This article is mentioned in:

Introduction

Melioidosis is an often fatal infectious disease caused by Burkholderia pseudomallei (B. pseudomallei). It is known as the ‘remarkable imitator’ and the ‘great mimicker’ as the disease may mimic anything from a pyogenic bacterial infection to tuberculosis, with no one feature pathognomonic of melioidosis (1). The disease has an acute or subacute form and a chronic relapsing state that is associated with high mortality. Risk factors for infection include diabetes, alcoholism, renal insufficiency and chronic steroid use (2). The bacterium has a specific ecological niche, existing in soil and stagnant water in an area between the latitudes 20°N and 20°S of the equator; prominent endemic areas include Southeast Asia, northern Australia and areas of south America (3,4). The majority of patients are mainly affected by contact with contaminated soil or water, by either percutaneous inoculation or inhalation (5).

Hainan island (between the latitudes of 19° and 20°N) is geographically close to Thailand, an endemic area, and has a population of ~8,600,000 individuals in an area of 35,400 km2 with 1,823 km of coastline. This province is known as the Chinese vegetable basket and has >700,000 hectares of vegetable and paddy fields. More than one million individuals are at risk of contracting B. pseudomallei, which is a great public health concern and an important cause of community-acquired sepsis in Hainan. The first reported case of meliodosis in China was in 1990 in the south county of the Hainan province. Subsequently, a small number of additional cases were described in this region (6). However, the incidence may have previously been underestimated. In recent years, the number of sporadic cases has increased substantially (7). Although the results of these cases confirm that melioidosis is endemic in Hainan, no environmental B. pseudomallei isolates have been confirmed as the sources of infection for these melioidosis cases. Similarly, it is not clear whether there are certain natural reservoirs of B. pseudomallei in Hainan. Molecular typing methods for B. pseudomallei have been successful at assigning isolates into epidemiologically-associated groups. Multilocus sequence typing (MLST) and multilocus variable number tandem repeat analysis (MLVA) provide the ability to generate robust evolutionary hypotheses that enable tracking of B. pseudomallei in epidemiological outbreaks at fine phylogenetic scale (8,9). In the present study, a molecular investigation of four indigenous cases of melioidosis, which occurred in Hainan in 2015, is described.

Materials and methods

Samples

The four indigenous patients (who had never traveled outside the country) were admitted between June and August 2015 to Hainan People's Hospital (Haikou, China; Table I). The present study was approved by the Ethics Committee of Hainan Medical University (Haikou, China; CEEA2015-217) and all patients provided written informed consent. Samples of sputum, blood and pus were taken for culture, as appropriate. Colonies were identified by oxidative/fermentation glucose test as nonfermentative gram-negative Bacillus and were further identified using the VITEK-2 identification system (BioMérieux, Marcy-I'Etoile, France). The VITEK-2 suggested the isolate was B. pseudomallei, with an excellent level of identification (>99%), which was confirmed by 16S ribosomal DNA gene sequencing (Aiji, Ltd., Guangzhou, China). Each colony was stored at −20°C and subcultured prior to DNA extraction for molecular analysis. Isolates were cultured on standard media at 37°C overnight. Genomic DNA was extracted with the genomic DNA mini purification kit (Tiangen, Ltd., Beijing, China) according to the manufacturer's instructions for gram-negative bacteria.

Table I. Melioidosis cases identified in Hainan in 2015 (n=4).

Table I.

Melioidosis cases identified in Hainan in 2015 (n=4).

Patient ID	County of residence	Possible exposures	Outcome	Clinical features
P1	Dongfang	Often barefoot on soil	Survived	Male student (age, 19 years) exhibited a left parotid abscess, which had been presentfor 10 days. Abscess pus was sampled on admission and was positive for B. pseudomallei
P2	Wenchang	Agricultural work	Succumbed	Diabetic male (age, 63 years) rice farmer exhibited chest pain, fever and weakness, which had been present for 7 days. Left lobar pneumonia developed on day 13 when a tracheal suction sample was identified to be positive for B. pseudomallei
P3	Qionghai	Agricultural work	Survived	Male (age, 37 years) rice farmer presented witha cough, neck pain and fever, which had commenced 2 days previously. Fulminant sepsis developed on day 3 when the blood sample was was positive for B. pseudomallei
P4	Haikou	Unknown	Succumbed	Diabetic housewife (age, 48 years) presented with left lower pleuritic-type and fever, chest pain which had commenced 1 day previously. Pneumonia developed on day 5 when a sputum sample was identified to be positive for B. pseudomallei

[i] B. pseudomallei, Burkholderia pseudomallei.

In August 2015, 20 soil and water samples were collected from various locations within a 300-m sampling radius of each patient's household. In total, 80 sampling sites were examined. Environmental samples were screened for the presence of B. pseudomallei by culture using procedures described previously (10,11). The environmental isolates of B. pseudomallei were confirmed using the VITEK-2 identification system and 16S ribosomal DNA gene sequencing, as described above. Two B. pseudomallei isolates were identified during the course of the epidemiologic investigation of the 20 soil samples collected from around the home of one patient.

Polymerase chain reaction (PCR) profiling

Primers for the PCR assays are listed in Table II, as previously described (12). Briefly, PCR was conducted in a final reaction volume of 25 µl containing 1 µl template DNA, 250 nM of each primer, 12.5 µl Taq PCR master Mix (Tiangen, Ltd., Beijing, China), and adding distilled water to reach a final volume of 25 µl. Samples were separated by electrophoresis (100 V for 15 min), stained with ethidium bromide and visualized using the gel documentation system, Quantity One v4.62 (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Table II. Primers for polymerase chain reaction assays.

Table II.

Primers for polymerase chain reaction assays.

Assay	Primer	Forward	Reverse
TTS1	BpTT4176	CGTCTCTATACTGTCGAGCAATCG	CGTGCACACCGGTCAGTATC
YLF	YLF	CCGGGCCTTTCATGCTGTC	TGTTCGGTGATTTCGATTTGGA
BTFC	BTFC	CGAGCGCGTGAATCGAGTTG	CGACTGATCGCCAATTTCCA
cheB	cheB	ATCGGCCGGAGACGATTT	ACTACGCGAATCAATTCGTTTTC
wcbG	wcbG	ACACGCCCGCTGATTCCAA	GGTCCGGCATCGAGGATT
fhaB-1	fhaB-1	CGCCTTGGACGGTCACAT	TCGCTCAATACCGATGGGATG
bimABm	bimA-Bm	AGCGCTTCGCGCATCTAC	CGCGTTAAACGCCGTACTTTC
bimABP	bimA-Bp	CTCGCTCGCCGGATCAAG	GCTTTGGCGTGCATATCGA
BurkDiffBP	BD	CGAGCGCATCGTACTCGTA	CAAGTCGTGGATGCGCATTA

MLST and MLVA genotyping

Analysis by MLST was performed as previously described (13). Briefly, the alleles at each of the seven previously described loci (ace, gltB, gmhD, lepA, lipA, nark and ndh) were assigned for each isolate by comparing sequences with those on the B. pseudomallei MLST website (http://bpseudomallei.mlst.net). The allele numbers at each locus were used to define a sequence type (ST) based on the MLST database.

MLVA provided important insights into the genetic heterogeneity of individual strains of B. pseudomallei by offering fine-scale resolution, which is unattainable using MLST. Currie et al (14) described a simplified 4-locus multilocus variable number tandem repeat analysis (MLVA-4) for B. pseudomallei rapid typing (14). Briefly, four VNTR loci (2341, 389, 1788 and 933) were selected, the PCR products were subjected to capillary electrophoresis [20 V/cm (10 kV) for 20 min] using GeneScan 500 LIZ and DNA markers, and analyzed using the ABI software program, GeneMapper v4.1; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

Results

Soil and water sampling

B. pseudomallei was isolated from one of the four sites, the results indicated that the geographical distribution of culturable B. pseudomallei was confined to a site, which was near the household of a patient with melioidosis (patient 1; P1), where two positive B. pseudomallei isolates were obtained from two soil samples. B. pseudomallei were not isolated from any of the 78 soil or water samples taken at the three sites where the other three patients lived (Table III).

Table III. Number of samples positive for Burkholderia pseudomallei from different sources.

Table III.

Number of samples positive for Burkholderia pseudomallei from different sources.

	Location [positive samples/sample size (n)]
Sample	P1	P2	P3	P4
Water	0/8	0/8	0/4	0/6
Soil	2/12	0/14	0/16	0/14

[i] P, patient household site.

PCR-profiling

As listed in Table IV, the detection assays (TTS1, YLF, bimABp, wcbG, fhaB-1 and BurkDiff) were positive for all B. pseudomallei isolates except one isolate, which was negative for bimABp (P2), and the detection assays for Burkholderia mallei (bimABm) and Burkholderia thailandensis (BTFC and cheB) were negative. The YLF-positive versus BTFC-negative results grouped the patient and soil isolates with Southeast Asian populations.

Table IV. Polymerase chain reaction assay panel and results used to profile the clinical and environmental isolates.

Table IV.

Polymerase chain reaction assay panel and results used to profile the clinical and environmental isolates.

				Genomic target
Strain	TTS1	YLF	BTFC	cheB	wcbG	fhaB-1	bimABm	bimABp	BurkDiffBp
P1	Pos.	Pos.	Neg.	Neg.	Pos.	Pos.	Neg.	Pos.	Pos.
P2	Pos.	Pos.	Neg.	Neg.	Pos.	Pos.	Neg.	Pos.	Pos.
P3	Pos.	Pos.	Neg.	Neg.	Pos.	Pos.	Pos.	Pos.	Pos.
P4	Pos.	Pos.	Neg.	Neg.	Pos.	Pos.	Neg.	Pos.	Pos.
S1	Pos.	Pos.	Neg.	Neg.	Pos.	Pos.	Neg.	Pos.	Pos.
S2	Pos.	Pos.	Neg.	Neg.	Pos.	Pos.	Neg.	Pos.	Pos.

[i] P, patient; S, soil; Bp, Burkholderia pseudomallei; Bm, Burkholderia mallei; Pos., Positive; Neg., Negative.

Genotyping of clinical and environmental isolates

MLST and MLVA are commonly used to differentiate closely-associated bacterial strains within outbreaks (15). MLST and MLVA-4 were applied to all six isolates obtained from the four patients and two soil samples (S1 and S2) to determine genotypes. The results for the six isolate genotypes in the study are presented in Table V. MLST of one colony from one soil sample supported the homogeneity of the genotype of P1 (ST-46). Unlike MLST, the higher-resolution MLVA technique discriminated between the within-patient isolates. Strains that appeared to be closely associated by MLST could, in certain cases, be seen to be linked using MVLA-4, which was able to discriminate between each ST. Between the four clinical isolates and two colonies that were obtained from the two soil samples, a total of four and two MLVA genotypes were identified in P1 to P4 and S1 to S2, respectively. Analysis by MLST indicated that one soil (S1) and clinical colony (P1) were ST-46, as well as type (8, 3, 11, 9) by MLVA-4, indicating that soil may have been the source of infection for this melioidosis case.

Table V. MLST and repeat copy number (MLVA-4 code) for six Burkholderia pseudomallei strains.

Table V.

MLST and repeat copy number (MLVA-4 code) for six Burkholderia pseudomallei strains.

		VNTR loci (MLVA-4)
Strain	MLST	RCN 2341	RCN 389	RCN 1788	RCN 933
P1	ST46	8	3	11	9
P2	ST30	3	4	8	2
P3	ST55	7	5	12	3
P4	ST1397	4	5	8	3
S1	ST46	8	3	11	9
S2	ST58	9	5	6	4

[i] MLST, multilocus sequence typing; MLVA-4, 4-locus multilocus variable number tandem repeat analysis; VNTR, variable number tandem repeat; RCN, repeat copy number.

Discussion

Melioidosis is a tropical disease, which prevails in regions of Southeast Asia and northern Australia. However, in recent years, the known area of endemicity is expanding and extends to other locations around the globe, including regions of South America, certain countries in Africa, and various Pacific and Indian Ocean islands (4). B. pseudomallei is widespread in soil in the regions where it is endemic, such as Guangxi, China (16). Since 1990, cases of melioidosis have been sporadically reported from Hainan, China (17). Although the cases are common enough that Hainan is listed as one of the endemic areas for melioidosis, there is a paucity of information on the geographical distribution and the molecular investigations of B. pseudomallei in Hainan, China (18).

In the current study, the first molecular investigations into four cases of non-human-to-human locally acquired melioidosis infection in Hainan are described. There were only two B. pseudomallei strains isolated from soil samples obtained at the sites near to the household of one of the patients (P1). P1 was from the Dongfang district, which is situated in the tropical zone of China. This was a locally acquired case, as P1 had never travelled to any other country. The patient reported frequently working barefoot on soil prior to the onset of illness. In this case, with a possible mechanism of subcutaneous inoculation transmission, an in-depth molecular analysis was required to facilitate with understanding the possible nature of the exposure and the isolate. Molecular tracking data are useful for focusing the on-site epidemiological investigation towards possible sources of fomites associated with the exposure. Due to the limitations of MLST in determining the associations between STs, further refinement of the estimates of geographic origin could not be performed using this technique alone. MLVA is known to be highly accurate for defining isolate associations, and has previously been used to differentiate closely associated bacterial strains within outbreaks (19). Therefore, in the present study MLST and MLVA-4 were employed to achieve optimal molecular epidemiologic confidence for this unusual case of melioidosis. The on-site epidemiological investigations identified that isolates P1 and S1 shared the same MLVA-4 pattern and an identical ST. Furthermore, the molecular evidence indicates a likely geographical and epidemiological link. All six B. pseudomallei isolates contained the YLF marker, which is predominant in Southeast Asia (20) and one of the isolates amplified the B. mallei allele of bimABm, with the other five having the B. pseudomallei allele.

In conclusion, to the best of our knowledge, this is the first molecular tracking investigation of melioidosis in China, and the first published isolation of B. pseudomallei from soil in Hainan. Due to the difficulty in identifying B. pseudomallei, it is likely that the reported melioidosis cases represent an underestimation of the true incidence of this infection, as there are few laboratories with experience in recognizing this organism. As a result, the actual incidence of melioidosis may be greater than is currently recognized. Whether this increase in the diagnosis of melioidosis in Hainan is due to the widespread existence of B. pseudomallei or a previous underdiagnosis of cases remains unclear. Thus, future epidemiological investigations to determine the geographical distribution and seroprevalence rate of B. pseudomallei in Hainan are required. Likewise, establishing epidemiological data with melioidosis at a national level using a appropriate surveillance system is considered to be important.

Acknowledgements

The authors would like to thank Professor Shengmiao Fu and Dr Zhenzen Fu, who recruited patients during the study period, and Dr Ying Wang and Dr Zongliang Niu for laboratory support. The authors would also like to thank Dr Xing Zhang for his help collecting the soil and water samples. The present study was financially supported by the National Natural Science Foundation of China (grant nos. 81360240 and 81560002) and the Social Development and Scientific and Technological Projects of Hainan Province (grant no. SF201415).

References