Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
July-August 2014 Volume 2 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-August 2014 Volume 2 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Screening for 392 polymorphisms in 141 pharmacogenes

  • Authors:
    • Jason Yongha Kim
    • Hyun Sub Cheong
    • Tae‑Joon Park
    • Hee Jung Shin
    • Doo Won Seo
    • Han Sung Na
    • Myeon Woo Chung
    • Hyoung Doo Shin
  • View Affiliations / Copyright

    Affiliations: Department of Life Science, Sogang University, Seoul 121‑742, Republic of Korea, Department of Genetic Epidemiology, SNP Genetics, Inc., Seoul 121‑742, Republic of Korea, Division of Clinical Reaserch, Department of Toxicological Evaluation and Research, National Institute of Food and Drug Safety Evaluation, Osong Health Technology Administration Complex, Osong, Chungcheongbuk 363‑700, Republic of Korea
  • Pages: 463-476
    |
    Published online on: April 30, 2014
       https://doi.org/10.3892/br.2014.272
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Pharmacogenomics is the study of the association between inter‑individual genetic differences and drug responses. Researches in pharmacogenomics have been performed in compliance with the use of several genotyping technologies. In this study, a total of 392 single‑nucleotide polymorphisms (SNPs) located in 141 pharmacogenes, including 21 phase I, 13 phase II, 18 transporter and 5 modifier genes, were selected and genotyped in 150 subjects using the GoldenGate assay or the SNaPshot technique. These variants were in Hardy‑Weinberg equilibrium (HWE) (P>0.05), except for 22 SNPs. Genotyping of the 392 SNPs revealed that the minor allele frequencies of 47 SNPs were <0.05, 105 SNPs were monomorphic and 22 variants were not in HWE. Also, based on previous studies, we predicted the association between the polymorphisms of certain pharmacogenes, such as cytochrome P450 2D6, cytochrome P450 2C9, vitamin K epoxide reductase complex, subunit 1, cytochrome P450 2C19, human leukocyte antigen, class I, B and thiopurine S‑methyltransferase, and drug efficacy. In conclusion, our study demonstrated the allele distribution of SNPs in 141 pharmacogenes as determined by high‑throughput screening. Our results may be helpful in developing personalized medicines by using pharmacogene polymorphisms.

Introduction

Inter-individual variation in drug response among patients is a major obstacle in medicine application, due to the different response of each patient to the same medication (1). Several cases of adverse drug reactions occurring in certain patients, such as renal/hepatic disorders, congestive heart failure and anemia, were previously reported (1,2). The variations in drug responses may result from disease determinants, genetics, environmental factors and idiosyncratic response, which collectively affect drug metabolism (3). The knowledge of variations in efficacy and toxicity caused by the same doses of medications may enhance the effectiveness of drug therapy (3).

The initial human genome sequencing identified ~1.42 million single-nucleotide polymorphisms (SNPs), including >60,000 SNPs in the exonic region of genes (4). Some of these SNPs have been suggested to be associated with considerable changes in drug disposition and metabolism or the effects of medication (5–7), whereas others are used for the diagnosis of clinical response (8). The interaction of several gene products is known to affect the pharmacokinetics and pharmacodynamics of medications. For example, inherited variations in drug targets, drug disposition and polygenic factors of drug effects are determinants of the majority of drug effects and have become increasingly important in pharmacogenomics (9).

Pharmacogenomics is the study of how genetic differences among individuals affect the variability in their response to medications (6,10). Pharmacogenomic research includes clinical and basic science regarding genetic variation and drug response. The field of pharmacogenomics has attracted significant attention along with the completion of the Human Genome Project (11). Consequently, there has been an increase in the number of pharmacogenomic studies published (11). Furthermore, the continuous development of genotyping technologies may allow pharmacogenomic applications to move into the mainstream of medicine and pharmacy practice (12,13).

Over the last few years, the available technologies for genomic analyses have increased significantly (14). For example, the TaqMan and the SNPlex assays from Applied Biosystems (Foster City, CA, USA), the GeneChip assay from Affymetrix (Santa Clara, CA, USA) and the Infinium and GoldenGate assays developed by Illumina (San Diego, CA, USA) are the most frequently used techniques in genome research (15). In addition, the SNaPshot technique has been tested on a small scale of multiplex for analysis of gene polymorphisms (16). In this study, we used the GoldenGate assay and the SNaPshot technique for genotyping to investigate the allele distribution of 392 SNPs from 141 pharmacogenes in 150 Korean subjects.

Materials and methods

Study subjects

DNA samples from a total of 150 Korean subjects was used for this study. The 150 unrelated Korean samples were provided by the Center for Genome Science, Korea Centers for Disease Control and Prevention. The protocol and consent forms of this study were reviewed and approved by the Institutional Review Board of Sogang University (no. 2010_690).

SNP selection and genotyping

We selected a total of 378 SNPs of 141 well-known pharmacogenes, based on the score assigned by the Illumina GoldenGate assay design tool (ADT; Illumina). The SNPs were genotyped using the GoldenGate assay with the VeraCode microbead (Illumina) (17,18), followed by a scan using the BeadExpress® system (Illumina). Normalized bead intensity data obtained for each sample were loaded into the GenomeStudio® software (Illumina), which converted fluorescent intensities into SNP genotypes. SNP clusters for genotype calling were examined for all SNPs using the GenomeStudio® software. The cluster plots were then visually assessed and SNPs with poor cluster quality were removed. The overall call rate for all SNPs was 99.99%. For quality control, SNPs that met the following criteria were retained: call rate ≥0.98% and no triplicate error after three repetition tests. Fourteen additional SNPs which did not pass ADT scoring were genotyped using the SNaPshot technique (Invitrogen Life Technologies, Carlsbad, CA, USA). The SNaPshot technique is single- extension-based method, which enables the simultaneous analysis of multiple SNPs (19). The information of SNaPshot primers used for the 14 SNPs are shown in Table I. The GoldenGate and SNaPshot assays were conducted three times in order to increase the accuracy of the test.

Table I

SNaPshot primer sequences for 14 single-nucleotide polymorphisms (SNPs).

Table I

SNaPshot primer sequences for 14 single-nucleotide polymorphisms (SNPs).

GeneSNPPrimerSequence
CYP2D6Forward GTTATCCCAGAAGGCTTTGCAGGCTTCA
Reverse GCCGACTGAGCCCTGGGAGGTAGGTA
rs1065852aSNaPshot AACGCTGGGCTGCACGCTAC
rs16947aSNaPshot TCAGAGAACAGGTACCACCACTATGC
rs1135822aSNaPshot T(11)CGGGCCCATAGCGCGCCAGGA
rs35742686aSNaPshot T(10)CCAGCTGGATGAGCTGCTAACTGAGCAC
rs3892097aSNaPshot T(20)CCTTACCCGCATCTCCCACCCCCA
rs5030655aSNaPshot T(24)GCCTGGGCAAGAAGTCGCTGGAGCAG
rs79738337aSNaPshot T(31)GGCAAGGAGAGAGGGTGGAGGCTGG
rs1058164aSNaPshot T(41)CGAGCAGAGGCGCTTCTCCGT
DPYD rs72981743Forward CGAAAACAGGCAGACTAGGG
Reverse AGAGCGGGTGCTCTACTCC
SNaPshot TCTGCTTGCAGGCTGGGGCGC
CYP2A6 rs56256500Forward AGTTGGCAGGTTGTGGTAGG
Reverse CTCCAATGTCATCAGCTCCA
SNaPshot GAACTGGAAGATTCCTAGCATCATGC
NR1I2 rs1464603Forward CACCAGCCCACACTCTGAAC
Reverse CAAATCTGCCGTGTATGTGG
SNaPshot CTGGGGGACAGGTCAAGCTGAGGCCCTGAGA
CYP2A6 rs1809810Forward TCCAGCCCCTGTGTACTTTC
Reverse AAACTGCCCCTTCTCATTCA
SNaPshot T(7)CAACTTCCTCCTCCCTACCAGGGCACCGAAGTGT
ABCB1 rs2032582Forward TTGAAATGAAAATGTTGTCTGGA
Reverse AAAAGATTGCTTTGAGGAATGG
SNaPshot T(13)CAAGCACTGAAAGATAAGAAAGAACTAGAAGGT
CYP2C19 rs3758580Forward TTCATGTACCCCTGAATTGCT
Reverse CATCTGTGTAGGGCATGTGG
SNaPshot T(24)GCATGCAGGGGCTCCGGTTTCTGCCAAC

a The CYP2D6 SNPs share the same forward and reverse primers.

Statistical analysis

The Chi-square test was used to determine whether individual variants were in Hardy-Weinberg equilibrium (HWE) at each locus in a Korean population. Haplotypes of SNPs representing the star-alleles of each pharmacogene investigated in this study were defined using PHASE software (Stephen Laboratory, University of Chicago, Chicago, IL, USA).

Results and Discussion

A total of 392 SNPs located in 141 pharmacogenes (including 21 phase I, 13 phase II, 18 transporter and 5 modifier genes) were successfully genotyped in 150 Korean subjects and their minor allele frequencies (MAFs) were calculated (Table II). These variants were in HWE (P>0.05), except for 22 SNPs. Among the SNPs, 47 variants exhibited a MAF<0.05, while 105 variants exhibited a monomorphic allele distribution in the Korean population (Table III). In addition, there were 22 SNPs with HWE<0.05, 9 of which exhibited significantly lower HWE compared to others [rs2230037, rs2472393, rs743544 [all in the glucose-6-phosphate dehydrogenase (G6PD) gene], rs2227291 [copper-transporting ATPase 1 (ATP7A) gene], rs1414334, rs518147, rs3813928, rs6318 and rs3813929 [all in the 5-hydroxytryptamine receptor 2C (HTR2C) gene]. The 3 genes were all located in the X chromosome, although located far away from each other (G6PD at Xq28, ATP7A at Xq21.1 and HTR2C at Xq24). The classifications and SNP numbers of each pharmacogene investigated in this study are listed in Table IV. Among these, cytochrome P450 2D6 (CYP2D6), cytochrome P450 2C19 (CYP2C19), thiopurine S-methyltransferase (TPMT), cytochrome P450 2C9 (CYP2C9), vitamin K epoxide reductase complex, subunit 1 (VKORC1) and human leukocyte antigen, class I, B (HLA-B) are of great significance, due to their association with well-known drugs. Therefore, we investigated the respective genes and their effects on enzyme activity or associated drugs below.

Table II

Minor allele frequency of 287 polymorphic single-nucleotide polymorphisms (SNPs) from 141 pharmacogenes in a Korean population (n=150).

Table II

Minor allele frequency of 287 polymorphic single-nucleotide polymorphisms (SNPs) from 141 pharmacogenes in a Korean population (n=150).

GeneSNPAlternative nameAllelesMAFHWE
CYP2D6 rs1065852*10, *36, *49, 100C>TC>T0.1630.551
rs16947*2, 2850C>TC>T0.1400.472
rs3892097*4, 1846G>AG>A0.0730.152
rs79738337*60, 2303C>TC>T0.0070.934
rs1058164*2, *4, *8, *10, 1661G>CG>C0.2170.645
rs1135840*2A, 4180G>CC>G0.4000.496
rs28371525*41, 2988G>AG>A0.0030.967
rs5030865*8, 1758G>TG>T0.0030.967
CYP2C9 rs1057910*3, 42614A>CA>C0.0430.579
rs9332092-T>C0.0430.579
rs9332096-C>T0.0730.816
rs9332098-G>A0.0430.579
rs4918758*1C, C1188TT>C0.4430.624
VKORC1 rs9934438C6484T, 1173C>TA>G0.0870.368
rs8050894*2, 1542G>C, 6853G>CG>C0.0830.964
rs2359612*2, 2255C>T, 7566C>TA>G0.0830.964
rs72943730G>AG>A0.0800.965
rs17708472*4, 6009C>T, 698C>TG>A0.0030.967
CYP2C19 rs12248560*17, −806C>TC>T0.0670.662
rs4244285*2, G681AG>A0.3130.011
rs4986893*3, G636AG>A0.0770.891
rs28399504*4, A1GA>G0.0030.967
rs17885098*2, *4, 99C>TC>T0.0370.641
rs3758580*2, 80160C>TC>T0.2400.872
rs11568732−888T/GT>G0.1330.814
rs4986894−97T/CT>C0.3130.011
rs17886522G417GA>C0.0770.891
rs17878649IVS1-47G/AG>A0.0770.891
rs4417205IVS5-51C/GC>G0.3130.011
rs4917623IVS7-106T/CC>T0.4600.567
rs11188072*17, −3402C>TC>T0.0130.869
DPYD rs1801159*5, I543V, A1627GA>G0.2770.311
rs1801265*9A, C29R, T85CT>C0.0530.490
rs2297595496A>G, Met166ValT>C0.0100.902
rs72981743−243G/AG>A0.0170.836
rs10424823651G/AG>A0.0900.434
rs2915933858T/CT>C0.3530.417
rs56279424-G>T0.1730.779
G6PD rs22300371311C>TC>T0.080 4.69×10−19
rs2472393IVS1+2955A/GC>T0.130 8.31×10−12
rs743544IVS1−773C/TC>T0.407 7.44×10−10
HLA-B*1502 rs3909184 HLA-B*1502C>G0.0530.354
rs2844682 HLA-B*1502C>T0.1570.674
NAT1 rs4986988*11, c.−344C>TC>T0.0070.934
rs4986989*11, c.−40A>TA>T0.0070.934
rs4986783*11, c.640T>G, p.S214AT>G0.0070.934
NAT2 rs1799929*11, *5BC>T0.0330.673
rs1041983*13, *5G, *6AC>T0.3130.011
rs1799930*5E, *6AG>A0.1730.153
rs1799931*7, G286E, *6IG>A0.1400.524
rs4646241-T>C0.1730.779
rs4646242-A>G0.1670.203
rs4646243-T>C0.3600.008
rs4646246-A>G0.2800.923
TPMT rs1800460*3BG>A0.0030.967
rs1142345*3C, C240Y, 18485A>GA>G0.0130.869
rs75543815*6, 15327A>TA>T0.0230.770
rs12201199-A>T0.0130.869
UGT1A1 rs4124874*60, −3263T>GA>C0.3000.560
rs887829*28G>A0.1270.764
rs4148323*6, Gly71ArgG>A0.1730.153
rs34993780*7T>G0.0070.934
rs10929302*93, −3156G>AG>A0.1270.764
rs3755319-A>C0.1370.579
rs2003569-G>A0.1270.764
CYP2E1 rs2031920*5, −1053C>TC>T0.1270.299
rs6413432*6, 7632T>AT>A0.0700.357
rs3813867*5A, *5BG>C0.2070.484
rs2070673*7, −333T>AT>A0.4200.410
rs2070875-G>T0.2900.879
rs2515641-C>T0.1730.779
CYP3A4 rs28371759*18, L293P (T>C)T>C0.0300.015
CYP3A5 rs776746*3, 6986A>GG>A0.2230.475
rs55965422*5, 12952T>CA>G0.0070.934
CYP4B1 rs4646487Arg173TrpC>T0.1430.472
CYP4F2 rs2108622V433MC>T0.3230.387
CYP19A1rs4646-C>A0.3200.893
rs6493497-G>A0.1800.938
CYP1A2 rs762551*1F, −163C>AA>C0.3630.259
rs2069526*K, *1E, −739T>GT>G0.0270.737
rs2470890*1B, 5347T>CC>T0.1530.740
rs2069522-T>C0.0270.737
rs3743484-G>C0.1470.614
rs2472304-G>A0.1530.740
rs4646427-T>C0.0230.770
rs2069521-G>A0.0570.462
CYP1B1 rs1056836*3, 4326C>G, L432VC>G0.1230.832
CYP2A6 rs28399433*13, *15, −48T>GT>G0.1730.391
CYP2B6 rs1042389-T>C0.2700.041
rs8192709*2, 64C>TC>T0.0200.803
CYP2C8 rs11572177-A>G0.0530.490
rs1113129-G>C0.4530.547
rs1341164-T>C0.0470.549
CYP2C18 rs12777823-G>A0.3130.011
ABCB1 rs10456423435C>TC>T0.3600.610
rs1128503Gly412GlyT>C0.4070.342
rs10280101-A>C0.0370.641
rs7787082-G>A0.4470.094
rs4148739-A>G0.0370.641
rs11983225-T>C0.0370.641
rs12720067-G>A0.0370.641
rs3213619−129T>CT>C0.0670.382
rs2235015287-25G>TG>T0.0370.641
rs10276036IVS9-44a>GC>T0.4070.342
rs28364274V1251IG>A0.0030.967
rs2032582-G>T0.1530.112
rs3789243-C>T0.3730.703
ABCC1 rs3784862-G>A0.3200.102
rs246240-A>G0.3770.428
rs2238476-C>T0.0330.673
rs3559216081823T>CT>C0.4800.610
rs356051684C>TC>T0.2400.463
rs22306714002G>AG>A0.1630.551
rs2120905462T>AT>A0.2270.891
rs4148356Arg723GlnG>A0.0670.382
rs119774-G>A0.0030.967
ABCC2 rs717620−24C>TG>A0.2430.696
rs37400663972C>TG>A0.2730.620
rs2273697V417IG>A0.0870.896
rs12762549-G>C0.3600.876
ABCC4 rs17510343463 A>GT>C0.1770.132
rs9561778 c.3366+1243G>TG>T0.2430.068
ABCC6 rs2238472Arg1268GlnG>A0.1730.779
ABCG2 rs13120400-T>C0.0070.934
rs17731538-G>A0.0570.020
rs2622604-C>T0.1430.957
rs2231142Q141KC>A0.2570.632
ABO rs8176746-C>A0.1600.481
rs495828-G>T0.3100.589
ACErs4341-C>G0.4100.201
ADM rs11042725−1923C>AC>A0.2730.187
ADRB2 rs1042713Arg16GlyA>G0.4370.259
ADRB3rs4994Trp64ArgT>C0.1570.299
AGTR1rs5182573C>TT>C0.2100.198
AKT1 rs2494732-C>T0.3130.388
ANKK1 rs1800497-C>T0.3800.565
APOB rs1367117711C>TG>A0.1070.144
APOC3rs51283238C>GG>C0.3070.967
rs2854117−482C>TG>A0.4370.595
ARG1 rs2781659-A>G0.3200.376
ATMrs4585-G>T0.4500.266
ATP7A rs2227291Val767LeuG>C0.210 2.10×10−8
ATXN1 rs179997A-241GA>G0.1330.814
BAT3 rs750332-A>G0.1130.383
BDKRB1 rs12050217-A>G0.4000.089
BDKRB2 rs1799722C-58TT>C0.4330.542
C6orf10 rs3129900-T>G0.0200.803
CACNG2 rs2284017-C>T0.4670.229
rs2284018-C>T0.3000.174
rs5750285-C>G0.4770.496
CAT rs10836235c.66+78C>TC>T0.2100.096
CBR1rs90241096G>AG>A0.2200.549
KCNH2 rs3807375-A>G0.1930.172
KCNJ11rs5219Lys23Glu, E23KC>T0.3500.346
KNG1 rs4686799-C>T0.3970.892
rs5030062-A>C0.2830.431
rs698078-T>C0.2870.286
LDLRrs68816730C>TC>T0.1400.968
LEMD2 rs2395402-T>C0.1770.858
LRP2 rs2075252-A>G0.4800.402
LTC4S rs730012−444CA>C0.1670.096
METTL21A rs7569963-G>A0.0830.964
rs4675690-T>C0.3430.543
MICA rs2848716-C>G0.2930.223
MLH1 rs1800734−93A>G0.4330.782
MTHFR rs18011311298A>CA>C0.1630.232
rs1801133Ala222ValC>T0.4230.768
NEFM rs1379357-G>C0.3330.391
NOS1AP rs10918594-G>C0.4870.877
rs10494366-G>T0.3170.251
NOS3 rs2070744−786T>CT>C0.1300.699
NPPArs5065T2238CA>G0.0100.902
NQO1 rs1800566*2, c.558C>TC>T0.4370.426
NR1I2 rs1464603g.252A>GT>C0.4400.181
NTRK1 rs2768759-A>C0.0830.964
OPRM1 rs1799971A118GA>G0.3830.719
P2RY1 rs701265-A>G0.3630.672
rs1065776893C>TC>T0.0970.576
P2RY12 rs2046934T744CT>C0.2330.027
PTGS1 rs3842787P17LC>T0.0900.226
PTGS2rs20417−765G>CG>C0.0270.005
RGS4 rs951439-C>T0.4130.256
rs2661319-A>G0.4730.006
rs2842030-T>G0.4500.127
SCN5A rs12053903-C>T0.4570.453
rs1805124H558RA>G0.1000.174
SLC10A1 rs2296651800C>TG>A0.0230.770
SLC10A2 rs2301159 c.*755C>TC>T0.2930.667
SLC19A1 rs1051266Arg27His, c.*746C>TA>G0.4970.022
SLC1A1 rs2228622-G>A0.2400.775
rs3780413-C>G0.2630.152
rs3780412-A>G0.2430.404
SLC22A16 rs714368146A>G, His49ArgA>G0.4430.405
SLC22A2 rs316019*4, A270SG>T0.1130.451
SLC28A2 rs241377516334845T>AA>T0.1530.354
SLCO1B1 rs2306283*1B, N130DC>T0.2370.470
rs4149056*5, c.521T>CT>C0.1600.264
rs4149081Intronic A/GG>A0.4530.296
rs11045879Intronic C/TT>C0.4530.296
SLCO1B3 rs11045585-A>G0.1700.440
SLCO2B1 rs12422149Arg312GlnG>A0.3900.334
SULT1C4 rs1402467p.Asp5GluC>G0.0800.965
TCF7L2 rs12255372-G>T0.0070.934
TNF rs1800629−308G>AG>A0.0530.354
TP53 rs1042522Arg72ProG>C0.3630.138
UGT1A7 rs7586110−57T>GT>G0.2200.282
UGT1A8 rs1042597*2, c.518C>G, Ala173GlyG>C0.4470.723
UGT2B15 rs1902023*2, Y85DT>G0.4870.630
UGT2B17 rs6552182*2, CNVC/T0.1630.999
ULK3 rs2290573-C>T0.1500.689
VDR rs1544410BsmIG>A0.0400.106
CBR1rs20572627C>T, A209AC>T0.2200.549
CBR3 rs1056892Val244MetG>A0.3800.642
CCND1 rs17852153870G>AA>G0.4600.567
CDA rs2072671Lys27Gln, K27QA>C0.1800.303
rs60369023c.208G>A, Ala70ThrG>A0.0070.934
rs532545−451C>TG>A0.1730.153
CETP rs708272Taq1BC>T0.3400.224
CHST3 rs4148943 c.*1278C>TC>T0.1030.596
rs4148945 c.*1361C>TC>T0.0730.816
rs4148950 c.*3477G>AG>A0.0730.816
rs1871450 c.*3785G>AG>A0.0730.816
rs730720 c.*4533C>TG>A0.1030.596
rs12418 c.*4785G>AG>A0.0730.816
CNTF rs1800169FS63TERG>A0.1430.957
COMT rs737865-T>C0.2770.844
rs165599-A>G0.4430.864
rs4680Val158MetG>A0.3130.214
CRHR2 rs2267715-G>A0.3830.719
rs2284220-A>G0.4400.499
rs7793837-A>T0.1830.107
CYTSA rs5760410 g.4205975G>AA>G0.3530.060
DRD2 rs4436578-T>C0.4870.863
rs1799978A-241GA>G0.1830.982
rs6277C957TC>T0.0500.519
rs1076560-C>A0.4030.135
DRD3 rs167771-A>G0.1470.882
rs6280Ser9GlyT>C0.3000.560
EGFR rs2227983R497KG>A0.2330.704
EPHX1 rs1051740Y113H, 337T>CT>C0.4470.760
rs2234922H139R, 416A>GA>G0.1430.957
ERBB2 rs1136201Ile655ValA>G0.1330.099
ERCC1 rs32129868092C>AG>T0.2770.833
rs1161519007T>C, Asn118AsnC>T0.2300.341
ERCC2rs131812251A>C, Lys751GlnT>G0.0430.579
FDPS rs2297480-C>A0.1870.677
FKBP5 rs1360780-C>T0.2500.057
rs3800373-T>G0.2230.101
GGCX rs6996648016G>AG>A0.3670.682
GGH rs11545078452C>TC>T0.0770.309
rs3780126 c.109+1307G>CC>T0.3130.783
rs11545077Ala31ThrG>A0.1770.345
GNB3rs5443Ser275SerC>T0.4570.082
GRIK4 rs1954787-C>T0.1230.333
GSK3B rs334558−50T>CG>A0.3500.622
rs13321783 IVS7+9227A>GG>A0.4200.246
rs2319398 IVS7+11660G>TT>G0.4300.362
rs6808874 IVS11+4251T>AA>T0.4930.252
GSTP1 rs1138272C341T, A114VC>T0.0800.965
rs1695*B, Ile105ValA>G0.1930.400
HLA-E rs1059510Asn98AsnG>A0.2930.252
HMGCR rs12654264-T>A0.4500.902
rs3846662-C>T0.4500.902
HSPA1L rs2227956-T>C0.0670.662
rs2075800E602KG>A0.3670.682
HTR1Ars6295-C>G0.2670.781
rs10042486-T>C0.2130.568
rs1364043-G>T0.3700.608
HTR2A rs9316233-C>G0.3230.623
rs7997012Intron 5, 2 variantG>A0.2030.919
rs6311−1438G>AC>T0.4700.541
rs6313102C>TC>T0.4670.662
HTR2C rs1414334-G>C0.013 1.53×10−9
rs518147−697G/CC>G0.140 6.36×10−14
rs3813928c.−995G>AG>A0.123 5.77×10−16
rs6318Cys23SerG>C0.013 1.53×10−9
rs3813929−759C>TC>T0.123 5.77×10−16
HTR3B rs2276307-A>G0.2230.486
HTR7 rs1935349-G>A0.2770.067
IL1Brs16944−511C/TG>A0.4630.793
IL28B rs8099917-T>G0.0700.740
rs12980275-A>G0.0770.891
rs8105790-T>C0.0700.740
rs11881222-A>G0.0700.740
rs7248668-G>A0.0670.662
ITPA rs1127354P32TC>A0.1470.882
KCNH2 rs3815459-A>G0.1870.903

[i] MAF, minor allele frequency; HWE, Hardy-Weinberg equilibrium.

Table III

List of 105 monomorphic single-nucleotide polymorphisms (SNPs).

Table III

List of 105 monomorphic single-nucleotide polymorphisms (SNPs).

GeneSNPAlternative nameAlleles
CYP2D6 rs1135822*49, 1611T>AT>A
rs35742686*3, 2549delAIns>del
rs5030655*6, 1707delTIns>del
CYP2D6_2*60, 1887insTADel>ins
rs5030867*7, 2935A>CA>C
rs5030656*9, 2615_2617delAAGIns>del
CYP2C9 rs28371685*11, R335WC>T
rs9332239*12, 50338C>TC>T
rs72558187*13, 3276T>CT>C
rs72558190*15, 9100C>AC>A
rs72558193*18, 47391A>CA>C
rs1799853*2, Arg144CysC>T
rs72558188*25, 353_362delAGAAATGGAAIns>del
rs9332131*6, 818delAIns>del
VKORC1 rs7200749*3F, 3462C>T, 8773C>TG>A
CYP2C19 rs41291556*8, 12711T>C, W120RT>C
rs56337013*5A, 1297C>T, R433WC>T
DPYD rs3918290*2A, IVS14+1G>AG>A
rs1801268*10, 2983G>T, V995FG>T
rs72549309*7, 295delTCATA>T
rs1801266*8, R235WC>T
rs1801267*9B, 2657G>A, R886HG>A
DPYD_2−268C/AC>A
DPYD_1N151DA>G
DPYD_3S811SC>T
DPYD_4T735AA>G
G6PD rs1050828202G>AC>T
rs1050829376A>GA>G
rs34193178H350DG>C
HLA-B*1502 rs3130690 HLA-B*1502C>A
HLA-B*5701 rs2395029 HLA-B*5701T>G
NAT1 rs4986990*11, c.459G>A, p.T153TG>A
rs5030839*15, c.559C>T, p.R187XC>T
rs56379106*17, c.190C>T, p.R64WC>T
rs56318881*19, c.97C>T, p.R33XC>T
rs56172717*22, c.752A>T, p.D251VA>T
rs55793712*5, c.884A>GA>G
rs72554612*5, c.976delAA>G
NAT2 rs1805158*19, 190C>T, R64WC>T
rs4986996 *12DG>A
TPMT rs1800462*2, 238G>C, A80PG>C
rs1800584*4G>A
UGT1A1 rs28934877*38A>G
rs55750087*29, R367GC>G
CYP3A4 rs4987161*17, F189S, 670T>CT>C
rs2740574*1B, −392A>GA>G
CYP3A5 rs10264272*6, 14690G>AC>T
rs41303343*7, 27131_27132insTA>T
rs28383479*9, 19386G>AG>A
rs41279854*10, 29753T>CA>G
CYP1A2 rs72547513*11, F186L, 558C>AC>A
rs72547511*15, P42R, 125C>GC>G
rs72547515*16, R377Q, 2473G>AC>T
rs55889066*5, C406Y, 3497G>AG>A
rs28399424*6, R431W, 5090C>TC>T
rs72547517*8, R456H, 5166G>AG>A
CYP2A6 rs28399468*10, 6600G>TG>T
rs1809810*18, 5668A>TA>T
rs56256500*23, R203C, 607C>TC>T
rs28399444*20, 2141_2142delAAA>C
rs12721655*8, 415A>G, K192EA>G
rs34223104*22, −82C>TT>C
rs36079186*27, 593T>C, M198TT>C
rs34097093*28, 1132C>T, R378XC>T
rs3211371*1C, *5, *7, 1459C>T, Arg487CysT>C
rs28399499*18, 983T>C, I328TT>C
rs58425034 c.646-159G>CG>C
rs12721646c.646-17C>TC>T
CYP2C8 rs11572103*2, I269F, A805TA>T
rs10509681*5, 2189delAIns>del
ABCB1 rs35810889M89TT>C
rs35023033R669CC>T
rs35730308W1108RT>C
rs35529209Ala989ThrG>A
rs45511401Gly671ValG>T
ABCC2 rs8187710Cys1515TyrG>A
rs17222723Val1188GluT>A
ADRB2 rs1800888Thr164IleC>T
AOX1 rs55754655Asn1135SerA>G
BCHE rs1799807Asp70GlyA>G
rs28933390Gly390ValG>T
rs28933389Thr243MetC>T
CBR3 rs2835285Val93IleG>A
COMT rs9332377-C>T
EGFR rs121434568L858RT>G
F2 rs1799963-G>A
GRIK2 rs2518224-A>C
GSTM3 rs1799735Intron 6, 3-bp deletionG>T
HTR2Ars6314C1354TC>T
ITGB3rs5918Leu33ProT>C
KCNH2 rs12720441R784WC>T
SCN5A rs7626962S1103YG>T
SLC22A1 rs340595081393G>A, G465RG>A
rs12208357148C>T, R61CC>T
SLC22A2 rs8177517K432QA>C
rs8177507M165IC>T
rs8177516*7, R400CC>T
SLC28A3 rs115683881099G>AG>A
SLCO1B1 rs56199088*10, D655GA>G
rs56101265*2, F73LT>C
rs72559745*3, E156GA>G
rs56061388*3, V82AT>C
rs59502379*9, G488AG>C
ST6GAL1 rs10937275-G>A
UGT2B10 rs7657958Asp67Tyr taggingG>A

Table IV

Summary of 141 pharmacogenes investigated in a Korean population (n=150).

Table IV

Summary of 141 pharmacogenes investigated in a Korean population (n=150).

ClassGene (no. of SNPs)
Phase ICYP2D6 (14)
CYP2C9 (13)
CYP2C19 (15)
DPYD (16)
CYP2E1 (6)
CYP3A4 (3)
CYP3A5 (6)
CYP4B1 (1)
CYP4F2 (1)
CYP19A1 (2)
CYP1A2 (14)
CYP1B1 (1)
CYP2A6 (5)
CYP2B6 (10)
CYP2C8 (5)
CYP2C18 (1)
AOX1 (1)
CBR1 (2)
CBR3 (2)
EPHX1 (2)
NOS3 (1)
Phase IINAT1 (10)
NAT2 (10)
TPMT (6)
UGT1A1 (9)
CHST3 (6)
GSTM3 (1)
GSTP1 (2)
SULT1C4 (1)
UGT1A7 (1)
UGT1A8 (1)
UGT2B10 (1)
UGT2B15 (1)
UGT2B17 (1)
TransporterABCB1 (16)
ABCC1 (11)
ABCC2 (6)
ABCC4 (2)
ABCC6 (1)
ABCG2 (4)
SLC10A1 (1)
SLC10A2 (1)
SLC19A1 (1)
SLC1A1 (3)
SLC22A1 (2)
SLC22A16 (1)
SLC22A2 (4)
SLC28A2 (1)
SLC28A3 (1)
SLCO1B1 (9)
SLCO1B3 (1)
SLCO2B1 (1)
ATP7A (1)
CAT (1)
ModifierCDA (3)
KCNJ11 (1)
NR1I2 (1)
VKORC1 (6)
G6PD (6)
Others HLA-B*1502 (3)
HLA-B*5701 (1)
ABO (2)
ACE (1)
ADM (1)
ADRB2 (2)
ADRB3 (1)
AGTR1 (1)
AKT1 (1)
OthersANKK1 (1)
APOB (1)
APOC3 (2)
ARG1 (1)
ATM (1)
ATXN1 (1)
BAT3 (1)
BCHE (3)
BDKRB1 (1)
BDKRB2 (1)
C6orf10 (1)
CACNG2 (3)
CCND1 (1)
CETP (1)
CNTF (1)
COMT (4)
CRHR2 (3)
CYTSA (1)
DRD2 (4)
DRD3 (2)
EGFR (2)
ERBB2 (1)
ERCC1 (2)
ERCC2 (1)
F2 (1)
FDPS (1)
FKBP5 (2)
GGCX (1)
GGH (3)
GNB3 (1)
GRIK2 (1)
GRIK4 (1)
GSK3B (4)
HLA-E (1)
OthersHMGCR (2)
HSPA1L (2)
HTR1A (3)
HTR2A (5)
HTR2C (5)
HTR3B (1)
HTR7 (1)
IL1B (1)
IL28B (5)
ITGB3 (1)
ITPA (1)
KCNH2 (3)
KNG1 (3)
LDLR (1)
LEMD2 (1)
LRP2 (1)
LTC4S (1)
METTL21A (2)
MICA (1)
MLH1 (1)
MTHFR (2)
NEFM (1)
NOS1AP (2)
NPPA (1)
NQO1 (1)
NTRK1 (1)
OPRM1 (1)
P2RY1 (2)
P2RY12 (1)
PTGS1 (1)
PTGS2 (1)
RGS4 (3)
SCN5A (3)
ST6GAL1 (1)
OthersTCF7L2 (1)
TNF (1)
TP53 (1)
ULK3 (1)
VDR (1)

First, 14 CYP2D6 SNPs (rs1065852, rs16947, rs1135822, rs35742686, rs3892097, rs5030655, rs79738337, rs1058164, rs1135840, rs28371525, CYP2D6_2, rs5030867, rs5030865 and rs5030656) were used for the investigation of 17 star-alleles (*1, *2, *3, *4, *5, *6, *7, *8, *9, *10, *14A, *14B, *34, *36, *41, *49 and *60). CYP2D6 is one of the most important pharmacogenes involved in the metabolism of foreign substances in the body. Overall, the genotypes associated with decreased activity or a non-functional enzyme were ~20% of all the investigated genotypes (Table V). Specifically, screening of polymorphisms such as rs3892097, rs1065852, rs16947 and rs1135840 may be useful for detecting the enzyme activity level of CYP2D6. CYP2C19 is clinically important for the metabolism of drugs including clopidogrel (20), which is an inhibitor of adenosine diphosphate-induced platelet aggregation (21–23). To investigate the association between CYP2C19 and clopidogrel response, 15 CYP2C19 SNPs were used for the investigation of seven alleles (*1, *2, *3, *4, *5A, *8 and *17) (Table V). In general, over half of the subjects were found to have genotypes that reduced the efficacy of clopidogrel, while 11.5% of the subjects carried genotypes which enhanced the efficacy of clopidogrel. This information may be used to adjust the dose of clopidogrel depending on the patient genotypes of the investigated polymorphisms.

Table V

Frequencies and effects of CYPD6, CYP2C19, TPMT, DPYD and IL28B genotypes on enzyme activity and drug toxicity.

Table V

Frequencies and effects of CYPD6, CYP2C19, TPMT, DPYD and IL28B genotypes on enzyme activity and drug toxicity.

GeneStar-allele genotype Star-allele-defining SNPs (genotype of each SNP)No.Freq. (%)Enzyme activityaClopidogrel efficacybAdverse reactions of azathioprine, mercaptopurine and thioguaninec5-FU toxicitydTreatment outcome for hepatitis Ce
CYP2D6 *1/*1Wild-type9563.3NormalN/AN/AN/AN/A
*1/*2rs16947 (CT), rs1135840 (GG)64NormalN/AN/AN/AN/A
*2/*2rs16947 (TT), rs1135840 (GG)21.3NormalN/AN/AN/AN/A
*1/*4rs3892097 (AG)1812DecreasedN/AN/AN/AN/A
*4/*4rs3892097 (AA)21.3NoneN/AN/AN/AN/A
*1/*10rs1065852 (CT or TT), rs1135840 (GG or CG)74.7NormalN/AN/AN/AN/A
*1/*14Ars1065852 (CT or TT), rs16947 (CT or TT), rs1135840 (GG or CG)128DecreasedN/AN/AN/AN/A
*1/*34rs16947 (CT)3422.7NormalN/AN/AN/AN/A
*34/*34rs16947 (TT)42.7NormalN/AN/AN/AN/A
*1/*36rs1065852 (CT or TT), rs1135840 (GG or CG)74.7NormalN/AN/AN/AN/A
*1/*60 CYP2D6_2f (ins/del or del/del), rs79738337 (TT or CT)21.3NormalN/AN/AN/AN/A
CYP2C19 *1/*1Wild-type4525.9NormalTypicalN/AN/AN/A
*1/*2rs4244285 (AG)7844.8DecreasedReducedN/AN/AN/A
*2/*2rs4244285 (AA)84.6DecreasedGreatly reducedN/AN/AN/A
*1/*3rs4986893 (AG)2112.1DecreasedReducedN/AN/AN/A
*3/*3rs4986893 (AA)10.6DecreasedGreatly reducedN/AN/AN/A
*1/*4rs28399504 (AG)10.6DecreasedReducedN/AN/AN/A
*1/*17rs11188072 (CC or CT), rs12248560 (CC or CT)2011.5IncreasedEnhancedN/AN/AN/A
TPMT *1/*3Brs1800460 (AG)10.7DecreasedN/AIncreased drug toxicityN/AN/A
*1/*3Crs1142345 (AG)42.7DecreasedN/AIncreased drug toxicityN/AN/A
*1/*6rs75543815 (AA)13992.7DecreasedN/AIncreased drug toxicityN/AN/A
*6/*6rs75543815 (AT)74.7DecreasedN/AIncreased drug toxicityN/AN/A
DPYD *1/*1rs3918290 (GG)150100-N/AN/ALow riskN/A
*1/*5rs1801159 (AG)6543.3NormalN/AN/A-N/A
*5/*5rs1801159 (GG)96NormalN/AN/A-N/A
*1/*9Ars1801265 (CT)1610.7NormalN/AN/A-N/A
c.496A>Grs2297595 (AG)32NormalN/AN/A-N/A
IL28B-rs8099917 (TT)13086.7N/AN/AN/AN/ANormal
-rs8099917 (GT)1912.7N/AN/A
N/A
N/A
N/A
N/A1.64 times less likely to respond
-rs8099917 (GG)10.7N/AN/A
N/A
N/A
N/A
N/A2.39 times less likely to respond

a Enzyme activity based on previous studies [CYP2D6 (21,76–80), CYP2C19 (81), TPMT (82,83), DPYD (84)].

b The efficacy of clopidogrel was estimated based on a previous study (81).

c The adverse reactions to azathioprine, mercaptopurine and thioguanine were estimated based on previous studies (8).

d 5-Fluorouracil (5-FU) toxicity estimation was based on a previous study (84).

e Odds of responding to peginterferon-α and ribavirin (PEG-IFNα/RBV) treatment for hepatitis C. The outcome estimation was based on previous studies (74,85).

f TA insertion at position 1887. N/A, not applicable.

TPMT encodes an enzyme involved in the detoxification of azathioprine, mercaptopurine and thioguanine, which are immunosuppressive drugs used in organ transplantation (24–27). Five SNPs (rs75543815, rs1142345, rs1800460, rs1800462 and rs1800584) were used to investigate the frequency of five alleles (*2, *3B, *3C, *4 and *6) in this study (Table V). The results suggested that the majority of Korean subjects have TPMT genotypes, which render them more prone to the toxicity of the aforementioned drugs. The dihydropyrimidine dehydrogenase gene (DPYD) encodes an enzyme catabolizing 5-fluorouracil (5-FU), which is commonly used for the treatment of solid carcinomas (28,29). A decrease in enzyme activity involved in 5-FU catabolism due to the mutational variants in DPYD may lead to an increase in the half-life of 5-FU and an increased risk of dose-dependent toxicity (28,30,31). In our study, all the Korean subjects were found to carry the DPYD genotypes associated with normal enzyme activity (*1/*5, *5/*5, *1/*9A, or c.496A>G; Table V). A polymorphism of interleukin 28B (IL28B), rs8099917 has been reported to be associated with the virologic response to peginterferon-α (PEG-IFNα) and ribavirin (RBV) combination therapy in hepatitis C virus-infected patients (32–34), whereas the GT and GG genotypes of rs8099917 have been suggested to be less responsive to treatment compared to TT (32). In this study, subjects carrying the TT genotype were the most common (86.7%), whereas the GT and GG genotypes were significantly less frequent (12.7 and 0.7%, respectively) in the Korean population (Table V). These results may be used to identify patients with reduced responsiveness to PEG-IFNα/RBV combined therapy and adjust the amount accordingly.

Warfarin is an anticoagulant used for the prevention of thromboembolic events and stroke (35). CYP2C9*2 variants, *3 variants (36–40) and VKORC1 polymorphism rs8050894 (41) were reported to be significantly associated with warfarin dose in European or African populations. In this study, we evaluated the variability of warfarin dose according to the CYP2C9 and VKORC1 genotypes using CYP2C9*2, *3 and rs8050894, based on previous reports (Table VI). Combinations of the CG or CC genotype of rs8050894 and CYP2C9 wild-type (*1/*1) yielded the highest warfarin dose requirement (5–7 mg/day), whereas a combination of the GG genotype of rs8050894 and CYP2C9*1/*1, demanding 3–4 mg/day of warfarin, was the most frequent (76.0%) in the Korean population. Furthermore, the warfarin dose requirement in CYP2C9 wild-type (*1/*1) was higher compared to that in *2 or *3 variant allele-containing genotypes (*1/*2, *1/*3, *2/*2, *2/*3 and *3/*3), which was also observed in European and African-American populations (42). As regards rs8050894 in VKORC1, an overall higher warfarin dose requirement in CG (heterozygote) or CC (minor homozygote) compared to that in GG (major homozygote) was observed. However, in European and African-American populations, GG exhibited a higher warfarin dose requirement compared to the CG or CC genotype (42). Further investigations may be required to verify the different genetic effect on warfarin response in various ethnic groups.

Table VI

Frequencies and effect of combined CYP2C9 and VKORC1 genotypes on the response to warfarin.

Table VI

Frequencies and effect of combined CYP2C9 and VKORC1 genotypes on the response to warfarin.

CYP2C9VKORC1 (rs8050894)

CCCGGG




Star- allele genotypeStar-allele- defining SNPsGenotype in each SNPnFreq. (%)Warfarin dose (mg/day)anFreq. (%)Warfarin dose (mg/day)anFreq. (%)Warfarin dose (mg/day)a
*1/*1 rs1799853CC10.75–72214.75–711476.03–4
rs1057910AA
*1/*2 rs1799853CT005–7003–4003–4
rs1057910AA
*1/*3 rs1799853CC003–410.73–4128.00.5–2
rs1057910AC
*2/*2 rs1799853TT003–4003–4000.5–2
rs1057910AA
*2/*3 rs1799853CT or TT003–4000.5–2000.5–2
rs1057910AC or CC
*3/*3 rs1799853CC000.5–2000.5–2000.5–2
rs1057910CC

a Warfarin dose estimation was based on previous studies (52,86,87).

HLA-B encodes for a protein which is an important part of the human immune system and its polymorphisms have been associated with various drug reactions (43–45). Carbamazepine, which is often used for treatment of chronic pain, bipolar disorder, seizure disorder and trigeminal neuralgia, is one of the most common causes of drug hypersensitivity reactions (46). The star-allele HLA-B*1502 is associated with various toxic events resulting from carbamazepine, such as cutaneous adverse drug reactions or Stevens-Johnson syndrome in Asian populations (47–51). In this study, two tagging SNPs of HLA-B*1502, rs3909184 and rs2844682, were used for the evaluation of the HLA-B*1502 frequency in the Korean population (Table VII). No subject was identified as carrying one or two copies of HLA-B*1502, which is associated with increased risk of adverse reactions to carbamazepine. Thus, the Korean population may have a relatively low risk of adverse reactions to carbamazepine.

Table VII

Frequencies and combined effects of rs2844682 and rs3909184 (tagging HLA-B*1502) on adverse reactions to carbamazepine.

Table VII

Frequencies and combined effects of rs2844682 and rs3909184 (tagging HLA-B*1502) on adverse reactions to carbamazepine.

SNP/GenotypenFreq. (%) HLA-B*1502 typeAdverse reactions to carbamazepinea

rs2844682 rs3909184
CCCC9563.3NoneLow risk
CCCG106.7NoneLow risk
CCGG10.7NoneLow risk
CTCC3724.7NoneLow risk
CTCG42.7Unable to be determined-
CTGG00 *1502 (one copy)High risk
TTCC32.0NoneLow risk
TTCG00 *1502 (one copy)High risk
TTGG00 *1502 (two copies)High risk

a Reaction estimation based on a previous study (88).

HLA-B*5701, which is in linkage disequilibrium with rs2395029 in HCP5, was reported to be a predictive marker of abacavir hypersensitivity (52). Abacavir is an inhibitor of nucleoside reverse-transcriptase and is used as an anti-retroviral agent for human immunodeficiency virus treatment (53). All 150 Korean subjects were found to carry the combination of the TT genotype of rs2395029 and HLA-B*5701-negative type, which is associated with a low risk of hypersensitivity to abacavir (Table VIII). The genotype frequencies of TPMT and catechol O-methyltransferase (COMT) polymorphisms, which are associated with the risk of hearing loss due to cisplatin toxicity (54), were also estimated in the Korean population (Table VIII) and the combination of the AA genotype of rs1142345 (TPMT) and the CC genotype of rs9332377 (COMT), which are associated with a lower risk of cisplatin ototoxicity (54), exhibited the highest frequency (93.7%) in the Korean population.

Table VIII

Frequency and effects of HCP5/HLA-B*5701 and TPMT/COMT polymorphisms on adverse drug reaction.

Table VIII

Frequency and effects of HCP5/HLA-B*5701 and TPMT/COMT polymorphisms on adverse drug reaction.

SNP ID/GenotypenFreq. (%)Abacavir hypersensitivitya

rs2395029 (HCP5) HLA-B*5701
TTNone150100Low risk
TG*5701 (one copy)00High risk
GG*5701 (two copies)00High risk

rs1142345 (TPMT)rs9332377 (COMT)nFreq. (%)Adverse reactions to cisplatinb

AACC14693.7Low risk
AGCC42.7High risk
GGCC00High risk

a Estimated based on a previous study (89).

b Risk estimation of adverse reactions to cisplatin was based on a previous study (39).

In conclusion, we conducted extensive analyses of the distribution of various pharmacogene polymorphisms in 150 Korean subjects and identified the genotype frequencies of important pharmacogene polymorphisms, such as CYP2D6, CYP2C9, VKORC1, CYP2C19, HLA-B and TPMT among others, which may affect the efficacy and side effects of various drugs, including warfarin, clopidogrel, carbamazepine, azathioprine and others. To the best of our knowledge, our study was the first to simultaneously investigate a large number of pharmacogene polymorphisms in multiple samples in a Korean population. The findings from the present study may be helpful in developing personalized medicines for Korean patients. Moreover, the methods used in the present study may also be applied in other populations in order to study their unique pharmacogenomics.

Acknowledgements

This study was supported by a grant from the Ministry of Food and Drug Safety, Republic of Korea, in 2011 (no. 10182MFDS572).

References

1 

Lazarou J, Pomeranz BH and Corey PN: Incidence of adverse drug reactions in hospitalized patients: a meta-analysis of prospective studies. JAMA. 279:1200–1205. 1998. View Article : Google Scholar : PubMed/NCBI

2 

Dormann H, Neubert A, Criegee-Rieck M, et al: Readmissions and adverse drug reactions in internal medicine: the economic impact. J Intern Med. 255:653–663. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Shastry BS: Pharmacogenetics and the concept of individualized medicine. Pharmacogenomics J. 6:16–21. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Sachidanandam R, Weissman D, Schmidt SC, et al; International SNP Map Working Group. A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature. 409:928–933. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Evans WE and Relling MV: Pharmacogenomics: translating functional genomics into rational therapeutics. Science. 286:487–491. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Evans WE and Johnson JA: Pharmacogenomics: the inherited basis for interindividual differences in drug response. Annu Rev Genomics Hum Genet. 2:9–39. 2001. View Article : Google Scholar : PubMed/NCBI

7 

McLeod HL and Evans WE: Pharmacogenomics: unlocking the human genome for better drug therapy. Annu Rev Pharmacol Toxicol. 41:101–121. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Yates CR, Krynetski EY, Loennechen T, et al: Molecular diagnosis of thiopurine S-methyltransferase deficiency: genetic basis for azathioprine and mercaptopurine intolerance. Ann Intern Med. 126:608–614. 1997. View Article : Google Scholar : PubMed/NCBI

9 

Evans WE and McLeod HL: Pharmacogenomics - drug disposition, drug targets, and side effects. N Engl J Med. 348:538–549. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Johnson JA: Pharmacogenetics: potential for individualized drug therapy through genetics. Trends Genet. 19:660–666. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Guttmacher AE and Collins FS: Welcome to the genomic era. N Engl J Med. 349:996–998. 2003. View Article : Google Scholar : PubMed/NCBI

12 

Zineh I, Gerhard T, Aquilante CL, Beitelshees AL, Beasley BN and Hartzema AG: Availability of pharmacogenomics-based prescribing information in drug package inserts for currently approved drugs. Pharmacogenomics J. 4:354–358. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Schmitz G, Aslanidis C and Lackner KJ: Pharmacogenomics: implications for laboratory medicine. Clin Chim Acta. 308:43–53. 2001. View Article : Google Scholar

14 

Collins FS, Green ED, Guttmacher AE, Guyer MS, et al: A vision for the future of genomics research. Nature. 422:835–847. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Ragoussis J: Genotyping technologies for genetic research. Annu Rev Genomics Hum Genet. 10:117–133. 2009. View Article : Google Scholar

16 

Kapoor G, Maitra A and Brahmachari V: Application of SNaPshot for analysis of thiopurine methyltransferase gene polymorphism. Indian J Med Res. 129:500–505. 2009.PubMed/NCBI

17 

Fan JB, Gunderson KL, Bibikova M, et al: Illumina universal bead arrays. Methods Enzymol. 410:57–73. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Lin CH, Yeakley JM, McDaniel TK and Shen R: Medium- to high-throughput SNP genotyping using VeraCode microbeads. Methods Mol Biol. 496:129–142. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Sanchez JJ, Borsting C, Hallenberg C, Buchard A, Hernandez A and Morling N: Multiplex PCR and minisequencing of SNPs - a model with 35 Y chromosome SNPs. Forensic Sci Int. 137:74–84. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Hulot JS, Bura A, Villard E, et al: Cytochrome P450 2C19 loss-of-function polymorphism is a major determinant of clopidogrel responsiveness in healthy subjects. Blood. 108:2244–2247. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Savi P, Herbert JM, Pflieger AM, et al: Importance of hepatic metabolism in the antiaggregating activity of the thienopyridine clopidogrel. Biochem Pharmacol. 44:527–532. 1992. View Article : Google Scholar : PubMed/NCBI

22 

Savi P, Combalbert J, Gaich C, et al: The antiaggregating activity of clopidogrel is due to a metabolic activation by the hepatic cytochrome P450-1A. Thromb Haemost. 72:313–317. 1994.PubMed/NCBI

23 

Hollopeter G, Jantzen HM, Vincent D, et al: Identification of the platelet ADP receptor targeted by antithrombotic drugs. Nature. 409:202–207. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Derijks LJ, Gilissen LP, Engels LG, et al: Pharmacokinetics of 6-thioguanine in patients with inflammatory bowel disease. Ther Drug Monit. 28:45–50. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Heneghan MA, Allan ML, Bornstein JD, Muir AJ and Tendler DA: Utility of thiopurine methyltransferase genotyping and phenotyping, and measurement of azathioprine metabolites in the management of patients with autoimmune hepatitis. J Hepatol. 45:584–591. 2006. View Article : Google Scholar

26 

Roman M, Cabaleiro T, Ochoa D, et al: Validation of a genotyping method for analysis of TPMT polymorphisms. Clin Ther. 34:878–884. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Hakooz N, Arafat T, Payne D, et al: Genetic analysis of thiopurine methyltransferase polymorphism in the Jordanian population. Eur J Clin Pharmacol. 66:999–1003. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Amstutz U, Froehlich TK and Largiader CR: Dihydropyrimidine dehydrogenase gene as a major predictor of severe 5-fluorouracil toxicity. Pharmacogenomics. 12:1321–1336. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Meyerhardt JA and Mayer RJ: Systemic therapy for colorectal cancer. N Engl J Med. 352:476–487. 2005. View Article : Google Scholar : PubMed/NCBI

30 

Ezzeldin H and Diasio R: Dihydropyrimidine dehydrogenase deficiency, a pharmacogenetic syndrome associated with potentially life-threatening toxicity following 5-fluorouracil administration. Clin Colorectal Cancer. 4:181–189. 2004. View Article : Google Scholar

31 

van Kuilenburg AB, Maring JG, Schalhorn A, et al: Pharmacokinetics of 5-fluorouracil in patients heterozygous for the IVS14+1G>A mutation in the dihydropyrimidine dehydrogenase gene. Nucleosides Nucleotides Nucleic Acids. 27:692–698. 2008.

32 

Suppiah V, Moldovan M, Ahlenstiel G, et al: IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat Genet. 41:1100–1104. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Tanaka Y, Nishida N, Sugiyama M, et al: Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet. 41:1105–1109. 2009. View Article : Google Scholar : PubMed/NCBI

34 

Rauch A, Kutalik Z, Descombes P, et al: Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology. 138:1338–1345. 2010. View Article : Google Scholar : PubMed/NCBI

35 

Glurich I, Burmester JK and Caldwell MD: Understanding the pharmacogenetic approach to warfarin dosing. Heart Fail Rev. 15:239–248. 2010. View Article : Google Scholar : PubMed/NCBI

36 

Schalekamp T, Brasse BP, Roijers JF, et al: VKORC1 and CYP2C9 genotypes and phenprocoumon anticoagulation status: interaction between both genotypes affects dose requirement. Clin Pharmacol Ther. 81:185–193. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Wadelius M, Chen LY, Eriksson N, et al: Association of warfarin dose with genes involved in its action and metabolism. Hum Genet. 121:23–34. 2007. View Article : Google Scholar : PubMed/NCBI

38 

Sconce EA, Khan TI, Wynne HA, et al: The impact of CYP2C9 and VKORC1 genetic polymorphism and patient characteristics upon warfarin dose requirements: proposal for a new dosing regimen. Blood. 106:2329–2333. 2005. View Article : Google Scholar : PubMed/NCBI

39 

D’Andrea G, D’Ambrosio RL, Di Perna P, et al: A polymorphism in the VKORC1 gene is associated with an interindividual variability in the dose-anticoagulant effect of warfarin. Blood. 105:645–649. 2005.PubMed/NCBI

40 

Schalekamp T, Brasse BP, Roijers JF, et al: VKORC1 and CYP2C9 genotypes and acenocoumarol anticoagulation status: interaction between both genotypes affects overanticoagulation. Clin Pharmacol Ther. 80:13–22. 2006. View Article : Google Scholar

41 

Wang D, Chen H, Momary KM, Cavallari LH, Johnson JA and Sadee W: Regulatory polymorphism in vitamin K epoxide reductase complex subunit 1 (VKORC1) affects gene expression and warfarin dose requirement. Blood. 112:1013–1021. 2008. View Article : Google Scholar : PubMed/NCBI

42 

Limdi NA, Arnett DK, Goldstein JA, et al: Influence of CYP2C9 and VKORC1 on warfarin dose, anticoagulation attainment and maintenance among European-Americans and African-Americans. Pharmacogenomics. 9:511–526. 2008. View Article : Google Scholar : PubMed/NCBI

43 

Fuerst D, Parmar S, Schumann C, et al: HLA polymorphisms influence the development of skin rash arising from treatment with EGF receptor inhibitors. Pharmacogenomics. 13:1469–1476. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Melis R, Lewis T, Millson A, et al: Copy number variation and incomplete linkage disequilibrium interfere with the HCP5 genotyping assay for abacavir hypersensitivity. Genet Test Mol Biomarkers. 16:1111–1114. 2012. View Article : Google Scholar : PubMed/NCBI

45 

Maekawa K, Nishikawa J, Kaniwa N, et al: Development of a rapid and inexpensive assay for detecting a surrogate genetic polymorphism of HLA-B*58:01: a partially predictive but useful biomarker for allopurinol-related Stevens-Johnson syndrome/toxic epidermal necrolysis in Japanese. Drug Metab Pharmacokinet. 27:447–450. 2012. View Article : Google Scholar : PubMed/NCBI

46 

Leeder JS: Mechanisms of idiosyncratic hypersensitivity reactions to antiepileptic drugs. Epilepsia. 39(Suppl 7): S8–S16. 1998. View Article : Google Scholar : PubMed/NCBI

47 

Wu XT, Hu FY, An DM, et al: Association between carbamazepine-induced cutaneous adverse drug reactions and the HLA-B*1502 allele among patients in central China. Epilepsy Behav. 19:405–408. 2010. View Article : Google Scholar : PubMed/NCBI

48 

Hung SI, Chung WH, Liu ZS, et al: Common risk allele in aromatic antiepileptic-drug induced Stevens-Johnson syndrome and toxic epidermal necrolysis in Han Chinese. Pharmacogenomics. 11:349–356. 2010. View Article : Google Scholar : PubMed/NCBI

49 

Chen P, Lin JJ, Lu CS, et al: Carbamazepine-induced toxic effects and HLA-B*1502 screening in Taiwan. N Engl J Med. 364:1126–1133. 2011. View Article : Google Scholar : PubMed/NCBI

50 

Zhang Y, Wang J, Zhao LM, et al: Strong association between HLA-B*1502 and carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis in mainland Han Chinese patients. Eur J Clin Pharmacol. 67:885–887. 2011.PubMed/NCBI

51 

Wang Q, Zhou JQ, Zhou LM, et al: Association between HLA-B*1502 allele and carbamazepine-induced severe cutaneous adverse reactions in Han people of southern China mainland. Seizure. 20:446–448. 2011.

52 

Colombo S, Rauch A, Rotger M, et al: The HCP5 single-nucleotide polymorphism: a simple screening tool for prediction of hypersensitivity reaction to abacavir. J Infect Dis. 198:864–867. 2008. View Article : Google Scholar : PubMed/NCBI

53 

Sanchez-Giron F, Villegas-Torres B, Jaramillo-Villafuerte K, et al: Association of the genetic marker for abacavir hypersensitivity HLA-B*5701 with HCP5 rs2395029 in Mexican Mestizos. Pharmacogenomics. 12:809–814. 2011. View Article : Google Scholar : PubMed/NCBI

54 

Ross CJ, Katzov-Eckert H, Dube MP, et al: Genetic variants in TPMT and COMT are associated with hearing loss in children receiving cisplatin chemotherapy. Nat Genet. 41:1345–1349. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kim JY, Cheong HS, Park TJ, Shin HJ, Seo DW, Na HS, Chung MW and Shin HD: Screening for 392 polymorphisms in 141 pharmacogenes. Biomed Rep 2: 463-476, 2014.
APA
Kim, J.Y., Cheong, H.S., Park, T., Shin, H.J., Seo, D.W., Na, H.S. ... Shin, H.D. (2014). Screening for 392 polymorphisms in 141 pharmacogenes. Biomedical Reports, 2, 463-476. https://doi.org/10.3892/br.2014.272
MLA
Kim, J. Y., Cheong, H. S., Park, T., Shin, H. J., Seo, D. W., Na, H. S., Chung, M. W., Shin, H. D."Screening for 392 polymorphisms in 141 pharmacogenes". Biomedical Reports 2.4 (2014): 463-476.
Chicago
Kim, J. Y., Cheong, H. S., Park, T., Shin, H. J., Seo, D. W., Na, H. S., Chung, M. W., Shin, H. D."Screening for 392 polymorphisms in 141 pharmacogenes". Biomedical Reports 2, no. 4 (2014): 463-476. https://doi.org/10.3892/br.2014.272
Copy and paste a formatted citation
x
Spandidos Publications style
Kim JY, Cheong HS, Park TJ, Shin HJ, Seo DW, Na HS, Chung MW and Shin HD: Screening for 392 polymorphisms in 141 pharmacogenes. Biomed Rep 2: 463-476, 2014.
APA
Kim, J.Y., Cheong, H.S., Park, T., Shin, H.J., Seo, D.W., Na, H.S. ... Shin, H.D. (2014). Screening for 392 polymorphisms in 141 pharmacogenes. Biomedical Reports, 2, 463-476. https://doi.org/10.3892/br.2014.272
MLA
Kim, J. Y., Cheong, H. S., Park, T., Shin, H. J., Seo, D. W., Na, H. S., Chung, M. W., Shin, H. D."Screening for 392 polymorphisms in 141 pharmacogenes". Biomedical Reports 2.4 (2014): 463-476.
Chicago
Kim, J. Y., Cheong, H. S., Park, T., Shin, H. J., Seo, D. W., Na, H. S., Chung, M. W., Shin, H. D."Screening for 392 polymorphisms in 141 pharmacogenes". Biomedical Reports 2, no. 4 (2014): 463-476. https://doi.org/10.3892/br.2014.272
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team