Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
November-2016 Volume 5 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2016 Volume 5 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effect of dehydration heat exposure on thoracic aorta reactivity in rats

  • Authors:
    • Yao Geng
    • Lingqin Zhu
    • Fadong Liu
    • Xiaodan Zhu
    • Jianguo Niu
    • Guanghua Li
  • View Affiliations / Copyright

    Affiliations: Department of Physiology, School of Basic Medical Science, Ningxia Medical University, Yinchuan, Ningxia 750004, P.R. China, Ningxia Key Laboratory of Cranial Cerebral Diseases, Yinchuan, Ningxia 750004, P.R. China
  • Pages: 613-617
    |
    Published online on: September 21, 2016
       https://doi.org/10.3892/br.2016.760
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to investigate the effect of one week dehydration heat exposure on thoracic aorta reactivity in rats. Eighteen Male Sprague‑Dawley rats were randomly divided into 3 groups (n=6 each group): Control group (CN), heat exposure group (HE), dehydration heat exposure group (DHE). The CN group was exposed to a room temperature of 24˚C, while the HE and DHE groups were exposed to a heat temperature of 32˚C. After 7 days of heat exposure, the heart rate and blood pressure of the rats were measured, and the noradrenaline (NA)‑induced contraction on the aorta rings was measured by tension recording. The average contents of malondialdehyde (MDA) and superoxide dismutase (SOD) in serum were detected using ELISA. The expression of apoptotic genes in the thoracic aorta was measured using RT‑PCR. Compared with CN, the heart rate in the HE and DHE groups had a tendency to become retarded, but there was no significant difference (P>0.05). In the HE group, the systolic blood pressure (SBP), diastolic blood pressure (DBP) and mean arterial pressure (MAP) of the rats were significantly higher than that of the CN (P<0.05). In the DHE group, the SBP of rats was significantly higher than that of the CN (P<0.05), while the SBP, DBP, and MAP of the rats were decreased compared to the rats in the HE group, although there was no statistical significance (P>0.05). In the HE and DHE groups, the NA‑induced contraction on the rats thoracic aorta ring was larger than that of the CN (P<0.05), albeit there was no significant difference between the HE and DHE groups (P>0.05). The serum SOD content decreased in the HE and DHE groups, however, the reduction was significant only in the DHE group (P<0.05). The content of MDA in serum was significantly increased in the DHE group (P<0.05). The expression of BAX was significantly upregulated whereas Bcl2 expression was decreased in the DHE group (P<0.05). The results showed that a high temperature was harmful to the body, especially in the case of lack of food and water. Additionally, the heat exposure elevated blood pressure, and increased arterial reactivity, which were related to the elevated production of MDA, led to the impaired production of SOD, and an increase of cell apoptosis. These findings are useful to understand the influence of dehydrated heat exposure on the vascular function, and they provide certain theoretical and experimental guidance for protection under high temperature.

Introduction

High temperature has a severe influence on an individual's work, life and body, and it is easy for the individual to become exhausted, irritable and exasperation. A high temperature constitutes a risk factor for the occurrence of cerebrovascular, heart and respiratory diseases; consequently, the death rate increases correspondingly, particularly among the elderly (1–3). At present, the effect of a high temperature especially the dehydration of thermal on the physiological function of human, is lacking in terms of comprehensive knowledge and understanding.

On the basis of heat stress, if the water intake is stopped, the extracellular fluid is reduced more rapidly and becomes DHE (4). For some workers such as firefighters, the damage caused by high temperature is inevitable. Recent findings have shown that dehydrated heat exposure elevated blood pressure over a long period of time increased the viscera index of spleen, heart, thymus gland, hypothalamus and pituitary to alleviate the harmful effects of high temperature on the body (5). However, the physiopathological mechanism involved in dehydration heat exposure on the cardiovascular system remains unknown. Thus, the present study focused on whether the influence of dehydrated heat exposure on the function of thoracic aorta is useful to understand the altered function of blood vessels. This study discussed the influence of dehydrated heat exposure on the thoracic artery of rats by studying the blood pressure, arterial reactivity, superoxide dismutase (SOD) and malondialdehyde (MDA) serums and apoptotic function.

Materials and methods

Animals and heat exposure protocol

Eighteen male Sprague-Dawley rats, weighing 180–200 g, were purchased from the Laboratory Animal Center of Ningxia Medical University (Ningxia, China). The experimental procedures of the present study were approved by the Animal Ethics Committee of Ningxia Medical University and Use Committee, in accordance with the guidelines of the Council of the Physiological Society of China.

Eighteen rats were randomly divided into control group (CN), heat exposure group (HE) and dehydration heat exposure group (DEF) (n=6/group). Rats in the CN group were fed at room temperature (25±1°C) throughout the study and were provided with food and water ad libitum. Rats in the HE and DHE groups received a fixed 8 h (9:00–17:00) heat exposure process per day, and in the DHE group, the rats were fasted during the exposed time. Exposure was finished inside the artificial climate chamber with a temperature of 32°C (relative humidity of 60±5%), after exposure, and the rats were kept at room temperature (25±1°C). The heat exposure lasted for 7 days. Room temperature was 24.0±0.1°C and relative humidity was 54±5%. The behavior of the animals was observed in the process of the whole experiment.

Heart rate and blood pressure

Heart rate and blood pressure were collected using blood pressure monitor (BP-2010A; Softron Beijing Biotechnology Co., Ltd., Beijing, China), and the data were obtained directly from the machine. After the heat exposure, we measured the heart rate and blood pressure from the rat tail.

Thoracic aortia reactivity

After anesthesia, the chest of the rats was immediately opened, and the thoracic aorta was removed and placed in a paraffin plate filled with physiological saline. Connective tissues were excised carefully, and vascular rings were made (4–5 mm wide). The vascular ring was quickly hung in the organization bath systems with the presentation of 10 ml Krebs solution [ingredients (mmol/l): 5.6 glucose, 10 NaCl, 24.8 NaHCO3, 4.6 KCl, 2.5 CaCl2, as well as 1.2 MgSO4 and KH2PO4, respectively]. The system was perfuse with 5% CO2 and 95% O2 contiguously and maintained a constant temperature of 37°C. Resting tension was adjusted to 1 g, and the ring was balanced for 40 min with Krebs changed every 15 min. The maximal contraction was induced by the addition of 60 mM KCl. After resting tension was stabilized, the Krebs fluid was replaced and basal tension was returned to 1 g, and cumulative concentrations of norepinephrine (10−10-10−5 M) was added to the bath system. The rates of the vascular tension range induced by noradrenaline (NA) (10−10-10−5 M) were expressed as percentages of the maximum contraction tension range (100%) induced by KCl (60 mM).

Detection of the serum SOD and MDA

Blood was collected from the left atrium and centrifuged at 3,500 × g for 15 min and the serum was segregated for further detection. The serum SOD was detected using a commercially available sandwich ELISA kit (Chenglin Biotechnology, Beijing, China). The MDA was detected by TBA kit (Nanjing Jiancheng Bioengineering Research Institute, Jiangsu, China). All the detections were tested in accordance with the kit's specifications. Absorbance was read at 450 nm (Bio-Rad 680; Bio-Rad, Hercules, CA, USA). The quantity of SOD in the serum was estimated from a calibration curve.

Detection of Bcl-2 and BAX gene expression

Vascular thoracic aortas were quickly removed and placed into liquid nitrogen. Frozen samples were reserved at −80°C for further analysis. The thoracic aorta (50 mg) was homogenized using glass-Teflon®. Total RNA was prepared using TRIzol® Reagent (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. Complementary DNA (cDNA) was synthesized with a First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc., Beijing, China). RT-PCR was carried out using a Maxima SYBR-Green PCR kit (Thermo Fisher Scientific, Inc.) with indicated primers. After an initial 10 min at 95°C, the PCR program was finished as follows: 95°C for 15 sec, 60°C for 30 sec, and extension at 72°C for 30 sec, for 40 cycles. At the end of the reaction, melting curve analysis was performed to ensure the specificity of the reaction. β-actin was used as an internal control. Primers used for the PCR are shown in Table I.

Table I.

Sequence of oligonucleotide primers.

Table I.

Sequence of oligonucleotide primers.

GeneSequence (5′->3′)bpTm/°CGenBank
Bcl2Forward: AGCCTGAGAGCAACCGAAC15960NM_016993
Reverse: AGCGACGAGAGAAGTCATCC
BaxForward: TTGCTACAGGGTTTCATCCAG14560NM_017059
Reverse: TGTTGTTGTCCAGTTCATCG
β-actinForward: CACCCGCGAGTACAACCTTC20760NM_031144
Reverse: CCCATACCCACCATCACACC
Statistical analysis

Data were analyzed by SPSS, Inc. 21.0 (Chicago, IL, USA), and the results were presented as mean ± SD. Statistical difference was evaluated using the t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

Behavior observation in rats

Before heat exposure, all the rats had good appetite, activity and agile reaction. Their fur was tight, clean and smooth. The rats were restless in the evening. During thermal exposure, the rats' limbs, nasal and testicular filled with blood, which was more obvious in the DHE group. Concerning mental state, the rats were tired and listless. Their surface fur was damp, the response to external stimuli was significantly reduced, and the rats hid their body in bedding material.

Measurement of heart rate and blood pressure

Compared with CN, the heart rate in the HE and DHE groups was retarded, albeit there was no significant difference (P>0.05) (Fig. 1). In the HE group, SBP, DBP and the mean arterial pressure (MAP) of rats were significantly higher than the CN (P<0.05). In the DHE group, the SBP of rats was significantly higher than that of the CN (P<0.05), albeit SBP, DBP and MAP of rats were lower than the rats in the HE group, although there was no statistical significance (P>0.05) (Fig. 2).

Figure 1.

Effect of heat exposure on heart rate. Data are shown as mean ± SD, n=6. CN, control group; HE, heat exposure group; DHE, dehydration heat exposure.

Figure 2.

Effect of heat exposure on blood pressure. Data are shown as mean ± standard deviation, n=6. CN, control group; HE, heat exposure group; DHE, dehydration heat exposure. *P<0.05 compared with CN.

Thoracic aortia reactivity

In the CN and HE groups, NA induced a dose-dependent contraction on the aortic ring. However, the contractive response was stronger in the HE compared with the CN group (P<0.05), but there was no significant difference between the HE and DHE groups (P>0.05) (Fig. 3).

Figure 3.

Effect of heat exposure on thoracic aortic reactivity. Data are shown as mean ± standard deviation, n=6. CN, control group; HE, heat exposure group; DHE, dehydration heat exposure. *P<0.05 compared with CN.

Detection of the serum SOD and MDA

The serum SOD in the DHE group was lower than that of the CN group (P<0.05) (Fig. 4), the level of MDA was significantly higher than that of the CN group (P<0.05) (Fig. 5). Compared with the CN and DHE groups, the serum SOD and MDA in the HE group was fluctuated but no significant difference was observed (P>0.05).

Figure 4.

Effect of heat exposure on the level of SOD in serum of rats. Data are shown as mean ± SD, n=8. CN, control group; HE, heat exposure group; DHE, dehydration heat exposure; SOD, superoxide dismutase. *P<0.05 compared with CN.

Figure 5.

Effect of heat exposure on the level of MDA in serum of rats. Data are shown as mean ± standard deviation, n=8. CN, control group; HE, heat exposure group; DHE, dehydration heat exposure; MDA malondialdehyde. *P<0.05 compared with CN.

Detection of Bcl-2 and Bax

Compared with CN, the expression of Bcl2 was significantly reduced (P<0.05) in the DEF group, while the Bax expression was increased (P<0.05). Compared with teh CN and DHE groups, the expression of Bcl2 and Bax in the HE group had no significant difference (P>0.05) (Fig. 6).

Figure 6.

Effect of heat exposure on the expression of Bcl-2 and Bax. Data are shown as mean ± standard deviation, n=8. CN, control group; HE, heat exposure group; DHE, dehydration heat exposure. *P<0.05 compared with CN.

Discussion

The present study has demonstrated that heat stress without food and water changed the rats' existence, increased blood pressure and damaged blood vessel function.

Living or working in a high temperature environment leads to not adapting to adverse reactions (6). Consequently, a lack of food and water reduces an individual's ability to survive. In a high temperature environment, the evaporation of the skin becomes the main way of cooling the body, but the high humidity limits the evaporation of perspiration. Under water shortage conditions, excessive loss of perspiration may damage the body's cardiovascular and thermoregulatory function (7–9). In response to the high temperature, the human body needs heat dissipation and expansion of body surface blood vessels, the amount of blood in the body surface increases, and the amount of blood supply for heart, cerebrovascular is relatively reduced, leading to cerebral ischemic and hypoxic reactions (10,11). The experiment results showed that, with the increase of heat exposure intensity, the rat heart rate had a tendency to slow down. Overton et al found that hunger and high temperature were able to reduce the heart and metabolic rate (12). The study by Williams et al showed hunger and high temperature were associated with the gradual reduction of activity (13). These indicated that, under the condition of hunger and high temperature, the rats could reduce heat production by decreasing movement and the metabolic rate. In the HE group, SBP, DBP, MAP were significantly higher than that of CN. The SBP of the rats in the DHE group was significantly higher than that of the CN. These results showed that high temperature increased blood pressure.

Vascular reactivity is a basic and direct index that reflects the state of the artery blood vessel function (14). Enhanced contractive function is the main performance of damaged blood vessels (15,16). The experiment results showed that the thoracic aorta reactivity in the HE and DHE groups was higher than that of the CN group. The environment of high temperature is harmful to blood vessels. However, it is difficult to find vascular injury; we investigated blood vessel function and attempted to identify the mechanism underlying vascular injury.

SOD is an important enzyme, which removes superoxide free radical from aerobic organisms and defense against the toxic effect of the oxygen-free radicals (17,18). MDA is the oxidative product of polyunsaturated fat in biological membrane (19). Its level can reflect the degree of lipid peroxidation and free radicals attacking the body's cells. In this experiment, SOD decreased significantly whereas the MDA level was increased in the the DHE group. This result suggested that high temperature without food and water caused increase of endogenous oxygen free radicals. Therefore, enhanced oxidative stress damaged the vascular elasticity.

Cell apoptosis was induced by stress, such as free radicals, hypoxia and blood deficiency (20,21). The present study focused on the function of Bcl2 and Bax in the regulation of apoptosis. In the process of cell apoptosis, members of the Bcl-2 family play a vital role. They have high homology, and share the conserved domain of BH1, BH2, BH3 and BH4. The Bcl2 family can be divided into two categories, one of which is anti-apoptotic, mainly containing Bcl2, Bcl-XL, Bcl-W, Mcl-1 and CED9. The other type promotes cell death, and mainly includes Bax, Bak, Bcl-XS, Bad, Bik and Bid. Increased Bax promotes cell apoptosis, whereas increased Bcl2 inhibits cell apoptosis (22). In this experiment, the expression of Bcl2 was significantly reduced in the DHE group, while Bax was increased. The present study has demonstrated that under the condition of dehydration heat exposure, the expression of Bax was markedly elevated, whereas Bcl2 was reduced. These results suggested that the cell apoptotic process was initiated by the heated environment, resulted in the altered organizational structure and affected the function of blood vessels.

The results of the present study show that a high temperature was harmful to the body, where particularly in the case of lack of food and water, the heat exposure elevated blood pressure, increased arterial reactivity, which was related to the elevated production of MDA, the impaired production of SOD, and the increase of cell apoptosis. These findings are useful in gaining a better understanding of the influence of dehydrated heat exposure on vascular function, and provide certain theoretical and experimental guidance for protection under high temperature.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (no. 81560052).

References

1 

Crandall CG and González-Alonso J: Cardiovascular function in the heat-stressed human. Acta Physiol (Oxf). 199:407–423. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Green RS, Basu R, Malig B, Broadwin R, Kim JJ and Ostro B: The effect of temperature on hospital admissions in nine California counties. Int J Public Health. 55:113–121. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Knowlton K, Rotkin-Ellman M, King G, Margolis HG, Smith D, Solomon G, Trent R and English P: The 2006 California heat wave: Impacts on hospitalizations and emergency department visits. Environ Health Perspect. 117:61–67. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Cheuvront SN, Kenefick RW, Montain SJ and Sawka MN: Mechanisms of aerobic performance impairment with heat stress and dehydration. J Appl Physiol. 109:1989–1995. 1985. View Article : Google Scholar

5 

Υang M, Zhao N, Luo Y, Ding J, Nie L-H, Dong J-W and Li G-H: Effects of dehydration heat exposure on weight of stress organ and IgG, IL- 2, IL-6 and intervention of LBP in rats. Lishizhen Medicine and Materia Medica Research. 7:1761–1764. 2014.

6 

Miescher E and Fortney SM: Responses to dehydration and rehydration during heat exposure in young and older men. Am J Physiol. 257:R1050–R1056. 1989.PubMed/NCBI

7 

Manning EP and Wilson B: Dehydration in extreme temperatures while conducting stability and support operations in a combat zone. Mil Med. 172:972–976. 2007. View Article : Google Scholar : PubMed/NCBI

8 

González-Alonso J: Hyperthermia impairs brain, heart and muscle function in exercising humans. Sports Med. 37:371–373. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Deng DF, Wang CF, Lee S, Bai S and Hung SSO: Feeding rates affect heat shock protein levels in liver of larval white sturgeon (Acipenser transmontanus). Aquaculture. 287:223–226. 2009. View Article : Google Scholar

10 

Pathapati RM, Kumar M Rajesh, Chirra BR, et al: Acute effects of two angiotensin receptor blockers on vascular hemodynamics, arterial stiffness, and oxidative stress in patients with mild to moderate hypertension: An open label parallel group study. ISRN Vascular Medicine. 2013:1–5. 2013. View Article : Google Scholar

11 

Cui S, Reichner JS, Mateo RB and Albina JE: Activated murine macrophages induce apoptosis in tumor cells through nitric oxide-dependent or -independent mechanisms. Cancer Res. 54:2462–2467. 1994.PubMed/NCBI

12 

Overton JM, Williams TD, Chambers JB and Rashotte ME: Cardiovascular and metabolic responses to fasting and thermoneutrality are conserved in obese Zucker rats. Am J Physiol Regul Integr Comp Physiol. 280:R1007–R1015. 2001.PubMed/NCBI

13 

Williams TD, Chambers JB, Henderson RP, Rashotte ME and Overton JM: Cardiovascular responses to caloric restriction and thermoneutrality in C57BL/6J mice. Am J Physiol Regul Integr Comp Physiol. 282:R1459–R1467. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Rubini A: Effect of perfusate temperature on pulmonary vascular resistance and compliance by arterial and venous occlusion in the rat. Eur J Appl Physiol. 93:435–439. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Benetos A, Vasmant D, Thiéry P and Safar M: Effects of ramipril on arterial hemodynamics. J Cardiovasc Pharmacol. 18(Suppl 2): S153–S156. 1991. View Article : Google Scholar : PubMed/NCBI

16 

Bonetti PO, Lerman LO, Napoli C and Lerman A: Statin effects beyond lipid lowering-are they clinically relevant? Eur Heart J. 24:225–248. 2003. View Article : Google Scholar : PubMed/NCBI

17 

Shan X, Zhou J, Ma T and Chai Q: Lycium barbarum polysaccharides reduce exercise-induced oxidative stress. Int J Mol Sci. 12:1081–1088. 2011. View Article : Google Scholar : PubMed/NCBI

18 

McClean CM, McLaughlin J, Burke G, Murphy MH, Trinick T, Duly E and Davison GW: The effect of acute aerobic exercise on pulse wave velocity and oxidative stress following postprandial hypertriglyceridemia in healthy men. Eur J Appl Physiol. 100:225–234. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Urso ML and Clarkson PM: Oxidative stress, exercise, and antioxidant supplementation. Toxicology. 189:41–54. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Kumar S and Vaux DL: Apoptosis. A cinderella caspase takes center stage. Science. 297:1290–1291. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Radwan MA, El-Gendy KS and Gad AF: Oxidative stress biomarkers in the digestive gland of Theba pisana exposed to heavy metals. Arch Environ Contam Toxicol. 58:828–835. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Liu Y, Zheng Q, Wu H, Guo X, Li J and Hao S: The effect of rapamycin on expression ratio of Bax/Bcl-2 and the expression of activated caspase-3 in different types of tumor cells. Tumor. 33:138–145. 2013.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Geng Y, Zhu L, Liu F, Zhu X, Niu J and Li G: Effect of dehydration heat exposure on thoracic aorta reactivity in rats. Biomed Rep 5: 613-617, 2016.
APA
Geng, Y., Zhu, L., Liu, F., Zhu, X., Niu, J., & Li, G. (2016). Effect of dehydration heat exposure on thoracic aorta reactivity in rats. Biomedical Reports, 5, 613-617. https://doi.org/10.3892/br.2016.760
MLA
Geng, Y., Zhu, L., Liu, F., Zhu, X., Niu, J., Li, G."Effect of dehydration heat exposure on thoracic aorta reactivity in rats". Biomedical Reports 5.5 (2016): 613-617.
Chicago
Geng, Y., Zhu, L., Liu, F., Zhu, X., Niu, J., Li, G."Effect of dehydration heat exposure on thoracic aorta reactivity in rats". Biomedical Reports 5, no. 5 (2016): 613-617. https://doi.org/10.3892/br.2016.760
Copy and paste a formatted citation
x
Spandidos Publications style
Geng Y, Zhu L, Liu F, Zhu X, Niu J and Li G: Effect of dehydration heat exposure on thoracic aorta reactivity in rats. Biomed Rep 5: 613-617, 2016.
APA
Geng, Y., Zhu, L., Liu, F., Zhu, X., Niu, J., & Li, G. (2016). Effect of dehydration heat exposure on thoracic aorta reactivity in rats. Biomedical Reports, 5, 613-617. https://doi.org/10.3892/br.2016.760
MLA
Geng, Y., Zhu, L., Liu, F., Zhu, X., Niu, J., Li, G."Effect of dehydration heat exposure on thoracic aorta reactivity in rats". Biomedical Reports 5.5 (2016): 613-617.
Chicago
Geng, Y., Zhu, L., Liu, F., Zhu, X., Niu, J., Li, G."Effect of dehydration heat exposure on thoracic aorta reactivity in rats". Biomedical Reports 5, no. 5 (2016): 613-617. https://doi.org/10.3892/br.2016.760
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team