Open Access

Roscovitine protects murine Leydig cells from lipopolysaccharide-induced inflammation

  • Authors:
    • Tiancheng Xie
    • Guanghui Hu
    • Binbin Dong
    • Yangye Yan
    • Min Liu
    • Xudong Yao
    • Junhua Zheng
    • Yunfei Xu
  • View Affiliations

  • Published online on: March 20, 2017     https://doi.org/10.3892/etm.2017.4239
  • Pages: 2169-2176
  • Copyright: © Xie et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Roscovitine is a cyclin-dependent kinase inhibitor, which has been previously investigated for its anticancer effects. It has also been confirmed that roscovitine can downregulate the expression of myeloid cell leukemia‑1 protein to inhibit inflammation. In the present study, roscovitine was used to treat inflammation in lipopolysaccharide (LPS)-induced model mice. At the cellular level, Leydig cells isolated from mouse testis were assessed for inflammatory factors. It was revealed that roscovitine successfully reduced inflammation‑associated injury induced by LPS pretreatment. At the molecular level, roscovitine was found to exert this effect through promotion of adenosine monophosphate-activated protein kinase phosphorylation. To the best of our knowledge, the present study was the first to suggest that roscovitine has a protective role in Leydig cells through its anti-inflammatory action.

Introduction

As novel cancer-targeting drugs, cyclin-dependent kinase (CDK) inhibitors are highly anticipated (1). Over the past decade, numerous studies have implicated roscovitine as an anticancer drug with promising therapeutic properties (2). Roscovitine was found to inhibit cell division control protein 2, cdk2 or cdk5 kinase activities (3,4), and was shown to directly inhibit nuclear factor-κb activation in cancer cell lines (5).

Additional studies have demonstrated further properties of cyclin-dependent kinase inhibitors (6) or roscovitine (7); for instance, roscovitine downregulated the expression of myeloid cell leukemia (Mcl)-1 protein, which is likely involved in inflammatory processes (7). Other studies have shown that upregulation of adenosine monophosphate-activated protein kinase (AMPK) activation also inhibited the expression of Mcl-1 (810). AMPK is an important regulator of energy homeostasis in cells. In recent years, studies have demonstrated that AMPK has an important role in modulating inflammation in inflammatory pulmonary diseases, including asthma, pulmonary infectious diseases and pulmonary fibrosis (1114). These results suggested that roscovitine may have anti-inflammatory effects; while it has remained elusive whether it also inhibits inflammation in murine Leydig cells.

Leydig cells are distributed in the loose connective tissue between seminiferous tubules. The main function of Leydig cells is the synthesis and secretion of androgen, which has important roles in male reproductive function (15). Inflammation can affect the normal function of Leydig cells (16). Lipopolysaccharide (LPS) was used to establish a mouse model of inflammation (17) and the testes were collected to investigate the effects of roscovitine on murine testis inflammation.

Materials and methods

Animals and ethics statement

A total of 16, 2-month-old male C57BL/6 mice (four groups, n=4 each group, weight range from 20–25 g) were obtained from the Shanghai Laboratory Animal Company (Shanghai, China). The mice were housed at 21±2°C with 55±10% humidity under a 12-h light/dark cycle. Chow and water were available ad libitum. All animal procedures were reviewed and approved by the Animal Care Committee of Tongji University (Shanghai, China).

Experimental groups

Mice were divided into four groups (n=4 each): Control group, case group, LPS group and dimethylsulfoxide (DMSO) group. In the case group, each mouse was injected i.p. with roscovitine (S1153; Selleck Chemicals, Houston, TX, USA) at 5 mg/kg dissolved in DMSO (Sigma-Aldrich, Merck Millipore, Darmstadt, Germany), and LPS (Sigma-Aldrich, Merck Millipore) at 3 mg/kg dissolved in saline (0.9% NaCl). Animals in the LPS group received LPS only (5 mg/kg). Animals in the DMSO and control groups only received equivalent volumes of DMSO and saline, respectively. After 12 h, mice were sacrificed by carbon dioxide anesthesia (SMQ-II; Tianhuan Technology, Co., Ltd., Shanghai, China) with a final concentration of 80–100% CO2 in a cage 730×560×600 mm in size. Mortality was confirmed following 5 min of observation. Venous blood was collected from the caudal vein and the testis was removed for further examination.

Behavior and weight of mice

The behavior of the mice was observed and recorded prior to and after drug treatment, and the mice were weighed using an electronic balance at the same time-points.

Observation of histological changes

Mouse testis were fixed at room temperature by soaking overnight in 2% paraformaldehyde and transferred by gradient ethanol (from 50 to 100%) and embedded into paraffin. Sections were sliced to 5 µm and stained with hematoxylin and eosin. Tissue sections were also stained immunohistochemically to observe specific expression of 3β-hydroxysteroid dehydrogenase (3β-HSD) in testis tissue after the indicated treatments. The dilution ratio of Anti-HSD3B1 antibody (catalogue no. ab55268; Abcam, Cambridge, UK) was 1:1,000. Histology of testicular tissues was observed by light microscopy (Eclipse E100, Nikon, Tokyo, Japan).

Serum testosterone levels

Venous blood was extracted from the mice and blood was allowed to coagulate for 12 h at room temperature, followed by centrifugation for 10 min at 4°C at 1006.2 × g (Centrifuge 5408R; Eppendorf, Hamburg, Germany). The upper serum layer was assessed using an ELISA kit (cat. no. YC30087; Yuanchuang Bio-Chemical Co., Ltd., Shanghai, China) to quantify testosterone levels according to the manufacturer's instructions.

Cell culture and reagents

Mouse testes were collected to extract primary Leydig cells for RNA and protein isolation. Furthermore, Leydig cells were isolated and maintained in Dulbecco's modified Eagle's medium (Sigma-Aldrich, Merck-Millipore) supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), 100 U/ml penicillin and 100 µg/ml streptomycin (18).

RNA analysis by reverse-transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA from cells was extracted using TRIzol (Life Technologies, Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. RNA samples were reverse-transcribed into complementary DNA using the Mx3005P qPCR system (Agilent Technologies, Inc., Santa Clara, CA, USA). The PCR reaction was completed as follows: 94°C for 5 min followed by 94°C for 30 sec, 55–58°C for 30 sec, 72°C for 30 sec-1 min and 70°C for 10 min at 4°C for 30 cycles. PCR reaction mixtures contained 10 ml SYBR Green Premix Ex Taq (Takara Bio Inc., Dalian, China). Relative gene expression levels were normalized to GAPDH mRNA levels in each sample. Melting curve analysis for each primer set revealed only one peak for each product. The Applied Biosystems 7900HT fast real-time system (Thermo Fisher Scientific, Inc.) was used. Primer sequences are listed in Table I (Takara, Dalian, China) (19) and quantification was completed using the 2(−Delta Delta C(T)) method (20).

Table I.

Primer sequences used for PCR.

Table I.

Primer sequences used for PCR.

GenePrimer (5′-3′)
Hsd17b3F: ATTTTACCAGAGAAGACATCT
R: GGGGTCAGCACCTGAATAATG
Cyp17a1F: CCAGGACCCAAGTGTGTTCT
R: CCTGATACGAAGCACTTCTCG
Cyp11a1F: AGGTGTAGCTCAGGACTTCA
R: AGGAGGCTATAAAGGACACC
Srd5a1F: CACATCCTGCGGAATCTGA
R: TGCTGCCTCGCTCTGGT
Cox2F: TTCAACACACTCTATCACTGGC
R: AGAAGCGTTTGCGGTACTCAT
iNOSF: GTTCTCAGCCCAACAATACAAGA
R: GTGGACGGGTCGATGTCAC
GAPDHF: AGGTCGGTGTGAACGGATTTG
R: TGTAGACCATGTAGTTGAGGTCA

[i] F, forward sequence; R, reverse sequence; hsd, hydroxysteroid dehydrogenase; CYP, cytochrome P450; Srd5a1, steroid 5 alpha-reductase 1; COX, cyclooxygenase; iNOS, inducible nitric oxide synthase.

Western blot analysis

After the indicated treatments, Leydig cells were lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM EDTA, 1 mM phenylmethane sulfonyl fluoride and 1% Triton X-100). Samples were fractionated by 12% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Millipore Corp., Bedford, MA, USA). The membranes were blocked with 10% nonfat milk and incubated at room temperature with primary antibodies for 2 h, followed by incubation with horseradish peroxidase-conjugated secondary antibodies (Li-cor Biosciences, Lincoln).

NE, USA; catalogue no. 926-32211, 926-68021) at a dilution of 1:10,000 at room temperature for 1 h. Images were obtained using Odyssey (LI-COR Biosciences, Lincoln, NE, USA). Membranes were then stripped and re-probed with GAPDH antibody to ensure equal protein loading. TNF-α (D2D4, 1:1,000) and AMPK (catalogue no. 23A3, 1:1,000) antibodies were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA). Interleukin (IL)-1β antibody (catalogue no. CC36131) at a dilution of 1:1,000 was purchased from Bioworld Technology (Nanjing, China). Odyssey infrared imaging system (version 3.0.21; LI-COR Biosciences, Lincoln, NE, USA) was used for densitometry.

Statistical analysis

Values are expressed as the mean ± standard error of the mean. Statistical differences were analyzed with Student's t-test or one-way analysis of variance if there were more than two groups. P<0.05 was considered to indicate a statistically significant difference. Statistical analysis was performed using Statistical Package for Social Sciences (SPSS) version 12.0 (SPSS Inc., Chicago, IL, USA).

Results

Behavior and body weight of mice

The behavior of mice in the LPS group showed obvious changes at 12 h after injection of LPS. They showed less activity and eating, and their body weight was reduced (Fig. 1). In the DMSO and case groups, only minor weight reductions were observed, while no reduction was present in the control group (Fig. 1).

Serum testosterone levels

Venous blood was collected from the mice and serum testosterone levels were detected using an ELISA kit. Testosterone levels were significantly reduced in the LPS group compared to that in the control, with only a minor reduction in the case group and no reduction in the DMSO group (Fig. 2).

Histology of mouse testes

Hematoxylin and eosin staining revealed that the structure of the testis was intact in the control animals (Fig. 3A), with a large number of Leydig cells localized to the gaps between convoluted seminiferous tubules. In the LPS group, the structure of the testis was altered and fewer Leydig cells were present, while the case group treated with roscovitine showed partial rescue of the changes induced by LPS (Fig. 3B and C). There were no obvious morphological changes in the DMSO group (Fig. 3D). In addition, the expression of 3βHSD was observed by immunohistochemical staining (Fig. 4), revealing a marked decrease in the LPS group compared to that in the other groups.

Roscovitine inhibits the expression of proinflammatory cytokines

As roscovitine was observed to exert protective effects on Leydig cells, it was hypothesized that roscovitine inhibits inflammatory and proinflammatory signaling pathways. To examine this hypothesis, western blot and RT-qPCR analyses were performed to detect inflammatory proteins and mRNAs in Leydig cells from mice of the various treatment groups. TNF-α and IL-1β were significantly reduced in the case group compared to the LPS group (Fig. 5A and B).

Roscovitine inhibits inflammation by upregulating AMPK

The western blot analysis results showed an obvious upregulation of AMPK levels in the case group compared to that in the other groups. Compared with the control group, a slight upregulation of AMPK expression was observed in the LPS group as well as a downregulation in the DMSO group (Fig. 5C).

Roscovitine inhibit the pro-inflammatory gene

The protective effect of roscovitine in the case group was further confirmed by the inhibition of the pro-inflammatory genes cyclooxygenase (COX) −2 and inducible nitric oxide synthase (iNOS; Fig. 6A and B).

Roscovitine rescues LPS-induced inhibition of testosterone synthesis gene transcription

RT-qPCR was used to assess the effect of roscovitine on the transcription of the key reproduction-associated genes Hsd17b3, cytochrome P450 (Cyp) 17a1, Cyp11a1 and steroid 5 alpha-reductase 1 (Srd5a1). As shown in Fig. 7, LPS treatment significantly reduced the mRNA levels of each of these genes, while roscovitine partly attenuated these decreases, which was significant for Hsd17b3 and Cyp17a1 (Fig. 7A and B), but not for Cyp11a1 and Srd5a1 (Fig. 7C and D). There was a significant change in Srd5a1 expression in the DMSO group compared with that in the control group (Fig. 7C).

AMPK inhibitor reverses the effect of roscovitine

Leydig cells were induced with TNF-α and pretreated with or without AMPK inhibitor (compound C) for 1 h. Subsequently western blot and RT-qPCR were used to detect changes of the inflammatory factor COX-2. The results revealed that AMPK inhibitor reversed the inhibitory effect of roscovitine (Fig. 8).

Discussion

Inflammation in the male reproductive system has been considered to be one of the causes of male infertility (2123). Infection of the male reproductive system can affect the growth of the testis through direct damage to testicular sperm tissue or lead to the obstruction of sperm delivery ducts (24). Leydig cells are important for the maintenance of male reproductive function. Hong et al (15) found that inflammation can inhibit the function of Leydig cells. Thus, it is important to further study inflammation and anti-inflammatory mechanisms. To explore possible treatments, the present study established an experimental inflammation model in mice employing LPS as the most commonly used reagent for producing inflammation (17). The present study was using this mode following the successful experience of a previous study (19).

As a CDK inhibitor, roscovitine is a compound that competes for adenosine triphosphate binding sites on CDK (25). It has been demonstrated that roscovitine has significant anti-tumor effects (2628) and can downregulate Mcl-1 expression (7). Other studies have confirmed that upregulation of AMPK activation inhibits the expression of Mcl-1 (810). In the present study, it was observed that roscovitine protected mice and their testes from inflammatory injury. Compared with the LPS group, mice in the case group were more active and had less weight reduction following drug treatment. Moreover, LPS induced damage in mouse testes and reduced 3β-HSD expression, which was attenuated by roscovitine. 3β-HSD is a key enzyme regulating dihydrotestosterone generation and is a good marker for Leydig cells (2931).

Serum testosterone levels were then determined in the experimental groups, revealing LPS significantly decreased testosterone levels (P<0.05), with no significant change in the other three groups. Xue et al (32) previously reported that inflammation induced by LPS affects the levels of androgen in the microenvironment. It was therefore speculated that roscovitine may have a protective effect on androgen production in the testis.

Further study using the present inflammation model revealed that roscovitine downregulated the expression of inflammatory factors and proinflammatory genes, including TNF-α, IL-1β, COX-2 and iNOS. Inflammatory cytokines are mainly produced by activated lymphocytes and monocytes and are important in mediating inflammatory responses. Inflammatory cytokines such as IL-1β and TNF-α, secreted by endotoxin and immune complexes, may cause damage via autocrine and paracrine effects. COX-2 is an inducible enzyme similar to ring oxidase. It is highly expressed in inflammatory cells and catalyzes the synthesis of prostaglandin E2 and other products at inflammatory sites to promote an inflammatory reaction resulting in tissue damage. Chen et al (33) found that LPS induced inflammatory reactions in RAW264.7 cells, as well as overexpression of COX-2 and iNOS. Yang et al (34) used LPS to treat microglial cell lines and observed overexpression of COX-2 and iNOS, which was inhibited by application of curcumin.

The pathways via which roscovitine inhibits inflammation were further examined, revealing that the roscovitine-induced overexpression of AMPK was inversely correlated with the production of inflammatory factors. AMPK is a cellular energy regulator. Studies have found that AMPK has a significant inhibitory effect on inflammatory cells, inflammatory factors and inflammation pathways (3540). Therefore, AMPK and its associated signaling may be important pharmacological targets in the treatment of inflammatory diseases.

The present also investigated the expression of reproduction-associated genes in the experimental groups. Hsd17b3 and Cyp17a1 are key enzymes in testosterone synthesis. Yu et al (40) used dibutylphthalate to inhibit the expression of the Cyp17a1 gene, which reduced testicular rostenedione levels and inhibited testosterone synthesis in Leydig cells. A reduction in testosterone was also detected in male mice treated with LPS, and it was suggested that LPS treatment inhibited the expression of testosterone synthase. The results of the present study, showing diminished mRNA levels of Hsd17b3 and Cyp17a1 after LPS exposure, are consistent with this hypothesis. No significant affect was observed for Cyp11a1 and Srd5a1. However, roscovitine was demonstrated to inhibit these LPS-induced reductions.

In conclusion, to the best of our knowledge, the present study was the first to suggest that roscovitine has a protective role against inflammation in murine Leydig cells. The mechanism for these anti-inflammatory actions is likely to involve upregulation of AMPK. Future studies will further explore the specific roles of AMPK and its upstream and downstream signaling in mediating the development of testicular interstitial cell inflammation and examine the effect of roscovitine on these pathways.

Acknowledgements

This study was supported a grant from the National Natural Science Foundation of China (no. 81370699).

References

1 

Krystof V and Uldrijan S: Cyclin-dependent kinase inhibitors as anticancer drugs. Curr Drug Targets. 11:291–302. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Lapenna S and Giordano A: Cell cycle kinases as therapeutic targets for cancer. Nat Rev Drug Discov. 8:547–566. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Meijer L, Borgne A, Mulner O, Chong JP, Blow JJ, Inagaki N, Inagaki M, Delcros JG and Moulinoux JP: Biochemical and cellular effects of roscovitine, a potent and selective inhibitor of the cyclin-dependent kinases cdc2, cdk2 and cdk5. Eur J Biochem. 243:527–536. 1997. View Article : Google Scholar : PubMed/NCBI

4 

Payton M, Chung G, Yakowec P, Wong A, Powers D, Xiong L, Zhang N, Leal J, Bush TL, Santora V, et al: Discovery and evaluation of dual CDK1 and CDK2 inhibitors. Cancer Res. 66:4299–4308. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Dey A, Wong ET, Cheok CF, Tergaonkar V and Lane DP: R-Roscovitine simultaneously targets both the p53 and NF-kappaB pathways and causes potentiation of apoptosis: Implications in cancer therapy. Cell Death Differ. 15:263–273. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Rossi AG, Sawatzky DA, Walker A, Ward C, Sheldrake TA, Riley NA, Caldicott A, Martinez-Losa M, Walker TR, Duffin R, et al: Cyclin-dependent kinase inhibitors enhance the resolution of inflammation by promoting inflammatory cell apoptosis. Nat Med. 12:1056–1064. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Leitch AE, Riley NA, Sheldrake TA, Festa M, Fox S, Duffin R, Haslett C and Rossi AG: The cyclin-dependent kinase inhibitor R-roscovitine down-regulates Mcl-1 to override pro-inflammatory signalling and drive neutrophil apoptosis. Eur J Immunol. 40:1127–1138. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Kim SM, Yun MR, Hong YK, Solca F, Kim JH, Kim HJ and Cho BC: Glycolysis inhibition sensitizes non-small cell lung cancer with T790M mutation to irreversible EGFR inhibitors via translational suppression of Mcl-1 by AMPK activation. Mol Cancer Ther. 12:2145–2156. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Yue W, Zheng X, Lin Y, Yang CS, Xu Q, Carpizo D, Huang H, DiPaola RS and Tan XL: Metformin combined with aspirin significantly inhibits pancreatic cancer cell growth in vitro and in vivo by suppressing anti-apoptotic proteins Mcl-1 and Bcl-2. Oncotarget. 6:21208–21224. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Wang ST, Huang SW, Kao JK, Liang SM, Chen YJ, Chen YY, Wu CY and Shieh JJ: Imiquimod-induced AMPK activation causes translation attenuation and apoptosis but not autophagy. J Dermatol Sci. 78:108–116. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Nunes AK, Rapôso C, Rocha SW, Barbosa KP, Luna RL, da Cruz-Höfling MA and Peixoto CA: Involvement of AMPK, IKβα-NFκB and eNOS in the sildenafil anti-inflammatory mechanism in a demyelination model. Brain Res. 1627:119–133. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Liong S and Lappas M: Activation of AMPK improves inflammation and insulin resistance in adipose tissue and skeletal muscle from pregnant women. J Physiol Biochem. 71:703–717. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Hoogendijk AJ, Diks SH, van der Poll T, Peppelenbosch MP and Wieland CW: Kinase activity profiling of pneumococcal pneumonia. PLoS One. 6:e185192011. View Article : Google Scholar : PubMed/NCBI

14 

Hoogendijk AJ, Pinhancos SS, van der Poll T and Wieland CW: AMP-activated protein kinase activation by 5-aminoimidazole-4-carbox-amide-1-β-D-ribofuranoside (AICAR) reduces lipoteichoic acid-induced lung inflammation. J Biol Chem. 288:7047–7052. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Hong CY, Park JH, Ahn RS, Im SY, Choi HS, Soh J, Mellon SH and Lee K: Molecular mechanism of suppression of testicular steroidogenesis by proinflammatory cytokine tumor necrosis factor alpha. Mol Cell Biol. 24:2593–2604. 2004. View Article : Google Scholar : PubMed/NCBI

16 

Dobashi M, Fujisawa M, Yamazaki T, Okuda Y, Kanzaki M, Tatsumi N, Tsuji T, Okada H and Kamidono S: Inhibition of steroidogenesis in Leydig cells by exogenous nitric oxide occurs independently of steroidogenic acute regulatory protein (star) mRNA. Arch Androl. 47:203–209. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Liew SH, Meachem SJ and Hedger MP: A stereological analysis of the response of spermatogenesis to an acute inflammatory episode in adult rats. J Androl. 28:176–185. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Tiancheng X and Yunfei X: Research progress in separation and culture of mice leydig cells. J Clin Pathol Res. 35:569–572. 2015.

19 

Wu L, Xu B, Fan W, Zhu X, Wang G and Zhang A: Adiponectin protects Leydig cells against proinflammatory cytokines by suppressing the nuclear factor-κB signaling Pathway. FEBS J. 280:3920–3927. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Shchelochkov AM, Nefedova IF, Chernova SN and Vartanova OV: The regional indicators of male fertility in the Samara oblast and causative factors of their alterations. Klin Lab Diagn. 25–29. 2012.(In Russian). PubMed/NCBI

22 

Carlsen E, Andersson AM, Petersen JH and Skakkebaek NE: History of febrile illness and variation in semen quality. Hum Reprod. 18:2089–2092. 2003. View Article : Google Scholar : PubMed/NCBI

23 

Qureshi ST, Larivière L, Leveque G, Clermont S, Moore KJ, Gros P and Malo D: Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J Exp Med. 189:615–625. 1999. View Article : Google Scholar : PubMed/NCBI

24 

Parvinen M, Söder O, Mali P, Fröysa B and Ritzén M: In vitro stimulation of stage-specific deoxyribonucleic acid synthesis in rat seminiferous tubule segments by interleukin-1 alpha. Endocrinology. 129:1614–1620. 1991. View Article : Google Scholar : PubMed/NCBI

25 

Meijer L and Raymond E: Roscovitine and other purines as kinase inhibitors. From starfish oocytes to clinical trials. Acc Chem Res. 36:417–425. 2003. View Article : Google Scholar : PubMed/NCBI

26 

Cicenas J, Kalyan K, Sorokinas A, Stankunas E, Levy J, Meskinyte I, Stankevicius V, Kaupinis A and Valius M: Roscovitine in cancer and other diseases. Ann Transl Med. 3:1352015.PubMed/NCBI

27 

Kolodziej M, Goetz C, Di Fazio P, Montalbano R, Ocker M, Strik H and Quint K: Roscovitine has anti-proliferative and pro-apoptotic effects on glioblastoma cell lines: A pilot study. Oncol Rep. 34:1549–1556. 2015.PubMed/NCBI

28 

Arisan ED, Akkoç Y, Akyüz KG, Kerman EM, Obakan P, Çoker-Gürkan A and Palavan Ünsal N: Polyamines modulate the roscovitine-induced cell death switch decision autophagy vs. apoptosis in MCF-7 and MDA-MB-231 breast cancer cells. Mol Med Rep. 11:4532–4540. 2015.PubMed/NCBI

29 

El-Alfy M, Luu-The V, Huang XF, Berger L, Labrie F and Pelletier G: Localization if type 5 17beta-hydroxysteroid dehydrogenase, 3beta-hydroxysteroid dehydrogenase, and androgen receptor in the human prostate by in situ hybridization and immunocytochemistry. Endocrinology. 140:1481–1491. 1999. View Article : Google Scholar

30 

Gingras S, Moriggl R, Groner B and Simard J: Induction of 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase type 1 gene transcription in human breast cancer cell lines and in normal mammary epithelial cells by interleukin-4 and interleukin-13. Mol Endocrinol. 13:66–81. 1999. View Article : Google Scholar : PubMed/NCBI

31 

Gingras S and Simard J: Induction of 3beta-hydroxysteroid dehydrogenase/isomerase type 1expression by interleukin-4 in human normal prostate epithelial cells, immortalized keratinocytes, colon, and cervix cancer cell lines. Endocrinology. 140:4573–4584. 1999. View Article : Google Scholar

32 

Xue LY, Li J, Wang GX, Xiu HM and Sun HC: The functional change of the rats testis in the condition of undifferential orchitis induced by lipopolysaccharide. Reproduction & Contraception. 26:77–80. 2006.

33 

Chen L, Lai YS and Ji H: Effect of COX/5-LOX dual inhibitor ZLJ-6 on the expression of LPS-induced inflammation factors in macrophage cells. Journal of China Pharmaceutical University. 43:70–74. 2012.

34 

Yang KY, Gu JL, Yin DM and Shen Q: Effect of Curcumin on iNOS Expression in LPS-activated Microglia Cells and Ant-i oxidation. Chinese Journal of Biochemistry and Molecular Biology. 23:938–945. 2007.

35 

Ewart MA, Kohlhaas CF and Salt IP: Inhibition of tumor necrosis factor alpha-stimulated monocyte adhesion to human aortic endothelial cells by AMP-activated protein kinase. Arterioscler Thromb Vasc Biol. 28:2255–2257. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Giri S, Nath N, Smith B, Viollet B, Singh AK and Singh I: 5-Aminoimidazole-4-carboxamide-1-beta-4-ribofuranoside inhibits proinflammatory response in glial cells: A possible role of AMP-activated protein kinase. J Neurosci. 24:479–487. 2004. View Article : Google Scholar : PubMed/NCBI

37 

Yeung F, Hoberg JE, Ramsey CS, Keller MD, Jones DR, Frye RA and Mayo MW: Modulation of NF-kappaB-dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J. 23:2369–2380. 2004. View Article : Google Scholar : PubMed/NCBI

38 

Ak P and Levine AJ: P53 and NF-κB: Different strategies for responding to stress lead to a functional antagonism. FASEB J. 24:3643–3652. 2010. View Article : Google Scholar : PubMed/NCBI

39 

Komarova EA, Krivokrysenko V, Wang K, Neznanov N, Chernov MV, Komarov PG, Brennan ML, Golovkina TV, Rokhlin OW, Kuprash DV, et al: p53 is a suppressor of inflammatory response in mice. FASEB J. 19:1030–1032. 2005.PubMed/NCBI

40 

Yu M, Zhang LY, Qiao PH and Chang B: Testicular oxidative stress and downregulation of CYP17a1 induced by di(n-butyl) phthalate inhibit synthesis of testosterone. Wei Sheng Yan Jiu. 44:364–370. 2015.PubMed/NCBI

Related Articles

Journal Cover

May-2017
Volume 13 Issue 5

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Xie T, Hu G, Dong B, Yan Y, Liu M, Yao X, Zheng J and Xu Y: Roscovitine protects murine Leydig cells from lipopolysaccharide-induced inflammation. Exp Ther Med 13: 2169-2176, 2017.
APA
Xie, T., Hu, G., Dong, B., Yan, Y., Liu, M., Yao, X. ... Xu, Y. (2017). Roscovitine protects murine Leydig cells from lipopolysaccharide-induced inflammation. Experimental and Therapeutic Medicine, 13, 2169-2176. https://doi.org/10.3892/etm.2017.4239
MLA
Xie, T., Hu, G., Dong, B., Yan, Y., Liu, M., Yao, X., Zheng, J., Xu, Y."Roscovitine protects murine Leydig cells from lipopolysaccharide-induced inflammation". Experimental and Therapeutic Medicine 13.5 (2017): 2169-2176.
Chicago
Xie, T., Hu, G., Dong, B., Yan, Y., Liu, M., Yao, X., Zheng, J., Xu, Y."Roscovitine protects murine Leydig cells from lipopolysaccharide-induced inflammation". Experimental and Therapeutic Medicine 13, no. 5 (2017): 2169-2176. https://doi.org/10.3892/etm.2017.4239