Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
February-2018 Volume 8 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2018 Volume 8 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Long non‑coding RNA PAX8‑AS1 polymorphisms increase the risk of childhood acute lymphoblastic leukemia

  • Authors:
    • Gholamreza Bahari
    • Mohammad Hashemi
    • Majid Naderi
    • Simin Sadeghi‑Bojd
    • Mohsen Taheri
  • View Affiliations / Copyright

    Affiliations: Cellular and Molecular Research Center, Zahedan University of Medical Sciences, Zahedan 98167‑43181, Iran, Department of Pediatrics, School of Medicine, Zahedan University of Medical Sciences, Zahedan 98167‑43181, Iran, Genetics of Non‑Communicable Disease Research Center, Zahedan University of Medical Sciences, Zahedan 98167‑43181, Iran
  • Pages: 184-190
    |
    Published online on: December 13, 2017
       https://doi.org/10.3892/br.2017.1028
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present case‑control study was conducted on 110 children with acute lymphoblastic leukemia (ALL) and 120 healthy children to determine the impact of polymorphisms in paired‑box gene 8 (PAX8) antisense RNA 1 (PAX8‑AS1), namely rs4848320 C>T, rs6726151 T>G and rs1110839 G>T, on ALL risk. Genotyping was performed through the polymerase chain reaction‑restriction fragment length polymorphism method. The findings indicated that the rs4848320 variant increased the risk of ALL in codominant [CT vs. CC: odds ratio (OR)=2.13, 95% confidence interval (CI)=1.16‑3.90, P=0.014; and TT vs. CC: OR=2.21, 95% CI=1.03‑4.74, P=0.041], dominant (CT+TT vs. CC: OR=2.15, 95% CI=1.22‑3.81, P=0.009,) and allele (T vs. C: OR=1.55, 95% CI=1.07‑2.25, P=0.024) inheritance models. The rs6726151 variant significantly increased the risk of ALL in codominant (GT vs. GG: OR=1.88, 95% CI=1.08‑3.27, P=0.036) and overdominant (GT vs. GG+TT: OR=2.08, 95% CI=1.23‑3.53, P=0.008) inheritance models. No significant relationship was identified between the rs1110839 G>T variant and disease risk/protection in childhood ALL. In conclusion, the findings of the present study indicated that rs4848320 and rs6726151 polymorphisms of PAX8‑AS1 may be a risk factor for the development of childhood ALL. Further studies with larger sample sizes and different ethnicities are now required to confirm these findings.

Introduction

Acute lymphoblastic leukemia (ALL) is the most prevalent malignancy in children and constitutes approximately 75% of pediatric acute leukemias (1). While the etiology of ALL is not fully understood, previous reports have indicated that genetic factors serve a role in the development of childhood ALL (2–5).

Non-coding RNAs, comprising microRNAs and long non-coding RNAs (lncRNAs), do not encode protein sequences, yet are involved in various biological processes (6–8). In particular, lncRNAs, as transcripts of >200 nucleotides in length that lack protein-coding potential, regulate gene expression at various levels, including at the chromatin remodeling (9), transcription and post-transcriptional processing stages (10,11).

Paired-box gene 8 (PAX8) encodes a transcription factor required for cell growth and differentiation during embryonic development (12). Overexpression of PAX8 has been identified in various cancers (13–17). Though the precise role of PAX8 in cancer remains uncertain, it has been proposed that PAX8 contributes to the development and progression of specific cancers by maintaining tissue specific stem cells, by inhibiting terminal differentiation and apoptosis (18).

LncRNA PAX8 antisense RNA 1 (PAX8-AS1) is mapped to chromosome 2q13 in the upstream region of PAX8 (19). An expression quantitative trait loci (eQTL) is a locus containing a genetic variant that influences the expression level of a gene (20). PAX8-AS1, a potential regulator of PAX8, may contain polymorphisms that represent eQTLs for PAX8 (21). In particular, previous bioinformatics analyses have revealed that the polymorphisms rs4848320 C>T and rs1110839 G>T in PAX8-AS1 may be eQTLs for PAX8 (21). Furthermore, it has been suggested that rs4848320 and rs1110839 may affect the function or expression of PAX8-AS1, thereby influencing PAX8 expression (22,23). Few previous studies have evaluated the impact of PAX8-AS1 variants on cancer risk. Han et al (19) reported that rs4848320 and rs1110839 variants of PAX8-AS1 significantly decreased the risk of cervical cancer (19). Ma et al (24) identified that the two variants of PAX8-AS1 were significantly associated with the prognosis of hepatocellular carcinoma (HCC). However, to the best of our knowledge, no previous study has investigated the impact of PAX8-AS1 polymorphisms on childhood ALL. Based on the previous findings on PAX8-AS1 and cancer risk, it was hypothesized that polymorphisms of PAX8-AS1 may affect the risk of childhood ALL by disturbing the interaction between PAX8-AS1 and PAX8, to in turn influence PAX8 expression. PAX8 has been demonstrated to serve an important role in the pathogenesis of cancer by inhibiting cell differentiation and apoptosis (18). Therefore, the present study aimed to assess the possible association between the PAX8-AS1 polymorphisms rs4848320 C>T, rs1110839 G>T and rs6726151 T>G and the risk of childhood ALL in a Southeast Iranian population sample. In the analysis, the polymorphisms which have been implicated as potential risk factors for cancer were selected (19,24), while the rs6726151 T>G variant, with a minor allele frequency of 0.486 (25), was examined for the first time. The findings of the present study highlight the potential role of PAX8-AS1 variants in the pathogenesis of childhood ALL.

Materials and methods

Patients

A total of 230 subjects including 110 children diagnosed with ALL and 120 age- and sex-matched healthy children were enrolled in the present case-control study. The study design including the enrolled patients has been reported previously by our group (2,8). The local Ethics Committee of Zahedan University of Medical Sciences (Zahedan, Iran) approved the project (approval no. IR.ZAUMS.REC.1395.270) and informed consent was obtained from the parents of all participants. Extraction of genomic DNA from whole blood was performed using the salting out method as described previously (26).

Genotyping

Polymorphism genotyping was performed through the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The primer sequences and restriction enzymes are summarized in Table I. The primers were produced by Bioneer Corp., (Daejeon, Korea). Into a 0.20 ml PCR reaction tube, 1 µl genomic DNA (~100 ng/ml), 1 µl (10 µM each) forward and reverse primers, 10 µl 2X Prime Taq Premix, all from Genet Bio, Inc., (Daejeon, Korea), and 7 µl ddH2O were added. The PCR conditions were as follows: Preheating for 6 min at 95°C; 30 cycles of 95°C for 30 sec, 64°C for rs1110839 and rs4848320 for 30 sec or 62°C for rs6726151 for 30 sec, and 72°C for 30 sec; followed by a final extension step for 5 min at 72°C. Subsequently, 10 µl of amplified product was digested with the appropriate restriction enzyme (New England BioLabs, Inc., Ipswich, MA, USA), resolved on 2.5% agarose gel containing 0.5 µg/ml ethidium bromide, observed under a UV transilluminator (DigiDoc H101; UVP, LLC, Upland, CA, USA) and photographed. For quality control, 15% randomly selected samples were regenotyped and the outcome revealed 100% concordance.

Table I.

Primers and restriction enzymes used in the detection of paired-box gene 8 antisense RNA 1 polymorphisms.

Table I.

Primers and restriction enzymes used in the detection of paired-box gene 8 antisense RNA 1 polymorphisms.

PolymorphismSequence, 5′-3′Restriction enzymeProduct size, bp
rs4848320 C>TF: CTGCTTAGCATGTGCTTGGTGATGPstIT allele: 222;
R: GAAACACTGAGAACTAAGAGAAGCCTGCA C allele: 195+27
rs1110839 G>TF: TCATCTCCCCAGGAGAGGTCCTCAGCHhaIT allele: 270;
R: ACAGTCCGGTTGGAGACTG C G allele: 244+26
rs6726151 T>GF: CCCAAAGACCAGCACACAMboIG allele: 371;
R: AGACCCACCATTTCCATAACA T allele: 211+160

[i] F, forward; R, reverse.

Statistical analysis

Statistical analysis was performed using SPSS 22.0 software (IBM, Corp., Armonk, NY, USA). The categorical and continuous data were analyzed using χ2 and t-test, respectively. Individual single nucleotide polymorphism (SNP) associations with childhood ALL risk were assessed using unconditional logistic regression analyses, in which odds ratios (ORs) and 95% confidence intervals (CIs) were determined for codominant, dominant, recessive, overdominant and allele inheritance models. P<0.05 was considered to indicate a statistically significant difference. Haplotype and linkage disequilibrium analyses were conducted using SNPStats (https://www.snpstats.net/snpstats) (27) and Haploview 4.2 software both from Broad Institute (Cambridge, MA, USA) (28), respectively. Linkage disequilibrium between the PAX8-AS1 polymorphisms was estimated through calculation of D' (correlation coefficient between pairs of loci) and r2 (square of the correlation coefficient between two indicator variables) with Haploview 4.2.

Results

Patient characteristics

The demographic characteristics of the patients considered in the present study are reported previously (2,8).

Genotyping of the variants

Variants were genotyped by PCR-RFLP. When genotyping the rs4848320 variant, digestion of the PCR product (222 bp) yielded a fragment of 195 bp (and presumed 27 bp fragment not visible on agarose gel) for the C allele, and remained undigested for the T allele (Fig. 1). Regarding the rs1110839 variant, the T allele remained undigested (270 bp), while the G allele was digested and produced a fragment of 244 bp (and presumed 26 bp fragment not visible on agarose gel; Fig. 2). For rs6726151, the T allele was digested and produced 211 and 160 bp fragments while the G allele was undigested (371 bp; Fig. 3). The lengths of all fragments following restriction digestion are summarized in Table I.

Figure 1.

Electrophoresis of rs4848320 C>T polymorphism fragments. The C allele was digested by PstI and produced a 195 bp fragment and presumed 27 bp fragment not visible on agarose gel, while the T allele remained undigested (222 bp). M: DNA marker; lanes 1 and 6: CT; lanes 2 and 5: TT; lanes 3 and 4: CC.

Figure 2.

Electrophoresis of rs1110839 G>T polymorphism fragments. The G allele was digested by HhaI and produced 244 bp fragment and presumed 26 bp fragment not visible on agarose gel, while the T allele remained undigested (270 bp). M: DNA marker; lanes 1 and 6: GT; lanes 2 and 5: TT; lanes 3 and 4: GG.

Figure 3.

Electrophoresis of rs6726151 T>G polymorphism fragments. The T allele was digested by MboI and produced 211 and 160 bp fragments, while the G allele remained undigested (371 bp). M: DNA marker; lanes 1 and 4: GT; lane 2: GG; lane 3: TT.

Association between the variants and childhood ALL risk

The genotype and allele distributions of PAX8-AS1 polymorphisms in pediatric patients with ALL and healthy controls are presented in Table II. The findings suggested that the rs4848320 variant was associated with risk of ALL in codominant (CT vs. CC: OR=2.13, 95% CI=1.16–3.90, P=0.014; and TT vs. CC: OR=2.21, 95% CI=1.03–4.74, P=0.041), dominant (CT+TT vs. CC: OR=2.15, 95% CI=1.22–3.81, P=0.009,) and allele (T vs. C: OR=1.55, 95% CI=1.07–2.25, P=0.024,) inheritance models. For the rs6726151 variant, the findings indicated that this variant significantly increased the risk of ALL in codominant (GT vs. GG: OR=1.88, 95% CI=1.08–3.27, P=0.036) and overdominant (GT vs. GG+TT: OR=2.08, 95% CI=1.23–3.53, P=0.008) inheritance models. No significant association was observed between the rs1110839 G>T variant and disease risk/protection in childhood ALL.

Table II.

Association of paired-box gene 8 antisense RNA 1 polymorphisms and risk of acute lymphoblastic leukemia.

Table II.

Association of paired-box gene 8 antisense RNA 1 polymorphisms and risk of acute lymphoblastic leukemia.

PolymorphismCases, n (%)Controls, n (%)OR (95% CI)P-value
rs4848320
  Codominant
    CC  26 (23.6)  48 (40.0)1.00–
    CT  60 (54.6)  52 (43.3)2.13 (1.16–3.90)0.014
    TT  24 (21.8)  20 (16.7)2.21 (1.03–4.74)0.041
  Dominant
    CC  26 (23.6)  48 (40.0)1.00–
    CT+TT  84 (76.4)  72 (60.0)2.15 (1.22–3.81)0.009
  Recessive
    CC+CT  86 (78.2)100 (83.3)1.00–
    TT  24 (21.8)  20 (16.7)1.39 (0.72–2.70)0.322
  Overdominant
    CC+TT  50 (45.4)  68 (56.7)1.00–
    CT  60 (54.6)  52 (43.3)1.57 (0.93–2.64)0.090
  Allele
    C112 (50.9)148 (61.7)1.00–
    T108 (49.1)  92 (38.3)1.55 (1.07–2.25)0.024
rs1110839
  Codominant
    TT  43 (39.1)  54 (45.0)1.00–
    TG  43 (39.1)  34 (28.3)1.59 (0.87–2.90)0.132
    GG  24 (21.8)  32 (26.7)0.94 (0.48–1.83)0.860
  Dominant
    TT  43 (39.1)  54 (45.0)1.00–
    TG+GG  67 (60.9)  66 (55.0)1.27 (0.75–2.16)0.365
  Recessive
    TT+TG  86 (78.2)  88 (73.3)1.00–
    GG  24 (21.8)  32 (26.7)0.77 (0.42–1.41)0.393
  Overdominant
    TT+GG  67 (60.9)  86 (71.7)1.00–
    TG  43 (39.1)  34 (28.3)1.62 (0.93–2.82)0.085
  Allele
    T129 (58.6)142 (59.2)1.00–
    G  91 (60.4)  98 (40.8)1.02 (0.70–1.48)0.924
rs6726151
  Codominant
    GG  40 (36.3)  56 (46.6)1.00–
    GT  63 (57.3)  47 (39.2)1.88 (1.08–3.27)0.036
    TT  7 (6.4)  17 (14.2)0.58 (0.22–1.52)0.576
  Dominant
    GG  40 (36.4)  56 (46.6)1.00–
    GT+TT  70 (63.7)  64 (53.4)1.53 (0.90–2.60)0.141
  Recessive
    GG+GT103 (93.6)103 (85.8)1.00–
    TT  7 (6.4)  17 (14.2)0.41 (0.16–1.04)0.082
  Overdominant
    GG+TT  47 (42.7)  73 (60.8)1.00–
    GT  63 (57.3)  47 (39.2)2.08 (1.23–3.53)0.008
  Allele
    G143 (65.0)159 (72.3)1.00–
    T  77 (35.0)  81 (27.7)1.06 (0.72–1.55)0.844

[i] OR, odds ratio; CI, confidence interval.

Results of the haplotype analysis of the three variants are presented in Table III. The findings did not support an association between haplotype and risk of childhood ALL. Associations between the PAX8-AS1 polymorphisms and patient clinical characteristics were also estimated. As depicted in Table IV, a significant association between rs4848320 and sex was observed [χ2=8.45, degrees of freedom (df)=2, P=0.015]. Notably, the CT genotype significantly decreased the risk of ALL in females (OR=0.32, 95% CI=0.13–0.84, P=0.0355; data not shown). For rs6726151, the findings indicated that this variant was associated with organomegaly (χ2=8.21, df=2, P=0.017) and lymphadenopathy (χ2=11.48, df=2, P=0.003; Table IV). No significant associations were identified between rs1110839 and patient clinical characteristics.

Table III.

Association of paired-box gene 8 antisense RNA 1 haplotypes and risk of acute lymphoblastic leukemia.

Table III.

Association of paired-box gene 8 antisense RNA 1 haplotypes and risk of acute lymphoblastic leukemia.

Polymorphism

rs4848320rs1110839rs6726151Cases, frequencyControls, frequencyOR (95% CI)P-value
CTT0.20250.22161.00 [ref.]–
TGG0.20100.16801.32 (0.71–2.47)0.390
TTG0.21770.14721.63 (0.83–3.19)0.160
CTG0.14020.20420.77 (0.38–1.58)0.480
CGG0.09100.14310.68 (0.33–1.42)0.310
CGT0.07540.04781.87 (0.55–6.43)0.320
TGT0.04630.04951.09 (0.38–3.11)0.880
TTT0.02590.01861.35 (0.20–9.20)0.760

[i] OR, odds ratio; CI, confidence interval.

Table IV.

Association of paired-box gene 8 antisense RNA 1 polymorphisms with demographic and clinical features of patients.

Table IV.

Association of paired-box gene 8 antisense RNA 1 polymorphisms with demographic and clinical features of patients.

rs4848320 rs1110839 rs6726151



FactorCCCTTTP-valueTTTGGGP-valueGGGTTTP-value
Sex, n 0.015 0.583 0.073
  Male192818 282413 22367
  Female7326 151911 18270
Age at diagnosis, years5.2±3.16.5±3.95.7±4.50.3555.9±3.75.5±3.97.2±4.10.2315.6±4.06.2±3.96.3±3.80.757
WBC, ×106/ml, mean ± SD31.3±49.640.8±55.340.9±46.80.71533.8±42.944.0±66.237.5±36.40.65642.1±50.439.5±54.910.1±15.50.318
Hemoglobin, g/dl, mean ± SD7.2±2.17.0±2.37.8±2.30.3627.1±2.37.1±2.47.6±2.00.607  7.6±2. 37.9±2.28.0±1.60.172
Platelet, ×106/ml, mean ± SD71.9±64.052.3±45.449.1±38.00.17354.4±44.060.8±61.156.2±49.40.87461.6±50.654.3±50.5   42.9±430.00.587
Organomegaly 0.152 0.163 0.017
  Positive245224 393724 40555
  Negative280 460 082
Lymphadenopathy 0.105 0.649 0.003
  Positive144419 312818 31451
  Negative12165 12156 9186
Cerebrospinal fluid involvement 0.536 0.498 0.669
  Positive153 522 450
  Negative255521 384122 36587

[i] Emboldened values indicate statistical significance (P<0.05). WBC, white blood cell; SD, standard deviation.

Furthermore, linkage disequilibrium was observed between rs4848320 and rs1110839 (D'=0.2242, r2=0.0455); rs4848320 and rs6726151 (D'=0.5268, r2=0.1117); and rs1110839 and rs6726151 (D'=0.2279, r2=0.0189; Fig. 4).

Figure 4.

Haploview linkage disequilibrium graph of the three polymorphisms analyzed in long non-coding paired-box gene 8 antisense RNA 1. Pairwise linkage disequilibrium coefficients (D' ×100) are indicated in each cell linkage.

Discussion

In the present study, the possible association between PAX8-AS1 polymorphisms and risk of childhood ALL in a Southeast Iranian population was investigated. The findings indicated that the rs4848320 and rs6726151 variants of PAX8-AS1 significantly increased the risk of developing childhood ALL, while there was no association between rs1110839 and disease risk/protection. By contrast, the haplotype analysis did not identify a significant association of any of the variants with risk of childhood ALL. However, stratification of the variants according to the clinical characteristics of patients indicated that the rs4848320 variant was associated with sex while the rs6726151 variant was associated with organomegaly and lymphadenopathy.

Previous results have indicated that non-coding transcripts in the human genome serve crucial and diverse biological roles (29). The findings of macromolecular interactions have revealed that tissue-specific lncRNAs form base-pairing interactions with numerous mRNAs associated with tissue-differentiation, indicating that tissue specificity is an critical factor in controlling human lncRNA-mRNA interactions (30). LncRNAs have tissue-specific expression and serve an important role in the human transcriptome by regulating normal tissue differentiation as well as cancer development (30). Notably, a number of previous studies have implicated a role of lncRNA dysregulation, of transcripts including leukemia-induced non-coding activator RNA, B-ALL-associated long RNA (BALR)-6 and −2, NOTCH1-associated lncRNA in T-ALL and CCDC26, in tumorigenicity in leukemias (31–34). SNPs may significantly influence gene expression and function. Altered expression of lncRNAs in various cancers indicates the potential tumor suppressor or oncogenic functions of the lncRNAs (35–39). Recently, an association between the rs2147578 polymorphism of lnc-LAMC2-1 and risk of childhood ALL has been demonstrated (6).

There is limited information on the impact of PAX8-AS1 polymorphisms on cancer risk (19,24). Han et al (19) demonstrated that PAX8-AS1 rs4848320 and rs1110839 polymorphisms decreased the risk of cervical cancer, while Ma et al (24) reported that rs4848320 and rs1110839 were associated with prognosis of HCC in a Chinese population. It has been proposed that the PAX genes act as oncogenes, and that PAX overexpression facilitates malignant development through effects on apoptotic resistance, tumor cell proliferation and migration, and repression of terminal differentiation (40). As PAX8-AS1 is a potential regulator of PAX8, polymorphisms in the PAX8-AS1 may affect its function and alter the expression of PAX8.

There are a number of limitations to the present study. First, a relatively small sample size was used. Second, there was a lack of data regarding the response of patients to treatment; therefore, it was not possible to analyze the association between the variants and response to treatment.

In conclusion, the present results suggested that PAX8-AS1 polymorphisms significantly increased the risk of childhood ALL in a Southeast Iranian population. As this, to the best of our knowledge, was the first study to examine the association of polymorphisms in PAX8-AS1 with risk of childhood ALL, future studies with larger sample sizes and different ethnicities are required to confirm the findings.

Acknowledgements

The present study was financially supported by a research grant from the Deputy for Research of Zahedan University of Medical Sciences, (Zahedan, Iran; grant no. 8224).

References

1 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2013. CA Cancer J Clin. 63:11–30. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Bahari G, Hashemi M, Naderi M and Taheri M: IKZF1 gene polymorphisms increased the risk of childhood acute lymphoblastic leukemia in an Iranian population. Tumour Biol. 37:9579–9586. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Bahari G, Hashemi M, Naderi M, Sadeghi-Bojd S and Taheri M: Association of SHMT1 gene polymorphisms with the risk of childhood acute lymphoblastic leukemia in a sample of Iranian population. Cell Mol Biol (Noisy-le-grand). 62:45–51. 2016.PubMed/NCBI

4 

Hasani SS, Hashemi M, Eskandari-Nasab E, Naderi M, Omrani M and Sheybani-Nasab M: A functional polymorphism in the miR-146a gene is associated with the risk of childhood acute lymphoblastic leukemia: A preliminary report. Tumour Biol. 35:219–225. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Tong N, Chu H, Wang M, Xue Y, Du M, Lu L, Zhang H, Wang F, Fang Y, Li J, et al: Pri-miR-34b/c rs4938723 polymorphism contributes to acute lymphoblastic leukemia susceptibility in Chinese children. Leuk Lymphoma. 57:1436–1441. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Hashemi M, Bahari G, Naderi M, Bojd S Sadeghi and Taheri M: Association of lnc-LAMC2-1:1 rs2147578 and CASC8 rs10505477 polymorphisms with risk of childhood acute lymphoblastic leukemia. Asian Pac J Cancer Prev. 17:4985–4989. 2016.PubMed/NCBI

7 

Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, Tanzer A, Lagarde J, Lin W, Schlesinger F, et al: Landscape of transcription in human cells. Nature. 489:101–108. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Hashemi M, Bahari G, Naderi M, Sadeghi-Bojd S and Taheri M: Pri-miR-34b/c rs4938723 polymorphism is associated with the risk of childhood acute lymphoblastic leukemia. Cancer Genet. 209:493–496. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC, Hung T, Argani P, Rinn JL, et al: Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 464:1071–1076. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Tripathi V, Ellis JD, Shen Z, Song DY, Pan Q, Watt AT, Freier SM, Bennett CF, Sharma A, Bubulya PA, et al: The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell. 39:925–938. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Qi P and Du X: The long non-coding RNAs, a new cancer diagnostic and therapeutic gold mine. Mod Pathol. 26:155–165. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Poleev A, Fickenscher H, Mundlos S, Winterpacht A, Zabel B, Fidler A, Gruss P and Plachov D: PAX8, a human paired box gene: Isolation and expression in developing thyroid, kidney and Wilms' tumors. Development. 116:611–623. 1992.PubMed/NCBI

13 

Ordóñez NG: Value of PAX 8 immunostaining in tumor diagnosis: A review and update. Adv Anat Pathol. 19:140–151. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Nonaka D, Chiriboga L and Soslow RA: Expression of pax8 as a useful marker in distinguishing ovarian carcinomas from mammary carcinomas. Am J Surg Pathol. 32:1566–1571. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Tong GX, Weeden EM, Hamele-Bena D, Huan Y, Unger P, Memeo L and O'Toole K: Expression of PAX8 in nephrogenic adenoma and clear cell adenocarcinoma of the lower urinary tract: Evidence of related histogenesis? Am J Surg Pathol. 32:1380–1387. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Tong GX, Yu WM, Beaubier NT, Weeden EM, Hamele-Bena D, Mansukhani MM and O'Toole KM: Expression of PAX8 in normal and neoplastic renal tissues: An immunohistochemical study. Mod Pathol. 22:1218–1227. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Becker N, Chernock RD, Nussenbaum B and Lewis JS Jr: Prognostic significance of β-human chorionic gonadotropin and PAX8 expression in anaplastic thyroid carcinoma. Thyroid. 24:319–326. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Lang D, Powell SK, Plummer RS, Young KP and Ruggeri BA: PAX genes: Roles in development, pathophysiology, and cancer. Biochem Pharmacol. 73:1–14. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Han J, Zhou W, Jia M, Wen J, Jiang J, Shi J, Zhang K, Ma H, Liu J, Ren J, et al: Expression quantitative trait loci in long non-coding RNA PAX8-AS1 are associated with decreased risk of cervical cancer. Mol Genet Genomics. 291:1743–1748. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Nica AC and Dermitzakis ET: Expression quantitative trait loci: Present and future. Philos Trans R Soc Lond B Biol Sci. 368:201203622013. View Article : Google Scholar : PubMed/NCBI

21 

Boyle AP, Hong EL, Hariharan M, Cheng Y, Schaub MA, Kasowski M, Karczewski KJ, Park J, Hitz BC, Weng S, et al: Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22:1790–1797. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Stranger BE, Nica AC, Forrest MS, Dimas A, Bird CP, Beazley C, Ingle CE, Dunning M, Flicek P, Koller D, et al: Population genomics of human gene expression. Nat Genet. 39:1217–1224. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Veyrieras JB, Kudaravalli S, Kim SY, Dermitzakis ET, Gilad Y, Stephens M and Pritchard JK: High-resolution mapping of expression-QTLs yields insight into human gene regulation. PLoS Genet. 4:e10002142008. View Article : Google Scholar : PubMed/NCBI

24 

Ma S, Yang J, Song C, Ge Z, Zhou J, Zhang G and Hu Z: Expression quantitative trait loci for PAX8 contributes to the prognosis of hepatocellular carcinoma. PLoS One. 12:e01737002017. View Article : Google Scholar : PubMed/NCBI

25 

Sherry ST, Ward MH, Kholodov M, Baker J, Phan L, Smigielski EM and Sirotkin K: dbSNP: The NCBI database of genetic variation. Nucleic Acids Res. 29:308–311. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Hashemi M, Bojd H Hanafi, Nasab E Eskandari, Bahari A, Hashemzehi NA, Shafieipour S, Narouie B, Taheri M and Ghavami S: Association of adiponectin rs1501299 and rs266729 gene polymorphisms with nonalcoholic fatty kiver disease. Hepat Mon. 13:e95272013. View Article : Google Scholar : PubMed/NCBI

27 

Solé X, Guinó E, Valls J, Iniesta R and Moreno V: SNPStats: A web tool for the analysis of association studies. Bioinformatics. 22:1928–1929. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Barrett JC, Fry B, Maller J and Daly MJ: Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics. 21:263–265. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Geisler S and Coller J: RNA in unexpected places: Long non-coding RNA functions in diverse cellular contexts. Nat Rev Mol Cell Biol. 14:699–712. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Iwakiri J, Terai G and Hamada M: Computational prediction of lncRNA-mRNA interactionsby integrating tissue specificity in human transcriptome. Biol Direct. 12:152017. View Article : Google Scholar : PubMed/NCBI

31 

Rodríguez-Malavé NI, Fernando TR, Patel PC, Contreras JR, Palanichamy JK, Tran TM, Anguiano J, Davoren MJ, Alberti MO, Pioli KT, et al: BALR-6 regulates cell growth and cell survival in B-lymphoblastic leukemia. Mol Cancer. 14:2142015. View Article : Google Scholar : PubMed/NCBI

32 

Wang Y, Wu P, Lin R, Rong L, Xue Y and Fang Y: LncRNA NALT interaction with NOTCH1 promoted cell proliferation in pediatric T cell acute lymphoblastic leukemia. Sci Rep. 5:137492015. View Article : Google Scholar : PubMed/NCBI

33 

Trimarchi T, Bilal E, Ntziachristos P, Fabbri G, Dalla-Favera R, Tsirigos A and Aifantis I: Genome-wide mapping and characterization of Notch-regulated long noncoding RNAs in acute leukemia. Cell. 158:593–606. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Hirano T, Yoshikawa R, Harada H, Harada Y, Ishida A and Yamazaki T: Long noncoding RNA CCDC26, controls myeloid leukemia cell growth through regulation of KIT expression. Mol Cancer. 14:902015. View Article : Google Scholar : PubMed/NCBI

35 

Sun QL, Zhao CP, Wang TY, Hao XB, Wang XY, Zhang X and Li YC: Expression profile analysis of long non-coding RNA associated with vincristine resistance in colon cancer cells by next-generation sequencing. Gene. 572:79–86. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Yang X, Song JH, Cheng Y, Wu W, Bhagat T, Yu Y, Abraham JM, Ibrahim S, Ravich W, Roland BC, et al: Long non-coding RNA HNF1A-AS1 regulates proliferation and migration in oesophageal adenocarcinoma cells. Gut. 63:881–890. 2014. View Article : Google Scholar : PubMed/NCBI

37 

Xing CY, Hu XQ, Xie FY, Yu ZJ, Li HY, Bin-Zhou, Wu JB, Tang LY and Gao SM: Long non-coding RNA HOTAIR modulates c-KIT expression through sponging miR-193a in acute myeloid leukemia. FEBS Lett. 589:1981–1987. 2015. View Article : Google Scholar : PubMed/NCBI

38 

Morlando M, Ballarino M and Fatica A: Long non-coding RNAs: New players in hematopoiesis and leukemia. Front Med (Lausanne). 2:232015.PubMed/NCBI

39 

Emmrich S, Streltsov A, Schmidt F, Thangapandi VR, Reinhardt D and Klusmann JH: LincRNAs MONC and MIR100HG act as oncogenes in acute megakaryoblastic leukemia. Mol Cancer. 13:1712014. View Article : Google Scholar : PubMed/NCBI

40 

Muratovska A, Zhou C, He S, Goodyer P and Eccles MR: Paired-box genes are frequently expressed in cancer and often required for cancer cell survival. Oncogene. 22:7989–7997. 2003. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Bahari G, Hashemi M, Naderi M, Sadeghi‑Bojd S and Taheri M: Long non‑coding RNA PAX8‑AS1 polymorphisms increase the risk of childhood acute lymphoblastic leukemia. Biomed Rep 8: 184-190, 2018.
APA
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., & Taheri, M. (2018). Long non‑coding RNA PAX8‑AS1 polymorphisms increase the risk of childhood acute lymphoblastic leukemia. Biomedical Reports, 8, 184-190. https://doi.org/10.3892/br.2017.1028
MLA
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., Taheri, M."Long non‑coding RNA PAX8‑AS1 polymorphisms increase the risk of childhood acute lymphoblastic leukemia". Biomedical Reports 8.2 (2018): 184-190.
Chicago
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., Taheri, M."Long non‑coding RNA PAX8‑AS1 polymorphisms increase the risk of childhood acute lymphoblastic leukemia". Biomedical Reports 8, no. 2 (2018): 184-190. https://doi.org/10.3892/br.2017.1028
Copy and paste a formatted citation
x
Spandidos Publications style
Bahari G, Hashemi M, Naderi M, Sadeghi‑Bojd S and Taheri M: Long non‑coding RNA PAX8‑AS1 polymorphisms increase the risk of childhood acute lymphoblastic leukemia. Biomed Rep 8: 184-190, 2018.
APA
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., & Taheri, M. (2018). Long non‑coding RNA PAX8‑AS1 polymorphisms increase the risk of childhood acute lymphoblastic leukemia. Biomedical Reports, 8, 184-190. https://doi.org/10.3892/br.2017.1028
MLA
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., Taheri, M."Long non‑coding RNA PAX8‑AS1 polymorphisms increase the risk of childhood acute lymphoblastic leukemia". Biomedical Reports 8.2 (2018): 184-190.
Chicago
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., Taheri, M."Long non‑coding RNA PAX8‑AS1 polymorphisms increase the risk of childhood acute lymphoblastic leukemia". Biomedical Reports 8, no. 2 (2018): 184-190. https://doi.org/10.3892/br.2017.1028
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team