This article is mentioned in:

Introduction

Paraoxonase 2 (PON2) is a member of the PON gene family located on chromosome 7q21.3, which also includes the homologous genes for PON1 and PON3 (1,2). In contrast to PON1, which is mainly expressed in the liver, PON2 is expressed in a variety of tissues. It is known that PON1 has been shown to have antioxidant properties (3). However, the function of ubiquitously expressed PON2 remains to be elucidated (1).

A G/C single-nucleotide polymorphism (SNP) rs12026 in exon 5 of the PON2 gene introduces the coding variant of alanine/glycine at position 148 (PON2-148). There have been associating variants of rs12026 within the PON2 gene with cardiovascular disease (4–6), cerebrovascular disease (7), diabetes (8,9) and other diseases (10). For this SNP detection, several assays have been suggested, such as the fluorescently labeled probes technique (11), dynamic allele-specific hybridization technique (7), TaqMan assay (5) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) (6). Among them, PCR-RFLP is the most frequently used technique due to its high sensitivity and reliability. However, the current PCR-RFLP assay is facing practical challenges and is not suitable for high throughput screening. The present study demonstrated an improved PCR-RFLP assay for the detection of a polymorphism of the PON2 gene.

Materials and methods

Primer design

The information regarding the PON2 gene and polymorphism rs12026 was obtained from the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov). The method of the amplification-created restriction site was used to introduce a new enzyme site to recognize the variant.

The sequences of the primer pair were designed by primer premier 5.0 software as follows: Forward, 5′ AGGTCCCGTAGTTATGTCTTGT 3′; and reverse, 5′ TCAGATGCAACAGAGAATTGTCT 3′.

The natural occurring DNA sequences according with positions of primers were: AGGTCCCGTAGTTATGTCTTGT aaattaactctgttctttcaattctttagatgacacagtttatctctttgttgtaaaccaccc agaattcaagaatacagtggaaatttttaaatttgaagaagSAGAAAATTCTCTGTTGCATCTGA. Capital bases A, C, G and T represent the sequences according to the positions of primers, and S represents the position for the polymorphism G/C. The length of the base sequences was 150 base pairs (bp). The natural occurring ‘T’ nucleotide that matches with A (underlined) in the DNA sequences was substituted by a ‘G’ in the reverse primer (underlined) in order to introduce a recognized site for the BsmAI restriction endonuclease.

Genotype of DNA

Genomic DNA was extracted from the peripheral blood leukocytes of 302 Chinese Han individuals followed by standard procedures. The research objects were obtained from one enterprise in Zhengzhou in 2014. The study protocol was approved by the Ethics Committee of the University of Zhengzhou (Zhengzhou, Henan, China). The PCR was performed in a volume of 25 µl containing 100 ng of genomic DNA, 1X PCR Master mix (Tiangen, Beijing, China) and 5 pmol of each primer. The DNA was denatured at 95°C for 3 min, and temperature cycles were set at 95°C for 30 sec, 56°C for 30 sec and 72°C for 30 sec for 30 cycles, followed by a final extension at 72°C for 10 min. PCR products underwent electrophoresis on 3% agarose gels and were stained with ethidium bromide and exposed to ultraviolet illumination.

Enzyme digestion was conducted in a 20 µl final volume using 5 units of BsmAI enzyme (New England Biolabs, Ipswich, MA, USA) and 10 µl of the PCR product. The reaction was conducted at 37°C overnight. The digested products were visualized on 3% agarose gels stained with ethidium bromide.

Statistical analysis

The basic data were analyzed using SPSS 21.0 software (IBM, Corp., Armonk, NY, USA). Methods of representation and examination were based on the distribution of quantitative data. All the statistical tests were two-sided, and P<0.05 was considered to indicate a statistically significant difference.

Results

Polymorphisms of PON2

Based on the PCR designed with the mismatched primers, the PON2 polymorphisms could be identified simultaneously. The PCR products that were separated on 3% agarose gel are shown in Fig. 1 (BsmAI PCR-RFLP analysis of the PON2 biallelic polymorphism). From the gel, that the PCR amplification yielded a product of 150 bp. Following incubation with BsmAI, the individual homozygous for the C allele yielded one uncut band (150 bp). The homozygous G allele yielded two bands of 121 and 29 bp.

Figure 1. BsmAI polymerase chain reaction-restriction fragment length polymorphism analysis of the PON2 biallelic polymorphism, M, DNA ladder; lanes 1 and 4, CC; lane 2, CG; lane 3, GG. PON2, paraoxonase 2; bp, base pair.

Polymorphisms of PON2 were detected in 302 Chinese Han individuals. The genotype frequencies were 68.9% for CC, 29.8% for CG and 1.3% for GG. The allelic frequencies were 83.8% for C and 16.2% for G. The PCR results were confirmed by DNA sequencing. The χ2 test showed that the genotype and allele frequencies of PON2-148 do not deviate from Hardy-Weinberg equilibrium (χ2=2.80, P>0.05).

Examples of DNA sequencing of the PCR product of the PON2 gene are shown in Fig. 2. As expected, the sequences of the amplified products were consistent with the one published in Genbank (NM_000446), with the exception of the mismatched base.

Figure 2. Examples of DNA sequencing of the polymerase chain reaction product of the PON2 gene. (A and C) The BsmAI recognition site (GAGAC) is indicated by a mark symbol, and the vertical arrow corresponds to the mismatched base. Three figures represent the genotype of (A) GC, (B) CC and (C) GG are shown, and the bases (G and C) representing the polymorphism sites are in the squares. PON2, paraoxonase 2.

The BsmAI recognition site (GAGAC) is indicated by a marked symbol in Fig. 2A and C, and the vertical arrow corresponds to the mismatched base. The genotypes of GC, CC and GG are shown in Fig. 2, respectively, and the bases representing the polymorphism sites are denoted in squares.

Discussion

The commonly used detection methods for SNP analysis include DNA sequencing, TaqMan assay, fluorescently labeled probes, molecular beacons and PCR-RFLP. DNA sequencing is an accurate method for genotyping; however, it is labor-intensive and not suitable for high-throughput analysis. The most prominent advantage for the TaqMan probe technique is that it does not require a PCR post-treatment process, such as separation or elution, which improves the detection rate. To ensure accurate classification is difficult, as the probe must be designed and can be expensive (12). Molecular beacons are marked by fluorescent dyes of different colors to achieve the simultaneous detection of multiple SNPs. However, dyes are less for the suitable fluorescent dye-labeled, which significantly limits the detection of flux. In addition, a fluorescent molecular beacon probe must be designed and these are expensive (13). The abovementioned methods do have their own advantages; however, the equipment used is expensive and the experiment methods are complex, therefore, they are difficult to popularize and apply for SNP detection. The PCR-RFLP technique is widely used in the detection of SNP as the detection method is simple, and it has a high sensitivity and reliability. However, certain assays can be employed to detect rs12026 polymorphism of PON2 using common equipment. The PCR-RFLP method has been used since 1997 (14), but the BsoFI enzyme or its isoschizomers required are expensive. In order to overcome this, PCR-RFLP with mismatched primers and the inexpensive HinfI enzyme was developed to detect rs12026 (15). However, the polyacrylamide gel electrophoresis in this developed method was inconvenient compared with the agarose gel electrophoresis. The present study introduced the inexpensive BsmAI enzyme and fast agarose gel electrophoresis to detect PON2 polymorphism rs12026 using the PCR-RFLP method. In conclusion, a simple and economical technique for analysis of the PON2 polymorphism rs12026 was reported. This may be used widely in the future study of the genetics of diseases, including cardiovascular disease, cerebrovascular disease and diabetes.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant nos. NSFC81001239 and 30972457).

References