Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
March-2016 Volume 4 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2016 Volume 4 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Expression of calcitonin gene‑related peptide, adenosine A2a receptor and adenosine A1 receptor in experiment rat migraine models

  • Authors:
    • Wenxian Lu
    • Bin Li
    • Jinbo Chen
    • Yipeng Su
    • Xiaomeng Dong
    • Xinyang Su
    • Lixiang Gao
  • View Affiliations / Copyright

    Affiliations: Department of Neurology, Binzhou Medical University Hospital, Binzhou, Shandong 256603, P.R. China, Clinical Medical College, Binzhou Medical University, Yantai, Shandong 264003, P.R. China
  • Pages: 379-383
    |
    Published online on: February 5, 2016
       https://doi.org/10.3892/br.2016.591
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

A migraine is a disabling neurovascular disorder characterized by a unilateral throbbing headache that lasts from 4 to 72 h. The headache is often accompanied by nausea, vomiting, phonophobia and photophobia, and may be worsened by physical exercise. The trigeminovascular system (TVS) is speculated to have an important role in migraines, although the pathophysiology of this disorder remains to be elucidated. Trigeminal ganglion (TG) and spinal trigeminal nucleus caudalis (TNC) are important components of the TVS. Several clinical cases have provided evidence for the involvement of the brainstem in migraine initiation. Electrical stimulation of the trigeminal ganglion (ESTG) in rats can activate TVS during a migraine attack. Calcitonin gene‑related peptide (CGRP) is an important vasoactive compound produced following TVS activation. Numerous studies have revealed that adenosine and its receptors have an important role in pain transmission and regulation process. However, only a few studies have examined whether adenosine A2a receptor (A2aR) and adenosine A1 receptor (A1R) are involved in migraine and nociceptive pathways. In the present study, CGRP, A2aR and A1R expression levels were detected in the TG and TNC of ESTG models through reverse transcription‑quantitative polymerase chain reaction and western blot analysis. Tianshu capsule (TSC), a type of Chinese medicine, was also used in the ESTG rat models to examine its influence on the three proteins. Results demonstrated that CGRP, A2aR and A1R mediated pain transmission and the regulation process during migraine and the expression of the three proteins was regulated by TSC.

Introduction

A migraine is more than just a headache; it is a complex neurological disorder that involves altered sensory perception and processing, affecting ~15% of the population, and the mechanisms underlying migraine have not been completely elucidated (1). The trigeminovascular pathway and neuropeptide calcitonin gene-related peptide (CGRP) have important roles in migraines (2–5). Trigeminovascular doctrine combines nerves, blood vessels and neurotransmitters to explain certain animal experiments results and clinical manifestations of migraines. Electrical stimulation of the trigeminal ganglion (ESTG) in humans leads to increased extracerebral blood flow and local release of CGRP and substance P (6). This phenomenon causes extravasation of plasma proteins and neurogenic inflammation, which can stimulate spreading of the trigeminal nerve vascular fiber and nerve impulses in the brainstem, hypothalamus and cortex, eventually leading to migraine.

The pathogenesis of a migraine remains to be elucidated, and a variety of theories offer different targets for migraine treatment. Serotonin receptor agonists and nonsteroidal anti-inflammatory drugs have a clear therapeutic effect on migraines. Other targets, such as glutamate receptors, nitric oxide synthase and adenosine Al receptor (A1R), have been recently found to treat migraine, but they have not been clinically used (7,8). The physiological effects of adenosine, an important neurotransmitter, are mediated by adenosine receptor. Four adenosine receptor subtypes have been discovered, which are A1R, adenosine A2a receptor (A2aR), A2bR and A3R (9). A1R and A2aR are high-affinity receptors, which have an important role in pain information transmission and regulation. In addition to the aforementioned drugs, several Chinese medicines, including Tianshu capsule (TSC), also have an important role in migraine treatment. In China, a number of neurologists apply TSC as an acute and prophylactic drug treatment for migraines (10).

The present study aimed to determine whether CGRP, A2aR and A1R are involved in migraine pain information transmission in the ESTG migraine rat model. The possible mechanisms of TSC for migraine treatment were also explored.

Materials and methods

Animals

A total of 40 male Sprague-Dawley rats weighing 280–320 g (Vital River Laboratory Animal Technology Co., Ltd., Beijing, China) were used. All the rats were maintained under standard laboratory housing conditions with a 12 h-light-dark cycle and had free access to food and water. All the experimental protocols were approved by the Ethics Committee for the Use of Experimental Animals at Binzhou Medical University (Binzhou, China). All the procedures were performed with utmost caution to minimize animal suffering. All the rats were randomly divided into four groups: Blank (n=10), ESTG (n=10), sham-operated (SO; n=10) and TSC groups (n=10).

Experimental protocols
ESTG

The rats in the ESTG model group were anesthetized with 10% chloral hydrate [4 ml/kg, intraperitoneal injection (i.p.)] and placed in a stereotaxic frame (ZH-B; Zhenghua Biological Instrument Co., Ltd., Huaibei, China). The calvarium was exposed through a midline incision. A hole was made with a cranial drill 3.2–3.4 mm posteriorly to and 2.8–3.2 mm laterally from the bregma. A disposable concentric needle electrode (DCN37; Alpine Biomed Corp., Fountain Valley, CA, USA) was lowered into the right TG (at a depth of ~9.2 mm from the dura mater). TG was electrically stimulated for 30 min with square pulses at 10 Hz and 0.5 mA, with a pulse duration of 5 msec. Correct electrode placement of the electrode needle was confirmed through ipsilateral contraction of the masseter muscle during stimulation.

The rats in the SO group underwent a surgical procedure similar to that performed in the rats of the ESTG group. However, the concentric bipolar electrode was only lowered into the right TG and was maintained for only 30 min. The TG was not electrically stimulated.

Drug administration

The rats in the TSC group received intragastric administration of TSC (Jiangsu Kangyuan Pharmaceutical, Jiangsu, China), which was dissolved in saline at a dose of 3.5 mg/kg/day for 7 days. Subsequently, the rats were anesthetized with 10% chloral hydrate (4 ml/kg; i.p.) and subjected to ESTG 30 min after the last drug administration.

All the rats were sacrificed after 30 min of stimulation. The trigeminal nucleus caudalis (TNC) and ipsilateral TG were immediately removed and stored at −80°C for western blot analysis or reverse transcription-quantitative polymerase chain reaction (RT-qPCR).

RT-qPCR

The TG and TNC of mice were rapidly isolated for total RNA preparation as described in the previous section. Total RNA (1 µg) was reverse transcribed in a 25-µl reaction volume using Premix Ex Tap II (Takara Bio, Shiga, Japan). PCR amplifications and fluorescence detections were performed using the CFX96™ RT-PCR detection system C1000 according to the manufacturer's protocol. The PCR conditions were as follows: 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 30 sec. A relative quantity of each sample was calculated using the 2−ΔΔCt method. Nucleotide sequences of the specific primers for the selected genes were as follows: β-actin (forward, AGAGCTATGAGCTGCCTGACG and reverse, CTTCTGCATCCTGTCAGCGAATGC); CGRP (forward, TCCTGGTTGTCAGCATCTTG and reverse, CTCAGCCTCCTGTTCCTCCT); A1R (forward, GGCCACAGACCTACTTCCAC and reverse, ACCGGAGAGGGATCTTGACT); and A2aR (forward, GTCCTCACGCAGAGTTCCAT and reverse, CAC CTG TCA CCA AGC CAT T).

Western blot analysis

The tissues were lyzed in lysis buffer (Beyotime Biotechnology, Shanghai, China) that contained freshly added protease inhibitor. Equivalent amounts of protein lysates and loading buffer were loaded on 7.5/12.5% polyacrylamide gels, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and subsequently electrophoretically transferred onto PVDF membranes. These membranes were blocked with 5% non-fat milk in Tris-buffered saline + 0.1% Tween-20 buffer at room temperature for 1 h and incubated overnight at 4°C with the following primary antibodies: Rabbit polyclonal anti-CGRP (1:500; cat. no. ab47027), rabbit polyclonal anti-adenosine receptor A2a (1:1,000; cat. no. ab3461), rabbit polyclonal anti-adenosine receptor A1 (1:500; cat. no. ab82477) (all from Abcam, Shanghai, China) and β-actin (1:1,000; cat. no. AA128; Beyotime Biotechnology). The membranes were incubated with the corresponding horseradish peroxidase-conjugated secondary antibody at room temperature for 1 h, and the proteins were visualized using an electrochemiluminescence kit (1:5,000; cat. no. A0208; both from Beyotime Biotechnology).

Statistical analysis

All the values are presented as the mean ± standard deviation. Independent Student's t-test was used to compare the data from two groups. One-way analysis of variance followed by Tukey's post-hoc test was applied when more than two groups of data were compared. P<0.05 was considered to indicate a statistically significant difference. SPSS 16.0 software (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis.

Results

Effect of electrical stimulation on CGRP, A1R and A2aR expression in the TG and TNC

According to the western blot analysis and RT-qPCR results, electrical stimulation significantly increased CGRP and A2aR expression in the TNC and ipsilateral TG compared with the blank groups and SO groups (P<0.05) (Figs. 1 and 2). Electrical stimulation also significantly decreased A1R expression in the TNC and ipsilateral TG compared with the blank groups and SO groups (P<0.05) (Figs. 1 and 2), in which no differences were detected.

Figure 1.

Results of RT-qPCR analysis. A relative quantity of each sample was calculated using the 2−ΔΔCt method. (A) RT-qPCR analysis of CGRP, A2aR and A1R mRNA expression levels in ipsilateral TG. No significant differences in the three genes expression were observed between the blank and SO groups, while electrical stimulation significantly increased CGRP and A2aR mRNA expression in ipsilateral TG compared with the blank and SO groups. Electrical stimulation also significantly decreased A1R mRNA expression in ipsilateral TG compared with the blank and SO groups. (B) RT-qPCR analysis of CGRP, A2aR and A1R mRNA expression in the TNC. No significant differences in the three gene expressions were observed between the blank and SO groups, while electrical stimulation significantly increased CGRP and A2aR mRNA expression in the TNC compared with the blank and SO groups. Electrical stimulation also significantly decreased A1R mRNA expression in the TNC compared with the blank and SO groups. *P<0.05 compared with the blank and SO group. RT-qPCT, reverse transcription-quantitative polymerase chain reaction; CGRP, calcitonin gene-related peptide; A2aR, adenosine A2a receptor; A1R, adenosine A1 receptor; TG, trigeminal ganglion; TNC, trigeminal nucleus caudalis; SO, sham-operated.

Figure 2.

(A) Representative images of CGRP, A2aR and A1R expression in ipsilateral TG. (B) Western blot analysis of the expression of CGRP, A2aR and A1R in ipsilateral TG. No significant differences in the the three proteins expression were observed between the (a) blank groups and the (b) TSC groups, while pretreatment with TSC significantly decreased CGRP and A2aR expression in ipsilateral TG compared with the (c) ESTG groups. TSC significantly increased A1R expression compared with the ESTG groups. (C) Representative images of CGRP, A2aR and A1R expression in the TNC. (D) Western blot analysis of the expression of CGRP, A2aR and A1R in the TNC. No significant differences in the three proteins expression levels were observed between the blank and the TSC groups, while pretreatment with TSC significantly decreased CGRP and A2aR expression in the TNC compared with the ESTG groups. TSC significantly increased A1R expression compared with the ESTG groups. *P<0.05 compared with the blank and TSC groups. CGRP, calcitonin gene-related peptide; A2aR, adenosine A2a receptor; A1R, adenosine A1 receptor; TG, trigeminal ganglion; TNC, trigeminal nucleus caudalis; TSC, Tianshu capsule.

Effect of pretreatment with TSC on CGRP, A1R and A2aR expression in the TG and TNC. According to the western blot results, TSC pretreatment with TSC significantly decreased CGRP and A2aR expression in the TNC and ipsilateral TG compared with the ESTG group (P<0.05) (Fig. 2). TSC significantly increased A1R expression compared with the ESTG group (P<0.05) (Fig. 2). No differences were detected between the blank and TSC groups.

Discussion

Trigeminovascular theory is currently dominating the pathogenesis of migraine. This theory suggests that the activation of the trigeminovascular system (TVS) results in increased CGRP release that causes neurogenic inflammation, which is characterized by meningeal vascular expansion, plasma protein leakage and mast cell degranulation (11). Neurogenic inflammation is an important part of the pathogenesis of migraine. CGRP is essential vasoactive compound that cause neurogenic inflammation. Studies have identified that the CGRP expression levels in the external jugular vein, cubital vein and cerebrospinal fluid were significantly higher in patients with migraines compared to those in the healthy controls, and CGRP content is greater in the external jugular vein than that in the cubital vein (12). These results suggest that trigeminal nerve endings, which dominate the cerebravl blood wall, can release CGRP. Further research has found that CGRP nerve fibers dominating cerebrovascular are mainly from the TG (13). The present study showed that the expression levels of CGRP protein and CGRP mRNA in TG were higher in the migraine model rats compared to the in normal rats, further suggesting that the elevated CGRP levels during migraine attacks may be the result of CGRP release from the TG neuron. The results also showed that the ESTG model rats can stimulate TVS activation during a migraine attack.

TNC includes secondary neurons that are responsible for integrating the nociceptive information from the TG neurons. TNC and TG activities reflect the activation of trigeminal nerve nociceptive pathway in the central nervous system. TNC is a key component of pain transmission process. CGRP may be involved in the neuron activity adjustment (14). The present study identified that the CGRP protein and mRNA levels in TNC were higher in the ESTG model rats than those in normal rats. This finding suggests that CGRP is important in migraine transmission.

Adenosine, a strong vasoactive compound, and its receptors have an important role in pain transmission and information regulation. Adenosine injection in the vein, spine and intraventricular area has an analgesic effect (15–17). Numerous animal experiments (18–20) showed that A1 receptor activation can have a role in pathological neuralgia, inflammation and pain in animal models. Other studies showed that selective A1R agonists can inhibit neurogenic vasodilation and CGRP release, thereby inhibiting migraine generation and transfer (21). Combined with the experimental results, the A1R expression in TNC and TG in migraine model rats was lower than that in normal rats. This result suggests that decreased expression of A1R has an important role in the pathogenesis of migraine, whereas activation or increased expression of adenosine A1R may suppress the occurrence of migraines.

A2aR is widely distributed in the central nervous system and mediates the pathophysiology of numerous diseases, such as neuronal protection, stroke, pain and neurodegenerative disease, through interaction with other important receptors (22–24). Adenosine can directly stimulate the nociceptive nerve through A2aR and A2aR-knockout mice have a high pain threshold (25). The present study found that the A2aR expression in TG and TNC of the ESTG group was higher than that of the blank control group, which was similar with CGRP expression. This result suggests that CGRP and A2aR may cause migraine and pain transmission when combined. In addition, a previous study showed that CGRP cannot affect synaptic transmission in the brain neurons but can enhance excitatory synapse potential depending on A2aR activation and A1R inhibition (26). Another study revealed that A2aR activation can inhibit A1R, suggesting that transmission of migraine information requires multiple neurotransmitter interactions (27).

TSC is a modern Chinese medicine that consists of Chuanxiong and Tianma. TSC can promote blood circulation to remove blood stasis and activate meridians to alleviate pain. This Chinese medicine is mainly used for migraine treatment and has a beneficial effect; however, the underlying mechanism remains to be elucidated. The experiments showed that the CGRP, A1R and A2aR expression in the TSC intervention group did not significantly differ with that in the blank group, whereas no significant differences were found between the ESTG and TSC groups, suggesting that TSC can improve the levels of the three proteins involved in the pathogenesis of migraine for relief. Other studies showed that TSC can adjust the expression of vasoactive compounds, such as nitric oxide, CGRP and neurotransmitters, including serotonin, during migraine attacks, thereby relieving migraine symptoms (28,29). In conclusion, TSC can adjust to a variety of vasoactive compounds and neurotransmitters involved in the pathogenesis of migraines, thereby affecting the onset and progression of migraine.

The CGRP, A2aR and A1R expression in TG and TNC significantly changed the migraine rats more than the normal rats. CGRP not only had an important role in neurogenic inflammation, but may also have mediated migraine pain information with adenosine. TSC can adjust the expression of these three proteins, thereby providing a new experimental basis and targets for the pathogenesis and treatment of migraines. However, the interaction mechanisms of CGRP, A1R and A2aR in the pathogenesis of migraines require further study.

Acknowledgements

The present study was supported by the Science and Technology Project in Shandong Province (project no. J12LL63).

References

1 

Goadsby PJ: Recent advances in understanding migraine mechanisms, molecules and therapeutics. Trends Mol Med. 13:39–44. 2007. View Article : Google Scholar : PubMed/NCBI

2 

Noseda R and Burstein R: Migraine pathophysiology: Anatomy of the trigeminovascular pathway and associated neurological symptoms, cortical spreading depression, sensitization, and modulation of pain. Pain. 154(Suppl 1): S44–S53. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Ho TW, Edvinsson L and Goadsby PJ: CGRP and its receptors provide new insights into migraine pathophysiology. Nat Rev Neurol. 6:573–582. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Russo AF: Calcitonin gene-related peptide (CGRP): A new target for migraine. Annu Rev Pharmacol Toxicol. 55:533–552. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Villalón CM and Olesen J: The role of CGRP in the pathophysiology of migraine and efficacy of CGRP receptor antagonists as acute antimigraine drugs. Pharmacol Ther. 124:309–323. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Goadsby PJ, Edvinsson L and Ekman R: Release of vasoactive peptides in the extracerebral circulation of humans and the cat during activation of the trigeminovascular system. Ann Neurol. 23:193–196. 1988. View Article : Google Scholar : PubMed/NCBI

7 

Goadsby PJ: New targets in the acute treatment of headache. Curr Opin Neurol. 18:283–288. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Goadsby PJ: Post-triptan era for the treatment of acute migraine. Curr Pain Headache Rep. 8:393–398. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Fredholm BB, IJzerman AP, Jacobson KA, Klotz KN and Linden J: International Union of Pharmacology. XXV. Nomenclature and classification of adenosine receptors. Pharmacol Rev. 53:527–552. 2001.PubMed/NCBI

10 

Gao H, Yu Z, Ma K and Han G: Tianshu capsule for migraine: A systemic review. Chin Tradit Pat Med. 36:1156–1160. 2014.

11 

Messlinger K: Migraine: Where and how does the pain originate? Exp Brain Res. 196:179–193. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Moreno MJ, Abounader R, Hébert E, Doods H and Hamel E: Efficacy of the non-peptide CGRP receptor antagonist BIBN4096BS in blocking CGRP-induced dilations in human and bovine cerebral arteries: Potential implications in acute migraine treatment. Neuropharmacology. 42:568–576. 2002. View Article : Google Scholar : PubMed/NCBI

13 

Gibson SJ, Polak JM, Bloom SR, Sabate IM, Mulderry PM, Ghatei MA, McGregor GP, Morrison JF, Kelly JS, Evans RM, et al: Calcitonin gene-related peptide immunoreactivity in the spinal cord of man and of eight other species. J Neurosci. 4:3101–3111. 1984.PubMed/NCBI

14 

Fischer MJ, Koulchitsky S and Messlinger K: The nonpeptide calcitonin gene-related peptide receptor antagonist BIBN4096BS lowers the activity of neurons with meningeal input in the rat spinal trigeminal nucleus. J Neurosci. 25:5877–5883. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Sjölund KF, Belfrage M, Karlsten R, Segerdahl M, Arnér S, Gordh T and Solevi A: Systemic adenosine infusion reduces the area of tactile allodynia in neuropathic pain following peripheral nerve injury: A multi-centre, placebo-controlled study. Eur J Pain. 5:199–207. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Poon A and Sawynok J: Antinociception by adenosine analogs and inhibitors of adenosine metabolism in an inflammatory thermal hyperalgesia model in the rat. Pain. 74:235–245. 1998. View Article : Google Scholar : PubMed/NCBI

17 

Ma HC, Wang YF, Feng CS, Zhao H and Dohi S: Effects of adenosine agonist R-phenylisopropyl-adenosine on halothane anesthesia and antinociception in rats. Acta Pharmacol Sin. 26:181–185. 2005. View Article : Google Scholar : PubMed/NCBI

18 

Lavand'homme PM and Eisenach JC: Exogenous and endogenous adenosine enhance the spinal antiallodynic effects of morphine in a rat model of neuropathic pain. Pain. 80:31–36. 1999. View Article : Google Scholar : PubMed/NCBI

19 

Maione S, de Novellis V, Cappellacci L, Palazzo E, Vita D, Luongo L, Stella L, Franchetti P, Marabese I, Rossi F, et al: The antinociceptive effect of 2-chloro-2-C-methyl-N6-cyclopentyladenosine (2-Me-CCPA), a highly selective adenosine A1 receptor agonist, in the rat. Pain. 131:281–292. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Sjölund KF, Sollevi A, Segerdahl M, Hansson P and Lundeberg T: Intrathecal and systemic R-phenylisopropyl-adenosine reduces scratching behaviour in a rat mononeuropathy model. Neuroreport. 7:1856–1860. 1996. View Article : Google Scholar : PubMed/NCBI

21 

Goadsby PJ, Hoskin KL, Storer RJ, Edvinsson L and Connor HE: Adenosine A1 receptor agonists inhibit trigeminovascular nociceptive transmission. Brain. 125:1392–1401. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Chen JF, Sonsalla PK, Pedata F, Melani A, Domenici MR, Popoli P, Geiger J, Lopes LV and de Mendonça A: Adenosine A2A receptors and brain injury: Broad spectrum of neuroprotection, multifaceted actions and ‘fine tuning’ modulation. Prog Neurobiol. 83:310–331. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Takahashi RN, Pamplona FA and Prediger RD: Adenosine receptor antagonists for cognitive dysfunction: A review of animal studies. Front Biosci. 13:2614–2632. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Moro S, Gao ZG, Jacobson KA and Spalluto G: Progress in the pursuit of therapeutic adenosine receptor antagonists. Med Res Rev. 26:131–159. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Ledent C, Vaugeois JM, Schiffmann SN, Pedrazzini T, El Yacoubi M, Vanderhaeghen JJ, Costentin J, Heath JK, Vassart G and Parmentier M: Aggressiveness, hypoalgesia and high blood pressure in mice lacking the adenosine A2a receptor. Nature. 388:674–678. 1997. View Article : Google Scholar : PubMed/NCBI

26 

Sebastião AM, Macedo MP and Ribeiro JA: Tonic activation of A(2A) adenosine receptors unmasks, and of A(1) receptors prevents, a facilitatory action of calcitonin gene-related peptide in the rat hippocampus. Br J Pharmacol. 129:374–380. 2000. View Article : Google Scholar : PubMed/NCBI

27 

Cunha-Reis D, Ribeiro JA and Sebastião AM: A1 and A2A receptor activation by endogenous adenosine is required for VIP enhancement of K+-evoked [3H]-GABA release from rat hippocampal nerve terminals. Neurosci Lett. 430:207–212. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Zhang Q, Yang T, Zhou M and Zhou D: Effects of Tianshu capsule on plasma NO, NOS, CGRP contents and hemodynamic of migraine animal models. J Clin Neurol. 21:279–282. 2008.

29 

Tianhua YZ, Zhou M, Liu Y and Zhou D: Effect of Tianshu capsule on the plasma levels of β-endorphin and 5-Hydroxytryptamine and c-fos expression of brain tissue in migraine rats. J Clin Neurol. 21:368–370. 2008.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lu W, Li B, Chen J, Su Y, Dong X, Su X and Gao L: Expression of calcitonin gene‑related peptide, adenosine A2a receptor and adenosine A1 receptor in experiment rat migraine models. Biomed Rep 4: 379-383, 2016.
APA
Lu, W., Li, B., Chen, J., Su, Y., Dong, X., Su, X., & Gao, L. (2016). Expression of calcitonin gene‑related peptide, adenosine A2a receptor and adenosine A1 receptor in experiment rat migraine models. Biomedical Reports, 4, 379-383. https://doi.org/10.3892/br.2016.591
MLA
Lu, W., Li, B., Chen, J., Su, Y., Dong, X., Su, X., Gao, L."Expression of calcitonin gene‑related peptide, adenosine A2a receptor and adenosine A1 receptor in experiment rat migraine models". Biomedical Reports 4.3 (2016): 379-383.
Chicago
Lu, W., Li, B., Chen, J., Su, Y., Dong, X., Su, X., Gao, L."Expression of calcitonin gene‑related peptide, adenosine A2a receptor and adenosine A1 receptor in experiment rat migraine models". Biomedical Reports 4, no. 3 (2016): 379-383. https://doi.org/10.3892/br.2016.591
Copy and paste a formatted citation
x
Spandidos Publications style
Lu W, Li B, Chen J, Su Y, Dong X, Su X and Gao L: Expression of calcitonin gene‑related peptide, adenosine A2a receptor and adenosine A1 receptor in experiment rat migraine models. Biomed Rep 4: 379-383, 2016.
APA
Lu, W., Li, B., Chen, J., Su, Y., Dong, X., Su, X., & Gao, L. (2016). Expression of calcitonin gene‑related peptide, adenosine A2a receptor and adenosine A1 receptor in experiment rat migraine models. Biomedical Reports, 4, 379-383. https://doi.org/10.3892/br.2016.591
MLA
Lu, W., Li, B., Chen, J., Su, Y., Dong, X., Su, X., Gao, L."Expression of calcitonin gene‑related peptide, adenosine A2a receptor and adenosine A1 receptor in experiment rat migraine models". Biomedical Reports 4.3 (2016): 379-383.
Chicago
Lu, W., Li, B., Chen, J., Su, Y., Dong, X., Su, X., Gao, L."Expression of calcitonin gene‑related peptide, adenosine A2a receptor and adenosine A1 receptor in experiment rat migraine models". Biomedical Reports 4, no. 3 (2016): 379-383. https://doi.org/10.3892/br.2016.591
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team