Open Access

Dietary soy isoflavones alleviate dextran sulfate sodium‑induced inflammation and oxidative stress in mice

  • Authors:
    • Bin Wang
    • Cunbing Wu
  • View Affiliations

  • Published online on: May 18, 2017     https://doi.org/10.3892/etm.2017.4469
  • Pages: 276-282
  • Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

It has been hypothesized that soy isoflavones exhibit anti-oxidative and anti‑inflammatory functions, however, the effects of soy isoflavones on inflammatory bowel diseases remain unknown. Therefore, the present study aimed to investigate the effect and underlying mechanism of dietary soy isoflavones on dextran sulfate sodium (DSS)‑induced colitis. Mice were administered DSS and soy isoflavones, and histomorphometry, oxidative stress, inflammation and intestinal tight junctions were determined. The current study demonstrated that dietary soy isoflavones alleviated DSS‑induced growth suppression, colonic inflammatory response, oxidative stress and colonic barrier dysfunction. DSS treatment was indicated to activate Toll‑like receptor 4 (TRL4) and myeloid differentiation protein 88 (MyD88) in mice, whereas dietary soy isoflavones inhibited Myd88 expression in DSS‑challenged mice. In conclusion, dietary soy isoflavones alleviate DSS‑induced inflammation in mice, which may be associated with enhancing antioxidant function and inhibiting the TLR4/MyD88 signal.

Introduction

Inflammatory bowel disease (IBD), comprising Crohn's disease and ulcerative colitis, is multifactorial and results from an interaction between genetic, microbial, autoimmune and environmental factors (1). The incidence of IBD is associated with dietary compositions, saturated fats, depression, impaired sleep and serum vitamin D concentrations (24). The pathogenesis of IBD is a chronic relapsing inflammatory disorder leading to neutrophil accumulation, gastrointestinal inflammation with villus atrophy and loss of crypts, and is accompanied by diarrhea, blood in stool, weight loss, disturbed intestinal barriers and dysfunction of tight junctions (5,6). As inflammation is closely associated with the generation of free radical species, oxidative stress has been proposed as a mechanism underlying the pathophysiology of various inflammation-associated diseases, including IBD (7,8). Experimental and clinical evidence suggests that antioxidant compounds may serve as the potential therapeutic modalities of human IBD (811).

Soy isoflavones are diphenolic compounds that are present in plants such as soybeans, red clover and kudzu root. It has been demonstrated that they have antioxidant properties via detoxifying free radical species and upregulating antioxidant genes (12). Soy isoflavones are also associated with cell survival, cell cycle, inflammation and apoptosis, and they suppress nuclear factor (NF)-κB and other signaling pathways (12). However, the effects of soy isoflavones on dextran sulfate sodium (DSS)-induced IBD remain unknown. Thus, the aim of the present study was to investigate the protective effect of soy isoflavones in DSS-challenged mice via assessing morphology and performing reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analyses.

Materials and methods

Animal model and groups

A total of 40, 5-week old female ICR mice weighing 22.66±0.12 g were obtained from Changsha Well-Bio (Changsha, China). Mice were divided into four groups (n=10 in each): Control (Cont), in which mice were fed a basic diet (13) and tap water; a DSS-treated group (DSS), in which mice had ad libitum access to 5% DSS solution (Kayon Biotechnology, Co., Ltd., Shanghai, China) supplied as drinking water; a soy isoflavonones supplemented group (SIF), in which 0.5% soy isoflavones were mixed in the feeding diet (Xi'an Rongsheng Biotechnology, Co., Ltd., Shaanxi, China) according to previous studies (14); and a soy isoflavones and DSS-treated group (SDS), in which mice were treated with DSS and soy isoflavones as previously described. All mice were housed in polycarbonate cages in a room with a controlled temperature of 25±3°C, a humidity of 50±5% and a 12-h light/dark cycle. Mice were allowed ad libitum access to laboratory strip chows throughout the experimental period.

Following the 7-day experimental period, all mice were sacrificed via general anesthetic with Zoletil 50 (10 mg/kg diluted in saline; Virbac S.A., Carros, France). Subsequently, colons were harvested and colon length was measured (n=10). Prior to sacrifice, 10 blood samples from each group were collected via orbital vein bleeding after mice were sedated. In addition, colon tissues from each mouse were harvested and immediately frozen in liquid nitrogen and stored at −70°C for subsequent gene expression analysis (n=6). The present study was conducted according to the guidelines of the Declaration of Helsinki and all procedures involving animal subjects were approved by the Animal Welfare Committee of the Jiangsu Food and Pharmaceutical Science College (Huaian, China).

Histomorphometry determination

The morphological evaluation following treatment with DSS was performed using hematoxylin and eosin (H&E) staining. Briefly, one section of each colon sample (0.5 cm) was fixed in 4% neutral buffered formalin, processed using routine histological methods and mounted in paraffin blocks (room temperature). Each sample was cut into 6 µm-thick sections and stained with H&E. All specimens were examined under a light microscope (Nikon Corporation, Toyko, Japan). Villus height and crypt depth were measured using Image-Pro Plus version 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA) (15).

Serum oxidative indexes

Harvested blood samples were stored at 4°C for 4 h, when serum samples were separated from blood via centrifugation at 3,500 × g and 4°C for 15 min. Malondialdehyde (MDA) and total antioxidant capability (T-AOC) were measured using assay kits in accordance with the manufacturer's instructions (MDA, A003-1; T-AOC, A0015-1; both Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

cDNA synthesis and quantification of mRNA by RT-qPCR

Total RNA was isolated from liquid nitrogen pulverized tissues using TRIzol reagent according to the manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and then treated with DNase I (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Synthesis of the first strand (cDNA) was performed with oligo (dT) 20 and Superscript II reverse transcriptase using the following program: 42°C for 2 min; 37°C for 15 min; followed by 85°C for 5 sec (Invitrogen; Thermo Fisher Scientific, Inc.).

Primers were designed with Primer 5.0 according to the gene sequence of mouse (www.ncbi.nlm.nih.gov/nuccore/?term=Mus+musculus) to produce an amplification product. The primer sets used are presented in Table I. The protocol of RT-qPCR was completed using the SYBR ExScript RT-qPCR kit (Takara Biotechnology Co., Ltd.). A total reaction system of 10 µl contained 1 µl cDNA from the aforementioned PCR, 5 µl SYBR Premix EX Taq, 0.5 µl of each of the primers (10 µM), and 3 µl ddH2O. The PCR program was as follows: Denaturation at 95°C for 2 min; followed by 45 cycles at 95°C for 10 sec, 59°C for 20 sec and 72°C for 30 sec according to previous studies (16,17). Relative gene expression was normalized to β-actin and expressed as a ratio to the expression in control group using the formula 2−(∆∆Cq) (18), where ∆∆Cq=(CqTarget-Cqβ-actin)treatment-(CqTarget-Cqβ-actin)control. Therefore, relative expression of target genes in the control group was: Relative gene expression levels represented the comparison vs. control group; results were reported as a fold-change from the control value.

Table I.

Polymerase chain reaction primer sequences: F and R primers used in the present study.

Table I.

Polymerase chain reaction primer sequences: F and R primers used in the present study.

GeneAccession no.Nucleotide sequence of primers, 5′-3′Size, bp
β-ActinNM_007393.3F: GTCCACCTTCCAGCAGATGT117
R: GAAAGGGTGTAAAACGCAGC
OccludinNM_008756.2F: ACTGGGTCAGGGAATATCCA193
R: TCAGCAGCAGCCATGTACTC
ZO1XM_006540786.1F: ACTCCCACTTCCCCAAAAAC166
R: CCACAGCTGAAGGACTCACA
Caludin1NM_016674.4F: AGACCTGGATTTGCATCTTGGTG126
R: TGCAACATAGGCAGGACAAGAGTTA
CATXM_006498624.1F: AATATCGTGGGTGACCTCAA243
R: CAGATGAAGCAGTGGAAGGA
ZnCuSODNM_011434.1F: CCACTGCAGGACCTCATTTT216
R: CACCTTTGCCCAAGTCATCT
Gpx1NM_008160.6F: GGTTCGAGCCCAATTTTACA199
R: CCCACCAGGAACTTCTCAAA
Gpx2NM_030677.2F: GTGTGATGTCAATGGGCAGAA241
R: ACGTTTGATGTCAGGCTCGAT
Gpx3NM_008161.3F: GATGTGAACGGGGAGAAAGA152
R: CCCACCAGGAACTTCTCAAA
Gpx4NM_001037741.3F: CTCCATGCACGAATTCTCAG117
R: ACGTCAGTTTTGCCTCATTG
IL-1βNM_008361.3F: CTGTGACTCGTGGGATGATG213
R: GGGATTTTGTCGTTGCTTGT
IL-6NM_031168.1F: TGCAAGAGACTTCCATCCAGT116
R: GTGAAGTAGGGAAGGCCG
IL-10NM_010548.2F: ACAGCCGGGAAGACAATAAC116
R: CAGCTGGTCCTTTGTTTGAAAG
IL-17NM_010552.3F: TACCTCAACCGTTCCACGTC119
R: TTTCCCTCCGCATTGACAC
TNF-αNM_013693.2F: AGGCACTCCCCCAAAAGAT192
R: TGAGGGTCTGGGCCATAGAA
TLR4NM_021297.3F: TTTGCTGGGGCTCATTCACT164
R: GACTCGGCACTTAGCACTGT
Myd88NM_010851.2F: CTCGCAGTTTGTTGGATGCC185
R: GGCCACCTGTAAAGGCTTCT

[i] F, forward; R, reverse; ZO1, zonula occludens-1; CAT, catalase; ZnCuSOD, zinc-copper superoxide dismutase; GPX, glutathione peroxidase; IL, interleukin; TNF-α, tumor necrosis factor-α; TLR4, toll-like receptor 4; Myd88, myeloid differentiation primary response gene 88.

Statistical analysis

All statistical analyses were performed using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). Group comparisons were performed using a one-way analysis of variance to assess the homogeneity of variances via Levene's test and followed with Tukey's multiple comparison test. Data are expressed as the mean ± standard error of the mean. P<0.05 was considered to represent a statistically significant difference.

Results

Effects of soy isoflavones on body weight and colonic length in DSS-challenged mice

Body weight was recorded daily and is presented in Fig. 1A. On days 3 to 7, DSS treatment significantly reduced body weight in mice compared with the control group (P<0.05). Dietary soy isoflavones significantly increased body weight at day 5 in DSS-challenged mice compared with the DSS group (P<0.05). Average daily weight gain was significantly lower in the DSS compared with the control group (Fig. 1B; P<0.05), while dietary soy isoflavones failed to affect body weight gain in DSS-challenged mice (Fig. 1B; P>0.05).

Colonic length has been used as a clinical index for colonic inflammation and the present study demonstrated that DSS exposure significantly decreased colonic length (P<0.05; Fig. 1C). Dietary soy isoflavones (SIF group) tended to alleviate DSS-induced colonic atrophy, however the difference was not significant.

Effects of soy isoflavones on inflammation in DSS-challenged mice

The mRNA abundances of interleukin (IL)-1β, IL-6, IL-10, IL-17 and tumor necrosis factor (TNF)-α were measured via RT-qPCR to investigate the anti-inflammatory effect of soy isoflavones in DSS-challenged mice. The present data demonstrated that DSS treatment significantly induced colonic inflammation, indicated by the upregulation of IL-1β, IL-6, IL-17 and TNF-α expression (Fig. 2A-D). IL-10 was also tested in this study; however, no significant difference was indicated (P>0.05; Fig. 2E). Dietary supplementation with isoflavones downregulated the expression of TNF-α, compared with the DSS group (P<0.05; Fig. 2D).

Effects of soy isoflavones on oxidative stress in DSS-challenged mice

MDA and T-AOC have been widely used as makers for oxidative stress and are indicated to be associated with inflammatory diseases. In the present study, DSS exposure significantly increased serum MDA concentration and decreased serum T-AOC activity compared with the control group (P<0.05; Fig. 3A and B, respectively), suggesting that oxidative stress is associated with IBD. Although dietary soy isoflavones failed to significantly alleviate DSS-caused MDA generation, T-AOC activity in the SDS group was significantly higher than that in DSS group (P<0.05; Fig. 3B). Furthermore, RT-qPCR results (Fig. 3C-H) demonstrated that DSS significantly inhibited zinc-copper superoxide dismutase (ZnCuSOD; Fig. 3C) and glutathione peroxidase 1 (GPX1; Fig. 3D) gene expression levels (both P<0.05), whereas dietary soy isoflavones markedly upregulated ZnCuSOD, GPX1 and GPX4 mRNA expression levels (P<0.05; Fig. 3C, D and G, respectively). However, gene expression levels of GPX2, GPX3 and CAT were not significant between groups (P>0.05; Fig. 3E, F and H, respectively).

Effects of soy isoflavones on colonic morphology and tight junctions in DSS-challenged mice

No abnormal morphology was observed in the colon of mice in the control group (Fig. 4A). By contrast, villus height in the challenged mice exhibited a marked scattering and desquamation (Fig. 4B-D). Villus height in the DSS group (82.53±4.20 µm) was significantly lower than that in the control group (103.25±3.77 µm; P<0.05) and soy isoflavones (108.70±5.15 µm) significantly alleviated DSS-induced colonic villus injury (P<0.05; Table II).

Table II.

Effects of dietary soy isoflavones on villus height (µm) and crypt depth (µm) in the colon following exposure to DSS.

Table II.

Effects of dietary soy isoflavones on villus height (µm) and crypt depth (µm) in the colon following exposure to DSS.

ItemControlDSSSIFSDS
Villus height 103.25±3.77a82.53±2.43108.70±5.15a 100.05±3.56a
Crypt depth32.15±4.0731.57±1.6832.60±2.6934.60±3.01
V/C3.39±0.512.64±0.203.40±0.322.96±0.26

{ label (or @symbol) needed for fn[@id='tfn2-etm-0-0-4469'] } Data are presented as mean ± standard error of the mean (n=4).

a P<0.05 vs. DSS. V/C, ratio of villus height to crypt depth; DSS, dextran sulfate sodium treated group; SIF, soy isoflavones supplemented group; SDS, soy isoflavones and DSS-treated group.

The present study further determined the expression of Occludin, zonula occludens-1 and Claudin1 (Fig. 4E-G) following DSS exposure, and the results demonstrated that DSS significantly downregulated the expression of Occludin and soy isoflavones enhanced the Occludin mRNA level (P<0.05; Fig. 4E).

Effects of soy isoflavones on toll like receptor 4 (TLR4)/myeloid differentiation primary response gene 88 (Myd88) in DSS-challenged mice

TLR4/Myd88 is associated with various inflammatory responses (19). The present study demonstrated that DSS significantly enhanced the expression of colonic TLR4/Myd88 mRNA (P<0.05; Fig. 5), suggesting that DSS activates the TLR4/Myd88 signal. Although soy isoflavones tended to inhibit the TLR4 expression caused by DSS, the difference was not significant. However, dietary supplementation with soy isoflavones significantly inactivated Myd88 following DSS exposure (P<0.05; Fig. 5B).

Discussion

Soybeans, most widely used in Asian countries, are a rich source of biologically active isoflavones, such as genistein (4,5,7-trihydroxyisoflavone) and daidzein (4,7-dihydroxyisoflavone) known to have a spectrum of biological activities. Although soy isoflavones have been demonstrated to exert protective effects against a series of diseases in vitro and in vivo (20,21), to the best of our knowledge no reports are available regarding the evaluation of soy isoflavones in inflammation and specifically in IBD. The present study demonstrated that dietary soy isoflavones reduced the severity and extent of progressive chronic colonic damage induced by a 7-day exposure of DSS.

Although the etiology of IBD remains essentially obscure, it has been suggested that the development and pathology may be associated with an abnormal inflammatory response in the gastrointestinal tract (22). Kim et al (22) reported that disease severity is often associated with an increase in higher levels of pro-inflammatory cytokines in experimental colitis. Pro-inflammatory cytokines are important mediators of inflammation and have distinguished roles in cancer development. The present study determined that there is an abundance of IL-1β, IL-6, IL-10, IL-17 and TNF-α mRNA in the colon using RT-qPCR analysis and the results demonstrated that DSS-induced colonic inflammation. This was indicated by the upregulation of IL-1β, IL-6, IL-17 and TNF-α gene expression. However, in DSS-challenged mice, dietary soy isoflavones downregulated the gene expression of TNF-α. Similarly, soy isoflavones have also been demonstrated to alleviate inflammation induced by the generation of IL-1β, IL-6 and TNF-α (23). IL-1β, IL-6 and TNF-α have been implicated in a number of cellular and molecular mechanisms associated with the majority of inflammation-associated chronic human diseases, including IBD (23). Thus, the present study speculated that soy isoflavones have evident anti-inflammatory potential in the IBD model.

Studies on the antioxidant function of soy isoflavones have suggested a free radical scavenging ability, an ability to reduce low-density lipoprotein and DNA susceptibility to oxidative stress, and an ability to boost the activity and expression of antioxidant enzymes (14). Due in part to their potential antioxidant activities; soy isoflavones have been linked to a decreased risk of cardiovascular disease, osteoporosis, endocrine-responsive cancer and inflammatory diseases (24,25). MDA and T-AOC have been widely used as makers for oxidative stress (26,27). In the present study, DSS exposure significantly induced oxidative stress, indicated by the elevated MDA level and decreased T-AOC activity. Although dietary soy isoflavones failed to alleviate DSS-induced MDA generation, soy isoflavones enhanced serum T-AOC activity, suggesting an antioxidant function of soy isoflavones in the DSS-induced IBD model. To investigate the antioxidant mechanism of soy isoflavones, the present study further determined colonic antioxidant gene expression. The results demonstrated that dietary soy isoflavones upregulated the gene expression levels of ZnCuSOD, GPX1 and GPX4 in DSS-challenged mice. In the exercise-induced oxidative stress model, Yoon and Park (14) reported that soy isoflavones significantly enhanced SOD activity and alleviated oxidative injury. GPX1 and GPX4 have been revealed to be involved in IBD via regulating T cell function and oxidative stress (28,29). Thus, the antioxidant function of soy isoflavones in IBD model may be associated with increasing the expression of ZnCuSOD, GPX1 and GPX4.

Dysfunction of the gastrointestinal barriers is a major characteristic symptom in the pathophysiology of IBD (30). In the present study, dietary soy isoflavones significantly alleviated DSS-induced colonic villus injury and upregulated occludin expression in DSS-challenged mice. This indicated a beneficial role in intestinal morphologic structure and barrier function. Kiatprasert et al (31) reported that treatment with soy isoflavones may promote and restore the impaired endometrial barrier function by increasing the gene expression of tight junction-associated genes in lipopolysaccharide-induced inflammation.

TLR4/Myd88 signalling is associated with various inflammatory diseases, including IBD (32,33). Cao et al (33) demonstrated that TLR4/Myd88 is able to regulate interferon-γ and IL-17 production by inducing Foxp3+ regulatory T cells during intestinal inflammation. It has also been suggested that TLR4/Myd88 is able to mediate the NF-κB pathway and maintain the intestinal barrier function (34). In the present study, DSS activated TLR4/Myd88 and dietary soy isoflavones significantly inhibited Myd88 expression. Genistein, a principal soy isoflavone, has been revealed to mediate TLR4/Myd88 in various inflammations (35,36). In addition, genistein attenuated the initiation of intracellular signaling cascades by LPS through inhibiting NF-κB activation by inhibiting the binding of LPS to TLR-4 on microglial cells (37).

In conclusion, DSS caused inflammation, oxidative stress, intestinal barrier dysfunction in mice. However, findings from the present study demonstrated that dietary soy isoflavones alleviated DSS-induced inflammation in mice, which may be associated with enhancing antioxidant function and inhibiting the TLR4/MyD88 signal.

Acknowledgements

The present study was supported by Scientific Research Program of Jiangsu Provincial Huaian Municipal Government (grant no. HAN2014007).

References

1 

Dubeau MF, Iacucci M, Beck PL, Moran GW, Kaplan GG, Ghosh S and Panaccione R: Drug-induced inflammatory bowel disease and IBD-like conditions. Inflamm Bowel Dis. 19:445–456. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Ananthakrishnan AN: Epidemiology and risk factors for IBD. Nat Rev Gastroenterol Hepatol. 12:205–217. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Mileva S, Galunska B, Gospodinova M, Gerova D and Svinarov D: Vitamin D3 status in children with acute diarrhea. Integr Food Nutr Metab. 1:1–6. 2014.

4 

Hirai F and Matsui T: Status of food intake and elemental nutrition in patients with Crohn's disease. Integr Food Nutr Metab. 2:148–150. 2015.

5 

Naito Y, Takagi T and Yoshikawa T: Neutrophil-dependent oxidative stress in ulcerative colitis. J Clin Biochem Nutr. 41:18–26. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Sann H, Erichsen JV, Hessmann M, Pahl A and Hoffmeyer A: Efficacy of drugs used in the treatment of IBD and combinations thereof in acute DSS-induced colitis in mice. Life Sci. 92:708–718. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Piechota-Polanczyk A and Fichna J: Review article: The role of oxidative stress in pathogenesis and treatment of inflammatory bowel diseases. Naunyn Schmiedebergs Arch Pharmacol. 387:605–620. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Zhu H and Li YR: Oxidative stress and redox signaling mechanisms of inflammatory bowel disease: Updated experimental and clinical evidence. Exp Biol Med (Maywood). 237:474–480. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Almenier HA, Al Menshawy HH, Maher MM and Al Gamal S: Oxidative stress and inflammatory bowel disease. Front Biosci (Elite Ed). 4:1335–1344. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Shori AB and Baba AS: Fermented milk derives bioactive peptides with antihypertensive effects. Integr Food Nutr Metab. 2:178–181. 2015.

11 

McCann MJ, Dalziel JE, Bibiloni R and Barnett MPG: An integrated approach to assessing the bio-activity of nutrients in vitro: The anti-oxidant effects of catechin and chlorogenic acid as an example. Integr Food Nutr Metab. 2:197–204. 2015. View Article : Google Scholar

12 

Mahmoud AM, Yang W and Bosland MC: Soy isoflavones and prostate cancer: A review of molecular mechanisms. J Steroid Biochem Mol Biol. 140:116–132. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Yin J, Wu M, Duan J, Liu G, Cui Z, Zheng J, Chen S, Ren W, Deng J, Tan X, et al: Pyrrolidine dithiocarbamate inhibits NF-KappaB activation and upregulates the expression of Gpx1, Gpx4, occludin, and ZO-1 in DSS-induced colitis. Appl Biochem Biotechnol. 177:1716–1728. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Yoon GA and Park S: Antioxidant action of soy isoflavones on oxidative stress and antioxidant enzyme activities in exercised rats. Nutr Res Pract. 8:618–624. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Yin J, Liu M, Ren W, Duan J, Yang G, Zhao Y, Fang R, Chen L, Li T and Yin Y: Effects of dietary supplementation with glutamate and aspartate on diquat-induced oxidative stress in piglets. PLoS One. 10:e01228932015. View Article : Google Scholar : PubMed/NCBI

16 

Yin J, Duan J, Cui Z, Ren W, Li T and Yin Y: Hydrogen peroxide-induced oxidative stress activates NF-κB and Nrf2/Keap1 signals and triggers autophagy in piglets. RSC Advances. 5:15479–15486. 2015. View Article : Google Scholar

17 

Yin J, Wu MM, Xiao H, Ren WK, Duan JL, Yang G, Li TJ and Yin YL: Development of an antioxidant system after early weaning in piglets. J Anim Sci. 92:612–619. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Doz E, Noulin N, Boichot E, Guénon I, Fick L, Le Bert M, Lagente V, Ryffel B, Schnyder B, Quesniaux VF and Couillin I: Cigarette smoke-induced pulmonary inflammation is TLR4/MyD88 and IL-1R1/MyD88 signaling dependent. J Immunol. 180:1169–1178. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Pudenz M, Roth K and Gerhauser C: Impact of soy isoflavones on the epigenome in cancer prevention. Nutrients. 6:4218–4272. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Hillman GG and Singh-Gupta V: Soy isoflavones sensitize cancer cells to radiotherapy. Free Radic Biol Med. 51:289–298. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Kim JJ, Shajib MS, Manocha MM and Khan WI: Investigating intestinal inflammation in DSS-induced model of IBD. J Vis Exp pii. 36782012.

23 

Khan AQ, Khan R, Rehman MU, Lateef A, Tahir M, Ali F and Sultana S: Soy isoflavones (daidzein & genistein) inhibit 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced cutaneous inflammation via modulation of COX-2 and NF-κB in Swiss albino mice. Toxicology. 302:266–274. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Arteel GE, Uesugi T, Bevan LN, Gäbele E, Wheeler MD, McKim SE and Thurman RG: Green tea extract protects against early alcohol-induced liver injury in rats. Biol Chem. 383:663–670. 2002. View Article : Google Scholar : PubMed/NCBI

25 

Yousef MI, Kamel KI, Esmail AM and Baghdadi HH: Antioxidant activities and lipid lowering effects of isoflavone in male rabbits. Food Chem Toxicol. 42:1497–1503. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Yin J, Ren W, Yang G, Duan J, Huang X, Fang R, Li C, Li T, Yin Y, Hou Y, et al: l-Cysteine metabolism and its nutritional implications. Mol Nutr Food Res. 60:134–146. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Yin J, Ren W, Liu G, Duan J, Yang G, Wu L, Li T and Yin Y: Birth oxidative stress and the development of an antioxidant system in newborn piglets. Free Radic Res. 47:1027–1035. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Häuser F, Rossmann H, Laubert-Reh D, Wild PS, Zeller T, Müller C, Neuwirth S, Blankenberg S and Lackner KJ: Inflammatory bowel disease (IBD) locus 12: Is glutathione peroxidase-1 (GPX1) the relevant gene? Genes Immun. 16:571–575. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Kim HR, Lee A, Choi EJ, Kie JH, Lim W, Lee HK, Moon BI and Seoh JY: Attenuation of experimental colitis in glutathione peroxidase 1 and catalase double knockout mice through enhancing regulatory T cell function. PLoS One. 9:e953322014. View Article : Google Scholar : PubMed/NCBI

30 

Amasheh M, Grotjohann I, Amasheh S, Fromm A, Söderholm JD, Zeitz M, Fromm M and Schulzke JD: Regulation of mucosal structure and barrier function in rat colon exposed to tumor necrosis factor alpha and interferon gamma in vitro: A novel model for studying the pathomechanisms of inflammatory bowel disease cytokines. Scand J Gastroenterol. 44:1226–1235. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Kiatprasert P, Deachapunya C, Benjanirat C and Poonyachoti S: Soy isoflavones improves endometrial barrier through tight junction gene expression. Reproduction. 149:269–280. 2015. View Article : Google Scholar : PubMed/NCBI

32 

Ma W, Wang J, Li Y, Hu X, Shi F and Wang X: Enhancing pentose phosphate pathway in Corynebacterium glutamicum to improve l-isoleucine production. Biotechnol Appl Biochem. 63:877–885. 2016. View Article : Google Scholar : PubMed/NCBI

33 

Cao AT, Yao S, Stefka AT, Liu Z, Qin H, Liu H, Evans-Marin HL, Elson CO, Nagler CR and Cong Y: TLR4 regulates IFN-γ and IL-17 production by both thymic and induced Foxp3+ Tregs during intestinal inflammation. J Leukoc Biol. 96:895–905. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Wang W, Xia T and Yu X: Wogonin suppresses inflammatory response and maintains intestinal barrier function via TLR4-MyD88-TAK1-mediated NF-κB pathway in vitro. Inflamm Res. 64:423–431. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Dijsselbloem N, Goriely S, Albarani V, Gerlo S, Francoz S, Marine JC, Goldman M, Haegeman G and Berghe W Vanden: A critical role for p53 in the control of NF-kappaB-dependent gene expression in TLR4-stimulated dendritic cells exposed to Genistein. J Immunol. 178:5048–5057. 2007. View Article : Google Scholar : PubMed/NCBI

36 

Yu HL, Li XY, Zhou X, Yuan LH, Ma WW, Xi YD, Zhao X, Wu J and Xiao R: Beta amyloid peptide (25–35) leading to inflammation through Toll-like receptors and the anti-inflammatory effect of genistein in BV-2 cells. J Mol Neurosci. 51:771–778. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Jeong JW, Lee HH, Han MH, Kim GY, Kim WJ and Choi YH: Anti-inflammatory effects of genistein via suppression of the toll-like receptor 4-mediated signaling pathway in lipopolysaccharide-stimulated BV2 microglia. Chem Biol Interact. 212:30–39. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

July-2017
Volume 14 Issue 1

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Wang B and Wu C: Dietary soy isoflavones alleviate dextran sulfate sodium‑induced inflammation and oxidative stress in mice. Exp Ther Med 14: 276-282, 2017.
APA
Wang, B., & Wu, C. (2017). Dietary soy isoflavones alleviate dextran sulfate sodium‑induced inflammation and oxidative stress in mice. Experimental and Therapeutic Medicine, 14, 276-282. https://doi.org/10.3892/etm.2017.4469
MLA
Wang, B., Wu, C."Dietary soy isoflavones alleviate dextran sulfate sodium‑induced inflammation and oxidative stress in mice". Experimental and Therapeutic Medicine 14.1 (2017): 276-282.
Chicago
Wang, B., Wu, C."Dietary soy isoflavones alleviate dextran sulfate sodium‑induced inflammation and oxidative stress in mice". Experimental and Therapeutic Medicine 14, no. 1 (2017): 276-282. https://doi.org/10.3892/etm.2017.4469