977–1987. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Fang L, Li G, Liu G, Lee SW and Aaronson SA: p53 induction of heparin-binding EGF-like growth factor counteracts p53 growth suppression through activation of MAPK and PI3K/Akt signaling cascades. EMBO J. 20:1931–1939. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Breitling R, Marijanovic Z, Perovic D and Adamski J: Evolution of 17beta-HSD type 4, a multifunctional protein of beta-oxidation. Mol Cell Endocrinol. 171:205–210. 2001. View Article : Google Scholar : PubMed/NCBI

24 

de Launoit Y and Adamski J: Unique multifunctional HSD17B4 gene product: 17beta-hydroxysteroid dehydrogenase 4 and D-3-hydroxyacyl-coenzyme A dehydrogenase/hydratase involved in Zellweger syndrome. J Mol Endocrinol. 22:227–240. 1999. View Article : Google Scholar : PubMed/NCBI

25 

Veldhoven PP, Casteels M, Mannaerts GP and Baes M: Further insights into peroxisomal lipid breakdown via alpha- and beta-oxidation. Biochem Soc Trans. 29:292–298. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Romanuik TL, Wang G, Morozova O, Delaney A, Marra MA and Sadar MD: LNCaP Atlas: Gene expression associated with in vivo progression to castrationrecurrent prostate cancer. BMC Med. Genomics. 3:432010.

27 

True L, Coleman I, Hawley S, Huang CY, Gifford D, Coleman R, Beer TM, Gelmann E, Datta M, Mostaghel E, et al: A molecular correlate to the Gleason grading system for prostate adenocarcinoma. Proc Natl Acad Sci USA. 103:10991–10996. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Zha S, Ferdinandusse S, Hicks JL, Denis S, Dunn TA, Wanders RJ, Luo J, De Marzo AM and Isaacs WB: 2005. Peroxisomal branched chain fatty acid beta-oxidation pathway is upregulated in prostate cancer. Prostate. 63:316–323. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Ihle JN: STATs: Signal transducers and activators of transcription. Cell. 84:331–334. 1996. View Article : Google Scholar : PubMed/NCBI

30 

Costantino L and Barlocco D: STAT 3 as a target for cancer drug discovery. Curr Med Chem. 15:834–843. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Aggarwal BB, Sethi G, Ahn KS, Sandur SK, Pandey MK, Kunnumakkara AB, Sung B and Ichikawa H: Targeting signal- transducer-and-activator-of-transcription-3 for prevention and therapy of cancer: Modern target but ancient solution. Ann NY Acad Sci 1091. 151–169. 2006. View Article : Google Scholar

32 

Subramaniam A, Shanmugam MK, Perumal E, Li F, Nachiyappan A, Dai X, Swamy SN, Ahn KS, Kumar AP, Tan BK, Perumal E, Chen L, Vali S, Abbasi T, Kapoor S, Ahn KS, Kumar AP, et al: Potential role of signal transducer and activator of transcription (STAT)3 signaling pathway in inflammation, survival, proliferation and invasion of hepatocellular carcinoma. Biochim Biophys Acta 1835. 46–60. 2013.

33 

Subramaniam A, Shanmugam MK, Ong TH, Li F, Perumal E, Chen L, Vali S, Abbasi T, Kapoor S, Ahn KS, et al: Emodin inhibits growth and induces apoptosis in an orthotopic hepatocellular carcinoma model by blocking activation of STAT3. Br J Pharmacol. 170:807–821. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Schindler C and Darnell JE Jr: Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu Rev Biochem. 64:621–651. 1995. View Article : Google Scholar : PubMed/NCBI

35 

Chiarle R, Simmons WJ, Cai H, Dhall G, Zamo A, Raz R, Karras JG, Levy DE and Inghirami G: Stat3 is required for ALK-mediated lymphomagenesis and provides a possible therapeutic target. Nat Med. 11:623–629. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Schuringa JJ, Jonk LJ, Dokter WH, Vellenga E and Kruijer W: Interleukin-6-induced STAT3 transactivation and Ser727 phosphorylation involves Vav, Rac-1 and the kinase SEK-1/MKK-4 as signal transduction components. Biochem J 347 Pt. 1:89–96. 2000. View Article : Google Scholar

37 

Gu FM, Li QL, Gao Q, Jiang JH, Huang XY, Pan JF, Fan J and Zhou J: Sorafenib inhibits growth and metastasis of hepatocellular carcinoma by blocking STAT3. World J Gastroenterol. 17:3922–3932. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Chiablaem K, Lirdprapamongkol K, Keeratichamroen S, Surarit R and Svasti J: Curcumin suppresses vasculogenic mimicry capacity of hepatocellular carcinoma cells through STAT3 and PI3K/AKT inhibition. Anticancer Res. 34:1857–1864. 2014.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lu X, Kong L, Wang X, Liu W, Ma P and Jiang L: 17β‑hydroxysteroid dehydrogenase 4 induces liver cancer proliferation‑associated genes via STAT3 activation. Oncol Rep 41: 2009-2019, 2019.
APA
Lu, X., Kong, L., Wang, X., Liu, W., Ma, P., & Jiang, L. (2019). 17β‑hydroxysteroid dehydrogenase 4 induces liver cancer proliferation‑associated genes via STAT3 activation. Oncology Reports, 41, 2009-2019. https://doi.org/10.3892/or.2019.6981
MLA
Lu, X., Kong, L., Wang, X., Liu, W., Ma, P., Jiang, L."17β‑hydroxysteroid dehydrogenase 4 induces liver cancer proliferation‑associated genes via STAT3 activation". Oncology Reports 41.3 (2019): 2009-2019.
Chicago
Lu, X., Kong, L., Wang, X., Liu, W., Ma, P., Jiang, L."17β‑hydroxysteroid dehydrogenase 4 induces liver cancer proliferation‑associated genes via STAT3 activation". Oncology Reports 41, no. 3 (2019): 2009-2019. https://doi.org/10.3892/or.2019.6981
Copy and paste a formatted citation
x
Spandidos Publications style
Lu X, Kong L, Wang X, Liu W, Ma P and Jiang L: 17β‑hydroxysteroid dehydrogenase 4 induces liver cancer proliferation‑associated genes via STAT3 activation. Oncol Rep 41: 2009-2019, 2019.
APA
Lu, X., Kong, L., Wang, X., Liu, W., Ma, P., & Jiang, L. (2019). 17β‑hydroxysteroid dehydrogenase 4 induces liver cancer proliferation‑associated genes via STAT3 activation. Oncology Reports, 41, 2009-2019. https://doi.org/10.3892/or.2019.6981
MLA
Lu, X., Kong, L., Wang, X., Liu, W., Ma, P., Jiang, L."17β‑hydroxysteroid dehydrogenase 4 induces liver cancer proliferation‑associated genes via STAT3 activation". Oncology Reports 41.3 (2019): 2009-2019.
Chicago
Lu, X., Kong, L., Wang, X., Liu, W., Ma, P., Jiang, L."17β‑hydroxysteroid dehydrogenase 4 induces liver cancer proliferation‑associated genes via STAT3 activation". Oncology Reports 41, no. 3 (2019): 2009-2019. https://doi.org/10.3892/or.2019.6981
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team