The impact of single‑nucleotide polymorphisms on liver stiffness and controlled attenuation parameter in patients treated with direct‑acting antiviral drugs for hepatitis C infection
- Authors:
- Published online on: December 7, 2021 https://doi.org/10.3892/br.2021.1492
- Article Number: 9
-
Copyright: © Matsumoto et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
Research on genome-wide association analyses and the association of single-nucleotide polymorphisms (SNPs) with various diseases have seen great advances (1). The association between the pathophysiology of chronic liver disease and SNPs has also been reported. Patatin-like phospholipase domain-containing 3 (PNPLA3) rs738409 (2-4), tolloid-like protein 1 (TLL1) rs17047200 (5-7) and interleukin-28B (IL28b) rs809917 (8-14) are associated with liver fibrosis, inflammation and steatosis in hepatitis C virus (HCV)-infected patients.
Liver biopsy is considered the gold standard for evaluating liver histology, including steatosis, inflammation and fibrosis; however, it is an invasive procedure that can cause various complications such as pain, fever, and bleeding (15). To address this limitation, FibroScan and Virtual Touch tissue quantification (VTTQ) were developed as modalities for the non-invasive assessment of liver fibrosis (16,17). In addition, FibroScan includes software for assessing hepatic steatosis using controlled attenuation parameter (CAP) (16). These modalities can be used to repeatedly evaluate liver steatosis, inflammation and fibrosis.
Hepatitis C is a disease that causes cirrhosis and hepatocellular carcinoma. It is estimated that 177.5 million individuals worldwide are infected with HCV, which is 2.5% of the world's population (17). HCV infection poses a significant risk of cirrhosis and liver cancer. Originally, interferon-based treatment was used as the treatment for HCV, but the elimination rate of HCV was low, and adverse events frequently appeared (18). Direct-acting antivirals (DAAs) have been used as a treatment for HCV, and a high treatment success rate has been reported (19). Ogasawara et al (20) reported the influence of DAA therapy on liver stiffness (LS) and CAP, finding that the treatment of HCV with DAA decreases LS and increases CAP after treatment. Therefore, in this study, the impact of three SNPs (PNPLA3, TLL1 and IL28B) on changes in CAP and LS following DAA therapy were examined.
Materials and methods
Patients
A total of 78 seven patients (39 females and 38 males; median age, 68 years; age range, 33-88 years) who received DAA therapy for chronic HCV infection at Nagasaki University Hospital (Nagasaki, Japan) and were subsequently confirmed as HCV-negative 12 weeks after the end of treatment [sustained virologic response (SVR12)] between September 2014 and December 2017 were enrolled in the study.
The patients' profiles and the results of laboratory data at the start of DAA therapy are summarized in Table I. Written informed consent was obtained from all patients, and the study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki (21). This study was approved by the Ethics Committee of Nagasaki University (approval no. 15012688-3).
Measurement of LS and CAP
LS was measured twice, at the baseline (before DAA therapy) and 12 weeks after the end of the treatment (sustained virologic response, 12 weeks after the end of direct-acting antiviral treatment; SVR12). LS was measured by VTTQ [LS (VTTQ)] using an ACUSON S2000 (Siemens AG) and by transient elastography with the M-probe of FibroScan 502 Touch (Echosens) [LS (FibroScan)]. The CAP was also measured using FibroScan. The patient was examined in a supine position with their right arm raised. The tip of the probe was placed on the skin of the patient between the ribs and the right lobe of the liver. For VTTQ measurement, the region of interest was located 2-4 cm under the capsule in the right lobe to avoid major blood vessels. Measurements were taken five times and the median was used for analysis. The LS results after VTTQ are presented as m/s (22). For FibroScan measurement, the probe was placed on the skin between the ribs and aimed at a location similar to that used for VTTQ. Measurements were taken 10 times, and the median was used for analysis. The LS results after FibroScan are presented as kPa, and CAP results are presented as dB/m (23,24).
SNP genotyping
Genomic DNA was extracted from mononuclear cells in peripheral blood samples of each patient using a FlexiGene DNA kit (Qiagen GmbH). The SNPs in PNPLA3, TLL1 and IL28B were genotyped in each sample using TaqMan SNP genotyping assays kit (Thermo Fisher Scientific, Inc.) containing two allele-specific TaqMan MGB probes labeled with different fluorochromes and a PCR primer pair according to the manufacturer's protocol. The following primers were used: PNPLA3 rs738409, AGGCCTTGGTATGTTCCTGCTTCAT[C/G]CCCTTCTACAGTGGCCTTATCCCTC (cat. no. 4351379); TLL1 rs17047200, TTTTGCCCACTTATGTCCATTTCAC[A/T]GTTCATTGACATCTATTTCTGAAGG (cat. no. 4351379); IL28B rs8099917, TTTTGTTTTCCTTTCTGTGAGCAAT[G/T]TCACCCAAATTGGAACCATGCTGTA (cat. no. 4351379). As an example, the data for PNPLA3 are shown in Fig. S1. The protocol was the same as that described in a previous study (25).
Statistical analysis
Data are presented as the median (inter-quartile range). Pre- and post-treatment data were analyzed by a Wilcoxon signed-rank test. P<0.05 was considered to indicate a statistically significant difference. Statistical analysis was performed using the StatFlex software (version 6.0; Artech).
Results
Whole group analysis
Fig. 1 shows the changes in LS (VTTQ), LS (FibroScan) and CAP from before treatment and at SVR12. In the whole group, the median LS (VTTQ) values decreased significantly (P=0.006) from 1.33 to 1.21 m/s from the start of the treatment to SVR12. The median LS (FibroScan) values decreased significantly (P=0.017) from 6.10 to 5.80 kPa, and the median CAP values increased significantly (P=0.048) from 210 to 226 dB/m.
The PNPLA3 genotype frequencies were as follows: CC, 32 patients (42%); CG, 30 patients (39%); and GG, 15 patients (19%). The TLL1 genotype frequencies were as follows: AA, 57 patients (74%); AT, 20 patients (26%); and TT, no patients (0%). The IL28B genotype frequencies were as follows: TT, 57 patients (74%); TG, 18 patients (23%); and GG, two patients (3%). We divided PNPLA3 into CC and CG/GG groups, TLL1 into AA and AT(/TT) groups, and IL28B into TT and TG/GG groups.
Changes in LS (VTTQ)
Fig. 2 shows the changes in the LS (VTTQ) for each SNP. In PNPLA3, the median values of CC decreased significantly (P=0.035) from 1.39 to 1.19 m/s. The median values of CG/GG did not change significantly from 1.31 to 1.25 m/s. Even after dividing CG/GG genotypes into CG and GG, no significant difference was found between CG and GG. In TLL1, the median values of AA decreased significantly (P=0.011) from 1.31 to 1.19 m/s. The median values of AT did not change significantly from 1.43 to 1.26 m/s. In IL28B, the median values of TT decreased significantly (P=0.005) from 1.36 to 1.19 m/s. The median values of TG/GG did not change significantly from 1.31 to 1.36 m/s.
Changes in LS (FibroScan)
Fig. 3 shows changes in LS (FibroScan) for each SNP. In PNPLA3, the median values of CC decreased from 6.15 kPa before treatment to 5.75 kPa at SVR12, but the decrease was not significant. The median values of CG/GG did not change significantly from 6.10 to 5.80 kPa. Even after dividing CG/GG into CG and GG, no significant difference was found between CG and GG. In TLL1, the median values of AA decreased significantly (P=0.028) from 6.10 to 5.75 kPa. The median values of AT did not change significantly from 6.60 to 5.10 kPa. In IL28B, the median values of TT decreased significantly (P=0.032) from 6.10 to 5.50 kPa. The median values of TG/GG did not change significantly from 6.70 to 7.40 kPa.
Changes in CAP
Fig. 4 shows the changes in CAP for each SNP. In PNPLA3, the median values of CC did not change significantly from 217 to 209 dB/m. The median values of CG/GG increased significantly (P=0.004) from 204 to 233 dB/m. After dividing CG/GG into CG and GG, both CG (P=0.039) and GG (P<0.05) increased significantly. In TLL1, the median values of AA did not change significantly from 207 to 226 dB/m. The median values of AT did not change significantly from 215 to 225 dB/m. In IL28B, the median values of TT increased significantly (P=0.014) from 213 to 226 dB/m. The median values of TG/GG did not change significantly from 206 to 218 dB/m.
Discussion
In this study, the impact of SNPs on changes in LS and CAP after DAA therapy in patients with HCV infection were determined. LS was evaluated using VTTQ and FibroScan, and CAP was evaluated using FibroScan. LS (VTTQ) and LS (FibroScan) significantly decreased, and CAP significantly increased at SVR12 in all cases. These results are consistent with those of a previous study (20). LS reflects liver fibrosis staging and liver inflammation; therefore, a decrease in LS indicates an improvement in fibrosis and inflammation.
PNPLA3 rs738409 is considered a risk factor for liver steatosis, fibrosis progression, and the development of hepatocellular carcinoma in patients with non-alcoholic fatty liver disease (26,27). Moreover, a previous study reported that PNPLA3 is a significant risk factor for steatosis, inflammation and fibrosis in patients with hepatitis C (2-4). Furthermore, PNPLA3 is reportedly involved in lipase activity, and a C to G substitution causes an amino acid substitution from isoleucine to methionine at position 148 of the coding sequence (I148M), with the resulting loss of function possibly involved in hepatic steatosis. It is also possible that I148M affects the activation of hepatic stellate cells related to fibrosis; however, the associated mechanism has not yet been elucidated (2-4). Previous studies suggested that TLL1 rs17047200 may contribute to hepatocarcinogenesis through the progression of liver fibrosis and that the AT/TT genotype is a risk factor for the development of HCC after SVR (5-7). Furthermore, TLL1 may be involved in the development of hepatic fibrosis through extracellular matrix production and TGF-β signal activation (5-7). Another report indicated that SNPs located close to IL28B significantly influenced the therapeutic outcome of combination therapy involving pegylated IFN and ribavirin in HCV-infected patients (28). Additionally, liver fibrosis is reportedly exacerbated by the minor (14) and major alleles (8,13) of IL28B rs80991, with a previous report suggesting that changes in the IL28B allele alter the expression levels of IFN-stimulating genes, including some inflammatory cytokines, and may be involved in fibrosis. Moreover, increased IFN expression reportedly suppresses lipoprotein lipase activity and reduces very-low-density lipoprotein levels through low-density lipoprotein conversion, which may be involved in hepatic steatosis (8,13). These findings suggest the involvement of these SNPs in steatosis, inflammation and fibrosis in patients with chronic hepatitis, and the observed changes in LS and CAP in this study are consistent with previous findings.
Previous studies showed that HCV eradication by IFN and DAA therapy led to downstaging of fibrosis and reduced HCC incidence, particularly in patients who achieved SVR (29-31). However, HCC development can occur even in patients with SVR, and the major risk factors include older age, alcohol intake, pathological factors and diabetes (32-35). Motoyama et al (36) reported that stagnation of fibrosis regression is associated with a high risk of HCC development after SVR. Additionally, liver steatosis is reportedly a risk factor for HCC development after SVR (37). Given these findings, elevations in LS and CAP following DAA may represent a risk factor for HCC development. Therefore, patients found to possess these risk alleles need careful follow-ups with their doctors considering the risk of HCC.
In the present study, median LS (VTTQ) and LS (FibroScan) increased after treatment in IL28B TG/GG patients, although no significant difference was observed. After treatment, LS (VTTQ) increased in 26 out of 77 cases, and LS (FibroScan) increased in 29 out of 77 cases. Of the 20 cases of IL28B TG/GG, 7 cases exhibited an increase in LS (VTTQ) and 8 cases exhibited an increase in LS (FibroScan). Further analysis is difficult due to the small number of cases, and it is necessary to investigate whether IL28B TG/GG exacerbates fibrosis after DAA treatment using a larger cohort. The median decrease in CAP for PNPLA3 CC showed a similar result; therefore, this should be investigated using a larger cohort further.
In PNPLA3 CC, the value of LS (VTTQ) decreased significantly after treatment, but there was no significant difference in LS (FibroScan). However, the post-treatment value of LS (FibroScan) apparently showed a downward trend, and therefore, it is necessary to investigate whether this trend may be significant with a larger cohort.
In addition, as LS levels are affected by inflammation, it may be useful to compare the parameters immediately after treatment and 3 months after treatment. However, it was difficult to compare these because the protocol of this survey did not include the measurement of the LS value immediately after the treatment. In future studies, the parameters should be measured immediately after treatment as well.
The present study has certain limitations. The study was conducted in a single center, and the sample size was small. To validate the results observed in this study, a larger number of samples should be investigated in the future. Additionally, this study had a short observation period; therefore, it will be necessary to consider longer observation periods in future studies. Moreover, transient elastography was performed using only the M-probe, which is intended for patients whose distance from the measurement position on the skin to the liver is <25 mm, suggesting a possible disadvantage in that measurement errors are more likely at distances of ≥25 mm. An XL probe can be used for such patients (38).
In conclusion, the results suggested that certain SNPs were associated with the changes in liver fibrosis and steatosis after DAA treatment for HCV infection.
Supplementary Material
TaqMan SNP genotyping of the PNPLA3 gene. Vertical axis is the FAM C allele; horizontal axis is VIC G allele. SNP, single nucleotide polymorphism; PNPLA3, patatin-like phospholipase domain-containing 3; VIC, Victoria dye; FAM, fluorescein amidites.
Acknowledgements
Not applicable.
Funding
Funding: No funding was received.
Availability of data and materials
The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.
Authors' contributions
KM was involved in data curation, formal analysis, investigation and of writing the original draft. HM was involved in conceptualization, methodology and project administration. MF, RS, MH and SM were involved in data curation and formal analysis. KN was involved in data curation and supervision. All authors have read and approved the final manuscript. KM and HM confirm the authenticity of all the raw data.
Ethics approval and consent to participate
Written informed consent was obtained from all patients. This study was approved by the Ethics Committee of Nagasaki University (Nagasaki, Japan; approval no. 15012688-3).
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
|
Li R, Li Y, Fang X, Yang H and Wang J, Kristiansen K and Wang J: SNP detection for massively parallel whole-genome resequencing. Genome Res. 19:1124–1132. 2009.PubMed/NCBI View Article : Google Scholar | |
|
Sato M, Kato N, Tateishi R, Muroyama R, Kowatari N, Li W, Goto K, Otsuka M, Shiina S, Yoshida H, et al: Impact of PNPLA3 polymorphisms on the development of hepatocellular carcinoma in patients with chronic hepatitis C virus infection. Hepatol Res. 44:E137–E144. 2014.PubMed/NCBI View Article : Google Scholar | |
|
Yasui K, Kawaguchi T, Shima T, Mitsuyoshi H, Seki K, Sendo R, Mizuno M, Itoh Y, Matsuda F and Okanoue T: Effect of PNPLA3 rs738409 variant (I148 M) on hepatic steatosis, necroinflammation, and fibrosis in Japanese patients with chronic hepatitis C. J Gastroenterol. 50:887–893. 2015.PubMed/NCBI View Article : Google Scholar | |
|
Crisan D, Grigorescu M, Crisan N, Craciun R, Lupsor M, Radu C, Grigorescu MD, Suciu A, Epure F, Avram L and Leach N: Association between PNPLA3[G]/I148M variant, steatosis and fibrosis stage in hepatitis C virus-genetic matters. J Physiol Pharmacol. 70:2019.PubMed/NCBI View Article : Google Scholar | |
|
Matsuura K, Sawai H, Ikeo K, Ogawa S, Iio E, Isogawa M, Shimada N, Komori A, Toyoda H, Kumada T, et al: Genome-wide association study identifies TLL1 variant associated with development of hepatocellular carcinoma after eradication of hepatitis C virus infection. Gastroenterology. 152:1383–1394. 2017.PubMed/NCBI View Article : Google Scholar | |
|
Huang CF, Yeh ML, Huang CI, Lin ZY, Chen SC, Huang JF, Dai CY, Chuang WL, Chen JJ and Yu ML: Tolloid-like 1 genetic variants determine fibrosis regression in chronic hepatitis C patients with curative antivirals. Sci Rep. 8(15058)2018.PubMed/NCBI View Article : Google Scholar | |
|
Iio E, Matsuura K, Shimada N, Atsukawa M, Itokawa N, Abe H, Kato K, Takaguchi K, Senoh T, Eguchi Y, et al: TLL1 variant associated with development of hepatocellular carcinoma after eradication of hepatitis C virus by interferon-free therapy. J Gastroenterol. 54:339–346. 2019.PubMed/NCBI View Article : Google Scholar | |
|
Abe H, Ochi H, Maekawa T, Hayes CN, Tsuge M, Miki D, Mitsui F, Hiraga N, Imamura M, Takahashi S, et al: Common variation of IL28 affects gamma-GTP levels and inflammation of the liver in chronically infected hepatitis C virus patients. J Hepatol. 53:439–443. 2010.PubMed/NCBI View Article : Google Scholar | |
|
Bochud PY, Bibert S, Negro F, Haagmans B, Soulier A, Ferrari C, Missale G, Zeuzem S, Pawlotsky JM, Schalm S, et al: IL28B polymorphisms predict reduction of HCV RNA from the first day of therapy in chronic hepatitis C. J Hepatol. 55:980–988. 2011.PubMed/NCBI View Article : Google Scholar | |
|
Kurosaki M, Tanaka Y, Nishida N, Sakamoto N, Enomoto N, Honda M, Sugiyama M, Matsuura K, Sugauchi F, Asahina Y, et al: Pre-treatment prediction of response to pegylated-interferon plus ribavirin for chronic hepatitis C using genetic polymorphism in IL28B and viral factors. J Hepatol. 54:439–448. 2011.PubMed/NCBI View Article : Google Scholar | |
|
Ohnishi M, Tsuge M, Kohno T, Zhang Y, Abe H, Hyogo H, Kimura Y, Miki D, Hiraga N, Imamura M, et al: IL28B polymorphism is associated with fatty change in the liver of chronic hepatitis C patients. J Gastroenterol. 47:834–844. 2012.PubMed/NCBI View Article : Google Scholar | |
|
Asahina Y, Tsuchiya K, Nishimura T, Muraoka M, Suzuki Y, Tamaki N, Yasui Y, Hosokawa T, Ueda K, Nakanishi H, et al: Genetic variation near interleukin 28B and the risk of hepatocellular carcinoma in patients with chronic hepatitis C. J Gastroenterol. 49:1152–1162. 2014.PubMed/NCBI View Article : Google Scholar | |
|
Sato M, Kondo M, Tateishi R, Fujiwara N, Kato N, Yoshida H, Taguri M and Koike K: Impact of IL28B genetic variation on HCV-induced liver fibrosis, inflammation, and steatosis: A meta-analysis. PLoS One. 9(e91822)2014.PubMed/NCBI View Article : Google Scholar | |
|
Tamaki N, Kurosaki M, Higuchi M, Takada H, Nakakuki N, Yasui Y, Suzuki S, Tsuchiya K, Nakanishi H, Itakura J, et al: Genetic polymorphisms of IL28B and PNPLA3 are predictive for HCV related rapid fibrosis progression and identify patients who require urgent antiviral treatment with new regimens. PLoS One. 10(e0137351)2015.PubMed/NCBI View Article : Google Scholar | |
|
Myers RP, Fong A and Shaheen AA: Utilization rates, complications and costs of percutaneous liver biopsy: A population-based study including 4275 biopsies. Liver Int. 28:705–712. 2008.PubMed/NCBI View Article : Google Scholar | |
|
Sasso M, Beaugrand M, de Ledinghen V, Douvin C, Marcellin P, Poupon R, Sandrin L and Miette V: Controlled attenuation parameter (CAP): A novel VCTE™ guided ultrasonic attenuation measurement for the evaluation of hepatic steatosis: Preliminary study and validation in a cohort of patients with chronic liver disease from various causes. Ultrasound Med Biol. 36:1825–1835. 2010.PubMed/NCBI View Article : Google Scholar | |
|
Petruzziello A, Marigliano S, Loquercio G, Cozzolino A and Cacciapuoti C: Global epidemiology of hepatitis C virus infection: An up-date of the distribution and circulation of hepatitis C virus genotypes. World J Gastroenterol. 22:7824–7840. 2016.PubMed/NCBI View Article : Google Scholar | |
|
Attar BM and Van Thiel DH: Hepatitis C virus: A time for decisions. Who should be treated and when? World J Gastrointest Pharmacol Ther. 7:33–40. 2016.PubMed/NCBI View Article : Google Scholar | |
|
Leroy V, Angus P, Bronowicki JP, Dore GJ, Hezode C, Pianko S, Pol S, Stuart K, Tse E, McPhee F, et al: Daclatasvir, sofosbuvir, and ribavirin for hepatitis C virus genotype 3 and advanced liver disease: A randomized phase III study (ALLY-3+). Hepatology. 63:1430–1441. 2016.PubMed/NCBI View Article : Google Scholar | |
|
Ogasawara N, Kobayashi M, Akuta N, Kominami Y, Fujiyama S, Kawamura Y, Sezaki H, Hosaka T, Suzuki F, Saitoh S, et al: Serial changes in liver stiffness and controlled attenuation parameter following direct-acting antiviral therapy against hepatitis C virus genotype 1b. J Med Virol. 90:313–319. 2018.PubMed/NCBI View Article : Google Scholar | |
|
World Medical Association: World medical association declaration of Helsinki. Ethical principles for medical research involving human subjects. JAMA. 310:2191–2194. 2013.PubMed/NCBI View Article : Google Scholar | |
|
Bamber J, Cosgrove D, Dietrich CF, Fromageau J, Bojunga J, Calliada F, Cantisani V, Correas JM, D'Onofrio M, Drakonaki EE, et al: EFSUMB guidelines and recommendations on the clinical use of ultrasound elastography. Part 1: Basic principles and technology. Ultraschall Med. 34:169–184. 2013.PubMed/NCBI View Article : Google Scholar | |
|
Boursier J, Zarski JP, de Ledinghen V, Rousselet MC, Sturm N, Lebail B, Fouchard-Hubert I, Gallois Y, Oberti F, Bertrais S, et al: Determination of reliability criteria for liver stiffness evaluation by transient elastography. Hepatology. 57:1182–1191. 2013.PubMed/NCBI View Article : Google Scholar | |
|
Kumagai E, Korenaga K, Korenaga M, Imamura M, Ueyama M, Aoki Y, Sugiyama M, Murata K, Masaki N, Kanto T, et al: Appropriate use of virtual touch quantification and FibroScan M and XL probes according to the skin capsular distance. J Gastroenterol. 51:496–505. 2016.PubMed/NCBI View Article : Google Scholar | |
|
De la Vega FM, Lazaruk KD, Rhodes MD and Wenz MH: Assessment of two flexible and compatible SNP genotyping platforms: TaqMan SNP genotyping assays and the SNPlex genotyping system. Mutat Res. 573:111–135. 2005.PubMed/NCBI View Article : Google Scholar | |
|
Romeo S, Kozlitina J, Xing C, Pertsemlidis A, Cox D, Pennacchio LA, Boerwinkle E, Cohen JC and Hobbs HH: Genetic variation in PNPLA3 confers susceptibility to nonalcoholic fatty liver disease. Nat Genet. 40:1461–1465. 2008.PubMed/NCBI View Article : Google Scholar | |
|
Seko Y, Sumida Y, Tanaka S, Mori K, Taketani H, Ishiba H, Hara T, Okajima A, Umemura A, Nishikawa T, et al: Development of hepatocellular carcinoma in Japanese patients with biopsy-proven non-alcoholic fatty liver disease: Association between PNPLA3 genotype and hepatocarcinogenesis/fibrosis progression. Hepatol Res. 47:1083–1092. 2017.PubMed/NCBI View Article : Google Scholar | |
|
Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, Nakagawa M, Korenaga M, Hino K, Hige S, et al: Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet. 41:1105–1109. 2009.PubMed/NCBI View Article : Google Scholar | |
|
Morgan TR, Ghany MG, Kim HY, Snow KK, Shiffman ML, De Santo JL, Lee WM, Di Bisceglie AM, Bonkovsky HL, Dienstag JL, et al: Outcome of sustained virological responders with histologically advanced chronic hepatitis C. Hepatology. 52:833–844. 2010.PubMed/NCBI View Article : Google Scholar | |
|
Kanwal F, Kramer J, Asch SM, Chayanupatkul M, Cao Y and El-Serag HB: Risk of hepatocellular cancer in HCV patients treated with direct-acting antiviral agents. Gastroenterology. 153:996–1005.e1. 2017.PubMed/NCBI View Article : Google Scholar | |
|
Ogata F, Kobayashi M, Akuta N, Osawa M, Fujiyama S, Kawamura Y, Sezaki H, Hosaka T, Kobayashi M, Saitoh S, et al: Outcome of all-oral direct-acting antiviral regimens on the rate of development of hepatocellular carcinoma in patients with hepatitis C virus genotype 1-related chronic liver disease. Oncology. 93:92–98. 2017.PubMed/NCBI View Article : Google Scholar | |
|
Makiyama A, Itoh Y, Kasahara A, Imai Y, Kawata S, Yoshioka K, Tsubouchi H, Kiyosawa K, Kakumu S, Okita K, et al: Characteristics of patients with chronic hepatitis C who develop hepatocellular carcinoma after a sustained response to interferon therapy. Cancer. 101:1616–1622. 2004.PubMed/NCBI View Article : Google Scholar | |
|
Asahina Y, Tsuchiya K, Nishimura T, Muraoka M, Suzuki Y, Tamaki N, Yasui Y, Hosokawa T, Ueda K, Nakanishi H, et al: α-Fetoprotein levels after interferon therapy and risk of hepatocarcinogenesis in chronic hepatitis C. Hepatology. 58:1253–1262. 2013.PubMed/NCBI View Article : Google Scholar | |
|
El-Serag HB, Kanwal F, Richardson P and Kramer J: Risk of hepatocellular carcinoma after sustained virological response in Veterans with hepatitis C virus infection. Hepatology. 64:130–137. 2016.PubMed/NCBI View Article : Google Scholar | |
|
Ioannou GN, Green PK, Beste LA, Mun EJ, Kerr KF and Berry K: Development of models estimating the risk of hepatocellular carcinoma after antiviral treatment for hepatitis C. J Hepatol. 69:1088–1098. 2018.PubMed/NCBI View Article : Google Scholar | |
|
Motoyama H, Tamori A, Kubo S, Uchida-Kobayashi S, Takemura S, Tanaka S, Ohfuji S, Teranishi Y, Kozuka R, Kawamura E, et al: Stagnation of histopathological improvement is a predictor of hepatocellular carcinoma development after hepatitis C virus eradication. PLoS One. 13(e0194163)2018.PubMed/NCBI View Article : Google Scholar | |
|
Tanaka A, Uegaki S, Kurihara H, Aida K, Mikami M, Nagashima I, Shiga J and Takikawa H: Hepatic steatosis as a possible risk factor for the development of hepatocellular carcinoma after eradication of hepatitis C virus with antiviral therapy in patients with chronic hepatitis C. World J Gastroenterol. 13:5180–5187. 2007.PubMed/NCBI View Article : Google Scholar | |
|
Myers RP, Pomier-Layrargues G, Kirsch R, Pollett A, Duarte-Rojo A, Wong D, Beaton M, Levstik M, Crotty P and Elkashab M: Feasibility and diagnostic performance of the FibroScan XL probe for liver stiffness measurement in overweight and obese patients. Hepatology. 55:199–208. 2012.PubMed/NCBI View Article : Google Scholar |
