Open Access

Ckip‑1 regulates C3H10T1/2 mesenchymal cell proliferation and osteogenic differentiation via Lrp5

  • Authors:
    • Xin Huang
    • Jianfei Liang
    • Ye Gao
    • Yan Hou
    • Yu Song
    • Liang Kong
  • View Affiliations

  • Published online on: February 10, 2021     https://doi.org/10.3892/etm.2021.9773
  • Article Number: 342
  • Copyright: © Huang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Casein kinase‑2 interaction protein‑1 (Ckip‑1) is a negative regulator of bone formation. The identification of novel Ckip‑1‑related targets and their associated signaling pathways that regulate mesenchymal stem cell (MSC) osteogenic differentiation is required. The present study aimed to evaluate the effects of Ckip‑1 knockdown on C3H10T1/2 MSC proliferation and osteogenic differentiation, and to explore the role of the canonical Wnt‑signaling receptor Lrp5. Ckip‑1‑knockdown (shCkip‑1), Ckip‑1‑overexpression (Ckip‑1) and their corresponding control [shCtrl and empty vector (EV), respectively] cell groups were used in the present study. Immunofluorescence localization of Ckip‑1 was observed. The expression of the key molecules of the canonical Wnt signaling pathway was examined in C3H10T1/2 cells following osteogenic induction. Moreover, the effects of Lrp5 knockdown in the presence or absence of Ckip‑1 knockdown were examined on C3H10T1/2 cell proliferation and osteogenic differentiation. The results indicated an increase in cell proliferation and osteogenic differentiation in the shCkip‑1 group compared with the shCtrl group. The expression levels of LDL receptor related protein 5 (Lrp5), lymphoid enhancer binding factor 1 (Lef1) and transcription factor 1 in C3H10T1/2 cells were significantly increased in shCkip‑1 cells following 7‑day osteoinduction compared with shCtrl cells. Moreover, the involvement of Lrp5 in shCkip‑1‑induced osteogenic differentiation of C3H10T1/2 cells was further verified. The results indicated that Ckip‑1 reduced C3H10T1/2 MSC proliferation and osteogenic differentiation via the canonical Wnt‑signaling receptor Lrp5, which is essential for the improvement of bone tissue engineering.

Introduction

Bone defects, which can be caused by trauma, infection, tumors or congenital deformation, have been accepted as difficult-to-treat conditions in medicine (1). To date, autologous bone grafting has been regarded as the most common strategy for the treatment of bone defects (2-4); however, it is considered as a ‘wound-repairing-wound’ method with disadvantages, such as donor site pain, infection, haemorrhage, nerve damage and limited blood supply (5). The development of cell and molecular biology as well as biomaterial science has enabled the introduction of bone tissue engineering (BTE) as a promising strategy for bone repair (6). During bone repair, the regulation of seed cell osteogenic differentiation is important (7). Mesenchymal stem cells (MSCs) are frequently used for these purposes; therefore, further investigation into the key genes and related signaling pathways of MSCs is required to improve BTE.

Wnt signaling is one of the five main osteogenic signaling pathways (Wnt, bone morphogenic protein (BMP), fibroblast growth factor, Hedgehog and Notch) and includes the three following branches (8): Wnt/β-catenin (9), Wnt/peridinin-chlorophyll-protein complex (10) and Wnt/Ca2+ (11) signaling pathways. Among the different pathways, the Wnt/β-catenin (canonical Wnt) signaling pathway is crucial for the maintenance of bone mass (12). Increasing evidence has indicated that the canonical Wnt signaling pathway can repress MSC chondrogenic and adipogenic differentiation (13-15), and improve MSC osteogenic differentiation (15-17). The canonical Wnt signaling pathway can be initiated by the binding of Wnt ligands to the receptor complex, which is comprised of Frizzled (FZD) and LDL receptor related protein (Lrp)5/Lrp6, resulting in the accumulation of β-catenin in the cytoplasm and its translocation to the nucleus to interact with transcription factor 1 (Tcf1)/lymphoid enhancer binding factor 1 (Lef1) (12). Lrp5 is a transmembrane receptor involved in the aforementioned signaling pathway (18). Several recent studies have indicated that inactivation of the canonical Wnt signaling pathway in Lrp5 knockout mice leads to symptoms of bone loss (19,20). By contrast, Lrp5 mutations in mice can result in high bone mass (21).

Casein kinase-2 interaction protein-1 (Ckip-1) mediates interactions with various proteins to participate in different signaling pathways (22). Ckip-1 was initially identified as a negative regulator of the BMP signaling pathway via the activation of Smad Specific E3 Ubiquitin Protein Ligase 1 and the degradation of Smad1/5(23). However, a limited number of studies have focused on other bone formation signaling pathways. The present study investigated whether Ckip-1 interacted with the canonical Wnt signaling pathway in MSCs, and the role of Lrp5 that may be involved in it.

Materials and methods

Cell culture and osteogenic induction

C3H10T1/2 cells (donated by the Tissue Engineering Center of the Fourth Military Medical University of China) were cultured at 37˚C with 5% CO2 in low glucose DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 0.1% streptomycin/penicillin. The culture medium was changed every 2 days and the cells were passaged at ~85% confluence. At ~85% confluence, osteogenic differentiation was induced by culturing cells in osteogenic medium (DMEM supplemented with 10% FBS, 10 nM dexamethasone, 10 mM β-glycerophosphate and 50 µg/ml ascorbic acid; all purchased from Sigma-Aldrich; Merck KGaA) for 7 or 14 days at 37˚C with 5% CO2.

Cell transfection

C3H10T1/2 cells were seeded (1x105 cells/well) into 24-well plates and cultured overnight prior to transfection. Lentivirus-packed Ckip-1 (Ckip-1 overexpression: Ubi-MCS-3FLAG-SV40-EGFP-IRES-puromycin; Ckip-1 knockdown: hU6-MCS-Ubiquitin-EGFP-IRES-puromycin; 1x108 TU/ml, 20 µl; Genechem, Inc.) and Lrp5 knockdown shRNA plasmids (GV248-hU6-MCS-Ubiquitin-EGFP-IRES-puromycin; 1x108 TU/ml, 20 µl; Genechem, Inc.) were transfected into C310T1/2 cells (1x105 cells/well) using polybrene (50 µg/ml, 20 µl; Genechem, Inc.) for 10 h at 37˚C. The Ckip-1 knockdown shRNA sequences used were as follows: Ckip-1-shRNA1, 5'-CCTGAGTGACTATGAGAAG-3'; Ckip-1-shRNA2, 5'-AGTGCGAAGAGCTCCGGAAA-3'; Lrp5-shRNA1, 5'-GACCTAAAGCGAAUCGAAA-3'; Lrp5-shRNA2, 5'-CGACCTGATGGGACUCAAA-3'; negative control shRNA of shCkip-1, 5'-TTCTCCGAACGTGTCACGT-3'; and negative control shRNA of shLrp5, 5'-TTCTCCGAACGTGTCACGT-3'. The empty plasmid served as the control of Ckip-1 overexpression group. Following culture for 72 h, fluorescence microscopy and reverse transcription-quantitative PCR (RT-qPCR) were used to verify the results of the transfection.

Immunofluorescence

Cells were seeded into 24-well plates at a density of 70%. Cells were washed three times with PBS and fixed with 4% paraformaldehyde at 37˚C for 30 min. Cells were permeabilized for 15 min with 0.2% Triton X-100 and sealed with 2% BSA (Sangon Biotech Co., Ltd.) for 30 min at room temperature. Subsequently, cells were incubated with an anti-Ckip-1 primary antibody (1:200; cat. no. D122120; Sangon Biotech Co., Ltd.) overnight at 4˚C. Following washing with PBS, cells were incubated with a goat anti-rabbit fluorescein-conjugated secondary antibody (1:1,000; cat. no. ab150079; Abcam) for 2 h in the dark. The nuclei were labeled with DAPI (5 µg/ml; Sigma-Aldrich; Merck KGaA) for 10 min at room temperature. Stained cells were visualized using a confocal scanning microscope (magnification, x40; Nikon Corporation). To observe cell localization, double immunofluorescence staining was performed using rabbit anti-Ckip-1 (1:200; cat. no. D122120; Sangon Biotech Co., Ltd.) and goat anti-Lrp5 (1:1,000; cat. no. ab36121; Abcam) antibodies. Similar to the aforementioned protocol, following fixation, permeabilization and sealing, cells were incubated with anti-Ckip-1 and anti-Lrp5 primary antibodies overnight at 4˚C. Subsequently, cells were incubated with a goat red fluorescein-conjugated secondary antibody (1:1,000; cat. no. ab150079; Abcam) for 2 h in the dark at room temperature. Following gentle washing with PBS, cells were incubated with a donkey green fluorescein-conjugated secondary antibody (1:1,000; cat. no. ab150129; Abcam) for 2 h in the dark at room temperature. Following washing with PBS, stained cells were visualized using a confocal laser scanning microscope (magnification, x40; Nikon Corporation).

Proliferation assay

Cell proliferation was analyzed by performing an MTT assay (Sigma-Aldrich; Merck KGaA). Following transfection, C3H10T1/2 cells were seeded (2x103 cells/well) in 96-well plates and cultured for 24 h. MTT (10 µl) was added to each well for 4 h at 37˚C. Subsequently, the medium was removed and DMSO was added to each well to dissolve the purple formazan. The absorbance was measured at a wavelength of 570 nm using a Bio-Rad 680 microplate reader (Bio-Rad Laboratories, Inc.).

Alkaline phosphatase (ALP) staining

Cells were seeded (5x105 cells/well) in 6-well plates. Following culture for 14 days, cells were washed with PBS and fixed in 4% paraformaldehyde at 4˚C for 30 min. ALP staining was performed using the BCIP/NBT ALP color development kit (LeaGene Biotech Co., Ltd.) according to the manufacturer's protocol. Stained cells were observed using a M205RA stereoscopic light microscope (Leica Microsystems GmbH) at a magnification of x200, and quantified using Image Pro Plus software (version 7.1; Media Cybernetics, Inc.).

RT-qPCR

Cells were seeded (5x105 cells/well) into 6-well plates and cultured in DMEM. Subsequently, the medium was removed and cells were washed three times with PBS. Total RNA was extracted using RNAisoPlus (Takara Bio, Inc.) and reverse transcribed into cDNA using Prime Script RT Master Mix (Takara Bio, Inc.) in a 20-µl volume. Subsequently, qPCR was performed using a SYBR PCR Master Mix kit (Takara Bio, Inc.) with 10 µM specific primers in a 25 µl total reaction volume with the following thermocycling conditions: Initial denaturation step at 95˚C for 1 min; followed by 35 cycles at 95˚C for 30 sec, 58˚C for 30 sec; and a final extension step at 72˚C for 30 sec. All signals were normalized to GAPDH, and the 2-ΔΔCq method was used for quantification (24). The mRNA expression levels of Ckip-1, RUNX family transcription factor 2 (Runx2), Osterix (Osx), type I collagen (Col1), bone sialoprotein (Bsp), osteocalcin (Ocn), Lrp5, Lef1 and Tcf1 were assessed via qPCR. The sequences of the primers used are presented in Table I. mRNA expression levels were normalized to the internal reference gene GAPDH.

Table I

Primers used for reverse transcription-quantitative PCR.

Table I

Primers used for reverse transcription-quantitative PCR.

GeneSequence (5'→3')
GAPDHF: AGGTCGGTGTGAACGGATTTG
 R: GTAGACCATGTAGTTGAGGTCA
Ckip-1F: AACCGCTATGTGGTGCTGAA
 R: CAGGGTGAACTTGCTGTGATTT
Runx2F: GACTGTGGTTACCGTCATGGC
 R: ACTTGGTTTTTCATAACAGCGGA
OsxF: CCCAGCCACCTTTACCTACA
 R: TATGGAGTGCTGCTGGTCTG
Col-1F: GAGGCATAAAGGGTCATCGTGG
 R: CATTAGGCGCAGGAAGGTCAG
BspF: GAGCCAGGACTGCCGAAAGGAA
 R: CCGTTGTCTCCTCCGCTGCTGC
OcnF: CAGCTTGGTGCACACCTAGC
 R: AGGGTTAAGCTCACACTGCTCC
Lrp5F: CTGCCAGGATCGCTCTGATG
 R: ACACTGTTGCTTGATGAGGACACAC
Lef1F: GCCACCGATGAGATGATCCC
 R: TTGATGTCGGCTAAGTCGCC
Tcf1F: TGAATCACCACCCGGAATGG
 R: CTGGGCCAACTTCACATCCC

[i] Ckip1, casein kinase-2 interaction protein-1; Runx2, RUNX family transcription factor 2; Osx, Osterix; Col-1, type I collagen; Bsp, bone sialoprotein; Ocn, osteocalcin; Lrp5, LDL receptor related protein 5; Lef1, lymphoid enhancer binding factor 1; Tcf1, transcription factor 1.

Western blotting

Total protein was extracted from cells using RIPA lysis buffer (Sangon Biotech Co., Ltd.) and quantified using a BCA protein kit (Sangon Biotech Co., Ltd.). Equal amounts of protein (20 µg/lane) were separated via 10% SDS-PAGE and transferred onto PVDF membranes, which were blocked in TBST (0.1% Tween-20) with 5% non-fat milk for 1 h at room temperature. Subsequently, the membranes were incubated with the following primary antibodies overnight at 4˚C: anti-Ckip-1 (1:500; cat. no. D122120; Sangon Biotech Co., Ltd.), anti-β-actin (1:3,000; cat. no. 4970; Cell Signaling Technology, Inc.), anti-Lrp5 (1:1,000; cat. no. ab38311; Abcam), anti-β-catenin (1:1,000; cat. no. 8480; Cell Signaling Technology, Inc.) and anti-α-tubulin (1:2,000; cat. no. 2125; Cell Signaling Technology, Inc.). Following primary incubation, the membranes were incubated with a fluorescein-conjugated secondary antibody (1:3,000; cat. no. ab150079; Abcam) for 2 h at room temperature. Protein bands were visualized using ECL reagent (Sangon Biotech Co., Ltd.) and Odyssey V3.0 image scanning (LI-COR Biosciences).

Statistical analysis

Statistical analyses were performed using SPSS software (version 19.0; SPSS, Inc.). Data are presented as the mean ± SD from at least three independent experiments. Comparisons among groups were analyzed using one-way ANOVA followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Ckip-1 knockdown and overexpression in C3H10T1/2 cells

Following transfection of C3H10T1/2 cells with different lentiviral expression vectors and subsequent puromycin selection, transfection efficiency was determined. The majority of cells displayed GFP expression and transfection efficiency was estimated to be ≥90% (Fig. 1A). In addition, the expression levels of Ckip-1 in different groups were measured via RT-qPCR and western blotting. Ckip-1 mRNA (Fig. 1B) and protein (Fig. 1C) expression levels were markedly decreased in the shCkip-1 group compared with the shCtrl group, whereas the opposite results were observed in the Ckip-1 group compared with the EV group, demonstrating successful and effective Ckip-1 knockdown and overexpression, respectively. To further detect the expression of Ckip-1 in C3H10T1/2 cells, immunofluorescence analysis was conducted. The majority of cells with green fluorescence in the shCtrl and EV groups displayed merged signals with red fluorescence that were representative of Ckip-1 detection (Fig. 1D). Decreased expression levels of Ckip-1 were observed in the shCkip-1 group compared with the shCtrl group, whereas increased expression levels of Ckip-1 were observed in the Ckip-1 group compared with the EV group.

Effects of Ckip-1 on C3H10T1/2 cell proliferation

To determine the effects of Ckip-1 knockdown and overexpression on C3H10T1/2 cell proliferation, an MTT assay was performed. On days 1, 3, 5 and 7, cell proliferation in the shCkip-1 group was significantly increased compared with the shCtrl group. By contrast, on day 5 and 7, cell proliferation in the Ckip-1 group was significantly decreased compared with the EV group (Fig. 2A).

Effects of Ckip-1 on C3H10T1/2 cell osteogenic differentiation

An ALP activity assay and RT-qPCR were performed to evaluate C3H10T1/2 cell osteogenic differentiation. Following 14-day osteoinduction, the shCkip-1 group displayed significantly higher positive staining (dark purple) compared with the shCtrl group (Fig. 2B). By contrast, the Ckip-1 group displayed significantly decreased ALP staining compared with the EV group. Moreover, gene expression analysis of osteogenic markers (Runx2, Osx, Col1, Ocn and Bsp) in the shCkip-1 group demonstrated a significant increase in expression levels compared with the shCtrl group (Fig. 2C). By contrast, with the exception of Bsp, the expression levels of the markers in the Ckip-1 group were significantly decreased compared with the EV group.

Ckip-1 knockdown and knockout increase the expression levels of Lrp5 in C3H10T1/2 cells

The effects of Ckip-1 knockdown on the expression levels of Lrp5, Tcf1 and Lef1 in C3H10T1/2 cells in the 7 d-shCkip-1 group were subsequently examined via RT-qPCR. The results indicated that the expression levels of Lrp5, Tcf1 and Lef1 were significantly increased in the 7 d-shCkip-1 group compared with the 7 d-shCtrl group (Fig. 3A). The western blotting results indicated that the expression levels of Lrp5 were increased in the 7 d-shCkip-1 group compared with the 7 d-shCtrl group, whereas β-catenin expression levels were not altered. However, the expression levels of Lrp5 and β-catenin were markedly increased in the 14 d-shCkip-1 group compared with the shCtrl group (Fig. 3B). To examine the cellular localization of Ckip-1 and Lrp5, immunofluorescence staining was performed (Fig. 3C). Colocalization of Ckip-1 (red) and Lrp5 (green) was observed in C3H10T1/2 cells under normal conditions. Moreover, the results suggested that Ckip-1 highly accumulated in the vicinity of the membrane of C3H10T1/2 cells, which may imply an underlying membrane-associated role of Ckip-1.

Decreased cell proliferation in the Lrp5 knockdown group can be rescued by shCkip-1

Simultaneous Lrp5 and Ckip-1 knockdown was achieved by lentiviral transfection and confirmed via RT-qPCR. In accordance with the aforementioned results, the expression level of Lrp5 was significantly increased in the shCkip-1 and shLrp5 + shCkip-1 groups compared with shCtrl group (Fig. 4A). C3H10T1/2 cell proliferation and osteogenic differentiation were evaluated in the different groups. At 3 and 5 days, cell proliferation in the shLrp5 group was significantly reduced compared with the shCtrl group (Fig. 4B). At 1, 3 and 5 days in the shLrp5 + shCkip-1 group, cell proliferation was significantly higher compared with the shLrp5 group.

Involvement of Lrp5 in Ckip-1 knockdown-induced C3H10T1/2 cell osteogenic differentiation

The relative gene expression levels of osteogenic markers in the shLrp5, shCkip-1, shLrp5 + shCkip-1 and shCtrl groups were evaluated after 7-day osteoinduction. The majority of the osteogenic markers were expressed at lower levels in the shLrp5 group compared with the shCtrl group, with significantly decreased Runx2 and Bsp expression levels in the shLrp5 group compared with the shCtrl group (Fig. 4C). However, in the shLrp5 + shCkip-1 group, osteogenic-related marker expression levels were significantly increased compared with the shLrp5 group. Moreover, the expression levels of the osteogenic markers in the shCkip-1 group were significantly higher compared with the shLrp5 + shCkip-1 group. The ALP activity detection results further indicated the rescue response of shCkip-1 in C3H10T1/2 cell osteogenic differentiation following Lrp5 knockdown (Fig. 4D).

Discussion

The stimulation of MSC proliferation and osteogenic differentiation is a promising approach for the treatment of bone defects (25,26). Ckip-1 can negatively regulate bone formation, and the canonical Wnt signaling pathway is one of the five osteogenesis signaling pathways (8,27). In the present study, the role of Ckip-1 in the regulation of osteogenic differentiation via the canonical Wnt signaling pathway was assessed. Moreover, to the best of our knowledge, with the exception of the BMP signaling pathway (22), the association between the osteogenic signaling pathways and Ckip-1 has not been previous reported. In the present study, the common C3H10T1/2 MSC-like pluripotent cell line was used, which was obtained from mouse embryos and established by Reznikoff et al in 1973(28). The effects of Ckip-1 on C3H10T1/2 cell proliferation and osteogenic differentiation were evaluated in the present study.

The results of the MTT assay indicated that C3H10T1/2 cell proliferation was enhanced and reduced in the shCkip-1 and Ckip-1 groups compared with the shCtrl and EV groups, respectively, indicating that Ckip-1 negatively regulated C3H10T1/2 cell proliferation. ALP activity is upregulated during osteogenesis and is regarded as an early bone marker (29). The ALP staining and RT-qPCR assays suggested that Ckip-1 also negatively regulated C3H10T1/2 cell osteogenic differentiation.

Subsequently, the association between Ckip-1 and the canonical Wnt signaling pathway was investigated. Following immunofluorescence staining, the expression and localization of Ckip-1 were examined in the cell membrane, cytoplasm and nucleus under normal conditions. High accumulation of Ckip-1 was observed at the cell membrane, which indicated colocalization of Ckip-1 with the Lrp5 receptor. Previous studies have suggested that Ckip-1 is localized near the cell membrane and distributed throughout the cytoplasm or in the nucleus, suggesting that its function is determined by its cellular location (30-33). Therefore, it was hypothesized that membrane-associated Ckip-1 localization may account for the phenotype of the C3H10T1/2 cell line or for the expression of the membrane receptors.

Ckip-1 knockdown significantly increased the expression levels of the key molecules of the canonical Wnt signaling pathway (Lrp5, Lef1 and Tcf1) in C3H10T1/2 cells compared with the shCtrl group. Lrp5 knockdown was established in C3H10T1/2 cells, since the cell line exhibited high Lrp5 expression compared with the shCtrl group (Fig. 3A and B). Lrp5 is a transmembrane receptor that can bind to Wnt ligands and FZD proteins to initiate and activate the canonical Wnt signaling pathway (12). Related studies have demonstrated that disruption of Lrp5 can result in a low bone mass phenotype in postnatal mice, whereas Lrp5 knockdown can lead to a high bone mass phenotype (34,35). The shCkip-1 group displayed increased expression levels of Lrp5 compared with the shCtrl group, as determined via RT-qPCR and western blotting. In addition, β-catenin is an important downstream molecule of the canonical Wnt signaling pathway (36,37). Previous studies have indicated that deletion of β-catenin can negatively affect osteoblast differentiation and bone formation (36,37). The western blotting results indicated that β-catenin expression levels were significantly increased on day 14 of osteoinduction in the shCkip-1 group compared with the shCtrl group, which was consistent with previous studies.

In the present study, the effect of Lrp5 knockdown on C3H10T1/2 cell proliferation and osteogenic differentiation was assessed. Moreover, the potential of Ckip-1 knockdown to reverse Lrp5 knockdown-mediated effects was also examined. Following lentiviral transfection, MTT and RT-qPCR assays were performed to evaluate cell proliferation and osteogenic marker expression, respectively. Cell proliferation was significantly decreased in the shLrp5 group on day 3 compared with the shCtrl group, indicating that Lrp5 may exert a potential positive effect on C3H10T1/2 cell proliferation. The shLrp5 + shCkip-1 group displayed higher cell proliferation compared with the shLrp5 group, which implied a rescue role of shCkip-1. With regard to osteogenic differentiation, the expression levels of the osteogenic-associated genes of the shLrp5 + shCkip-1 group were significantly increased compared with the shCtrl and shLrp5 groups. The shLrp5 and shCtrl groups displayed no significant differences. However, the expression levels of almost all the genes investigated were slightly decreased in the shLrp5 group compared with the shCtrl group, which was consistent with previous findings demonstrating that Lrp5 may serve a positive regulatory role on bone formation (34,35). Furthermore, it was hypothesized that the transmembrane receptor Lrp5 may serve as a potential target of Ckip-1 based on the membrane-associated colocalization of Ckip-1 and Lrp5 in C3H10T1/2 cells. However, further studies are required to verify the hypothesis, potentially by using a Wnt inhibitor.

In conclusion, the present study evaluated the effects of Ckip-1 on C3H10T1/2 cell proliferation and osteogenic differentiation, as well as the potential underlying mechanism. The results demonstrated that Ckip-1 negatively regulated C3H10T1/2 MSC cell proliferation and osteogenic differentiation via the canonical Wnt-signaling receptor Lrp5, which may provide a promising target for the improvement of BTE.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by the National Natural Science Foundation of China (grant no. 81670803).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YS and LK conceived the study. XH and JL designed the experiments. JL provided software. YG validated, formally analyzed and investigated the data. YH provided resources and performed experiments. XH wrote and reviewed the final manuscript. YS provided supervision. LK provided project administration and acquired funding. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Li L, Lu H, Zhao Y, Luo J, Luo J, Yang L, Liu W and He Q: Functionalized cell-free scaffolds for bone defect repair inspired by self-healing of bone fractures: A review and new perspectives. Mater Sci Eng C Mater Biol Appl. 98:1241–1251. 2019.PubMed/NCBI View Article : Google Scholar

2 

Liu M and Lv Y: Reconstructing bone with natural bone graft: A review of in vivo studies in bone defect animal model. Nanomaterials (Basel). 8(E999)2018.PubMed/NCBI View Article : Google Scholar

3 

Wei X, Liu B, Liu G, Yang F, Cao F, Dou X, Yu W, Wang B, Zheng G, Cheng L, et al: Mesenchymal stem cell-loaded porous tantalum integrated with biomimetic 3D collagen-based scaffold to repair large osteochondral defects in goats. Stem Cell Res Ther. 10(72)2019.PubMed/NCBI View Article : Google Scholar

4 

Chen X, Fan H, Deng X, Wu L, Yi T, Gu L, Zhou C, Fan Y and Zhang X: Scaffold structural microenvironmental cues to guide tissue regeneration in bone tissue applications. Nanomaterials (Basel). 8(E960)2018.PubMed/NCBI View Article : Google Scholar

5 

White KA and Olabisi RM: Spatiotemporal control strategies for bone formation through tissue engineering and regenerative medicine approaches. Adv Healthc Mater. 8(e1801044)2019.PubMed/NCBI View Article : Google Scholar

6 

El-Rashidy AA, Roether JA, Harhaus L, Kneser U and Boccaccini AR: Regenerating bone with bioactive glass scaffolds: A review of in vivo studies in bone defect models. Acta Biomater. 62:1–28. 2017.PubMed/NCBI View Article : Google Scholar

7 

Leyendecker Junior A, Gomes Pinheiro CC, Lazzaretti Fernandes T and Franco Bueno D: The use of human dental pulp stem cells for in vivo bone tissue engineering: A systematic review. J Tissue Eng. 9(2041731417752766)2018.PubMed/NCBI View Article : Google Scholar

8 

Wehner D and Weidinger G: Signaling networks organizing regenerative growth of the zebrafish fin. Trends Genet. 31:336–343. 2015.PubMed/NCBI View Article : Google Scholar

9 

Ren L, Chen H, Song J, Chen X, Lin C, Zhang X, Hou N, Pan J, Zhou Z, Wang L, et al: MiR-454-3p-mediated Wnt/β-catenin signaling antagonists suppression promotes breast cancer metastasis. Theranostics. 9:449–465. 2019.PubMed/NCBI View Article : Google Scholar

10 

Yuan K, Shamskhou EA, Orcholski ME, Nathan A, Reddy S, Honda H, Mani V, Zeng Y, Ozen MO, Wang L, et al: Loss of endothelial derived WNT5A is associated with reduced pericyte recruitment and small vessel loss in pulmonary arterial hypertension. Circulation. 139:1710–1724. 2019.PubMed/NCBI View Article : Google Scholar

11 

Gong B, Shen W, Xiao W, Meng Y, Meng A and Jia S: The Sec14-like phosphatidylinositol transfer proteins Sec14l3/SEC14L2 act as GTPase proteins to mediate Wnt/Ca2+ signaling. Elife. 6(e26362)2017.PubMed/NCBI View Article : Google Scholar

12 

Baron R and Kneissel M: WNT signaling in bone homeostasis and disease: From human mutations to treatments. Nat Med. 19:179–192. 2013.PubMed/NCBI View Article : Google Scholar

13 

Taipaleenmäki H, Abdallah BM, Aldahmash A, Säämänen AM and Kassem M: Wnt signalling mediates the cross-talk between bone marrow derived pre-adipocytic and pre-osteoblastic cell populations. Exp Cell Res. 317:745–756. 2011.PubMed/NCBI View Article : Google Scholar

14 

Day TF, Guo X, Garrett-Beal L and Yang Y: Wnt/beta-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev Cell. 8:739–750. 2005.PubMed/NCBI View Article : Google Scholar

15 

D'Alimonte I, Lannutti A, Pipino C, Di Tomo P, Pierdomenico L, Cianci E, Antonucci I, Marchisio M, Romano M, Stuppia L, et al: Wnt signaling behaves as a ‘master regulator’ in the osteogenic and adipogenic commitment of human amniotic fluid mesenchymal stem cells. Stem Cell Rev Rep. 9:642–654. 2013.PubMed/NCBI View Article : Google Scholar

16 

Zuo R, Liu M, Wang Y, Li J, Wang W, Wu J, Sun C, Li B, Wang Z, Lan W, et al: BM-MSC-derived exosomes alleviate radiation-induced bone loss by restoring the function of recipient BM-MSCs and activating Wnt/β-catenin signaling. Stem Cell Res Ther. 10(30)2019.PubMed/NCBI View Article : Google Scholar

17 

Fan J, An X, Yang Y, Xu H, Fan L, Deng L, Li T, Weng X, Zhang J and Zhao RC: MiR-1292 targets FZD4 to regulate senescence and osteogenic differentiation of stem cells in TE/SJ/mesenchymal tissue system via the Wnt/β-catenin pathway. Aging Dis. 9:1103–1121. 2018.PubMed/NCBI View Article : Google Scholar

18 

Williams BO: LRP5: From bedside to bench to bone. Bone. 102:26–30. 2017.PubMed/NCBI View Article : Google Scholar

19 

Li T, Li H, Wang Y, Li T, Fan J, Xiao K, Zhao RC and Weng X: microRNA-23a inhibits osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by targeting LRP5. Int J Biochem Cell Biol. 72:55–62. 2016.PubMed/NCBI View Article : Google Scholar

20 

Borrell-Pagès M, Romero JC and Badimon L: LRP5 deficiency down-regulates Wnt signalling and promotes aortic lipid infiltration in hypercholesterolaemic mice. J Cell Mol Med. 19:770–777. 2015.PubMed/NCBI View Article : Google Scholar

21 

Semenov MV and He X: LRP5 mutations linked to high bone mass diseases cause reduced LRP5 binding and inhibition by SOST. J Biol Chem. 281:38276–38284. 2006.PubMed/NCBI View Article : Google Scholar

22 

Nie J, Liu L, He F, Fu X, Han W and Zhang L: CKIP-1: A scaffold protein and potential therapeutic target integrating multiple signaling pathways and physiological functions. Ageing Res Rev. 12:276–281. 2013.PubMed/NCBI View Article : Google Scholar

23 

Lu K, Yin X, Weng T, Xi S, Li L, Xing G, Cheng X, Yang X, Zhang L and He F: Targeting WW domains linker of HECT-type ubiquitin ligase Smurf1 for activation by CKIP-1. Nat Cell Biol. 10:994–1002. 2008.PubMed/NCBI View Article : Google Scholar

24 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

25 

Chen BY, Wang X, Chen LW and Luo ZJ: Molecular targeting regulation of proliferation and differentiation of the bone marrow-derived mesenchymal stem cells or mesenchymal stromal cells. Curr Drug Targets. 13:561–571. 2012.PubMed/NCBI View Article : Google Scholar

26 

Lee DJ, Kwon J, Current L, Yoon K, Zalal R, Hu X, Xue P and Ko CC: Osteogenic potential of mesenchymal stem cells from rat mandible to regenerate critical sized calvarial defect. J Tissue Eng. 10(2041731419830427)2019.PubMed/NCBI View Article : Google Scholar

27 

Moore ER and Jacobs CR: The primary cilium as a signaling nexus for growth plate function and subsequent skeletal development. J Orthop Res. 36:533–545. 2018.PubMed/NCBI View Article : Google Scholar

28 

Reznikoff CA, Brankow DW and Heidelberger C: Establishment and characterization of a cloned line of C3H mouse embryo cells sensitive to postconfluence inhibition of division. Cancer Res. 33:3231–3238. 1973.PubMed/NCBI

29 

Hashimi SM: Exogenous noggin binds the BMP-2 receptor and induces alkaline phosphatase activity in osteoblasts. J Cell Biochem. 120:13237–13242. 2019.PubMed/NCBI View Article : Google Scholar

30 

Li D, Zhu H, Liang C, Li W, Xing G, Ma L, Ding L, Zhang Y, He F and Zhang L: CKIP-1 suppresses the adipogenesis of mesenchymal stem cells by enhancing HDAC1-associated repression of C/EBPα. J Mol Cell Biol. 6:368–379. 2014.PubMed/NCBI View Article : Google Scholar

31 

Safi A, Vandromme M, Caussanel S, Valdacci L, Baas D, Vidal M, Brun G, Schaeffer L and Goillot E: Role for the pleckstrin homology domain-containing protein CKIP-1 in phosphatidylinositol 3-kinase-regulated muscle differentiation. Mol Cell Biol. 24:1245–1255. 2004.PubMed/NCBI View Article : Google Scholar

32 

Zhang L, Xing G, Tie Y, Tang Y, Tian C, Li L, Sun L, Wei H, Zhu Y and He F: Role for the pleckstrin homology domain-containing protein CKIP-1 in AP-1 regulation and apoptosis. EMBO J. 24:766–778. 2005.PubMed/NCBI View Article : Google Scholar

33 

Bosc DG, Graham KC, Saulnier RB, Zhang C, Prober D, Gietz RD and Litchfield DW: Identification and characterization of CKIP-1, a novel pleckstrin homology domain-containing protein that interacts with protein kinase CK2. J Biol Chem. 275:14295–14306. 2000.PubMed/NCBI View Article : Google Scholar

34 

Kato M, Patel MS, Levasseur R, Lobov I, Chang BHJ, Glass DA II, Hartmann C, Li L, Hwang TH, Brayton CF, et al: Cbfa1-independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor. J Cell Biol. 157:303–314. 2002.PubMed/NCBI View Article : Google Scholar

35 

Cui Y, Niziolek PJ, MacDonald BT, Zylstra CR, Alenina N, Robinson DR, Zhong Z, Matthes S, Jacobsen CM, Conlon RA, et al: Lrp5 functions in bone to regulate bone mass. Nat Med. 17:684–691. 2011.PubMed/NCBI View Article : Google Scholar

36 

Hu H, Hilton MJ, Tu X, Yu K, Ornitz DM and Long F: Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development. 132:49–60. 2005.PubMed/NCBI View Article : Google Scholar

37 

Hill TP, Später D, Taketo MM, Birchmeier W and Hartmann C: Canonical Wnt/beta-catenin signaling prevents osteoblasts from differentiating into chondrocytes. Dev Cell. 8:727–738. 2005.PubMed/NCBI View Article : Google Scholar

Related Articles

Journal Cover

April-2021
Volume 21 Issue 4

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Huang X, Liang J, Gao Y, Hou Y, Song Y and Kong L: Ckip‑1 regulates C3H10T1/2 mesenchymal cell proliferation and osteogenic differentiation via Lrp5. Exp Ther Med 21: 342, 2021
APA
Huang, X., Liang, J., Gao, Y., Hou, Y., Song, Y., & Kong, L. (2021). Ckip‑1 regulates C3H10T1/2 mesenchymal cell proliferation and osteogenic differentiation via Lrp5. Experimental and Therapeutic Medicine, 21, 342. https://doi.org/10.3892/etm.2021.9773
MLA
Huang, X., Liang, J., Gao, Y., Hou, Y., Song, Y., Kong, L."Ckip‑1 regulates C3H10T1/2 mesenchymal cell proliferation and osteogenic differentiation via Lrp5". Experimental and Therapeutic Medicine 21.4 (2021): 342.
Chicago
Huang, X., Liang, J., Gao, Y., Hou, Y., Song, Y., Kong, L."Ckip‑1 regulates C3H10T1/2 mesenchymal cell proliferation and osteogenic differentiation via Lrp5". Experimental and Therapeutic Medicine 21, no. 4 (2021): 342. https://doi.org/10.3892/etm.2021.9773