This article is mentioned in:

Introduction

Curcumin is a phenolic pigment extracted from turmeric (Curcuma longa) rhizomes with anti-inflammatory, antioxidant and anti-cancer properties (1-5). In the gastrointestinal tract, curcumin plays important anti-inflammatory and tumor-suppressive roles (6-8). Our previous study suggested that gastrointestinal food propulsion was delayed by exogenous nitric oxide (NO) and atropine in mice and that curcumin could attenuate this effect (9). However, the mechanism of action of curcumin remains unclear.

NO synthase (NOS) generates NO using L-arginine as a precursor in vivo. NO is non-cholinergic and non-adrenergic neurotransmitter that inhibits gastrointestinal motility by relaxing gastrointestinal smooth muscles (10). Atropine is an antagonist of acetylcholine receptors (AChRs) that inhibits the contracting effect of ACh on gastrointestinal smooth muscles (11). Moreover, NO also can inhibit gastrointestinal motility by disrupting the activity of ICC (12) and ACh can stimulate ICC to regulate gastrointestinal motility by combining with the corresponding neurotransmitter receptor (13). ICC are mesenchymal cells that serve a key role in normal gastrointestinal motility (14,15). ICC mediate the interaction between the autonomic nervous system and smooth muscle cells of the digestive tract. Thus, ICC act as the ‘pacemaker’ of the gastrointestinal tract by generating spontaneous electrical slow waves and regulating rhythmic peristalsis (16). A previous study reported that ICC depletion and damage, network disruption (17,18) and the decreased expression of calcium-activated chloride channel (19) may lead to aberrant slow wave initiation and conduction. The c-kit tyrosine kinase receptor is an established marker of ICC (20). Indeed, c-kit and its ligand, stem cell factor (SCF), regulate ICC proliferation, development and functional maintenance (21). Insufficient c-kit/SCF signaling contributes to intestinal motility dysfunction induced by hypoxia in neonatal mice (22). Anoctamin 1 (Ano1) is a calcium-activated chloride channel identified as a selective molecular marker ICC in the human and murine gastrointestinal tracts (23). Slow gastrointestinal contraction depends on Ano1 activation in ICC (24). In addition, the gap junction protein connexin 43 (CX43) also serves a key role in the transmission and regulation of gastrointestinal motility (25,26).

The aim of the present study was to determine the mechanisms through which curcumin improves gastrointestinal motility using L-arginine and atropine-induced murine models of functional gastric emptying disorder. In addition to NO and ACh levels, the expression levels of several ICC markers, including C-kit, Ano1 and CX43, were also examined in the stomach to determine whether curcumin alters ICC.

Materials and methods

Chemicals

Curcumin (Sigma-Aldrich; Merck KGaA) was mixed in a 5% gum arabic solution to a concentration of 25 g/l for intragastric administration. L-arginine (Sigma-Aldrich; Merck KGaA) was mixed with a 5% gum arabic suspension for a final concentration of 250 g/l. Atropine Sulfate Injection (Tianjin Pharmaceutical Group Xinzheng Co., Ltd.) was diluted with saline to a concentration of 0.075 g/l.

Animals

Because hormone secretion in female mice may affect experimental results, male mice were exclusively used in the present study. A total of 40 male Kunming mice (3 weeks) weighing 19-22 g were supplied by Jinan Pengyue Experimental Animal Co. Ltd. The mice were housed at 18-22˚C and 50-60% humidity, in a 12-h light/dark cycle with free access to food and water. They were allowed to acclimatize to their surroundings for a week before experimentation. All animal experiments were approved by The Animal Ethics Committee of Qingdao University (approval no. QYFY WZLL 2017-10-16).

L-arginine-induced model establishment

Mice were randomly divided into normal (untreated) control, curcumin, L-arginine and curcumin + L-arginine groups (n=10 mice/group). Curcumin (200 mg/kg) was administered intragastrically in a 0.2-ml volume once per day for 15 days, as previously described (9). Mice in the curcumin-untreated groups received gum arabic suspension alone. From the 11th day, 2 g/kg L-arginine (2 g/kg, 0.2 ml) suspension was administered intragastrically in a 0.2-ml volume once per day for 5 consecutive days. Mice in L-arginine-untreated groups received gum arabic suspension.

Atropine-induced model establishment

Similar to the L-arginine model, mice were randomly divided into normal control, curcumin, atropine and curcumin + atropine groups (n=10 mice/group). Curcumin was administered as described for the L-arginine-induced model. On the 16th day, 0.5 mg/kg atropine sulfate was injected intraperitoneally in a 0.2-ml volume. Mice in atropine-untreated groups received 0.2 ml physiological saline.

Gastric emptying rate

All mice were fasted for 24 h. A volume of 0.8 ml semi-fluid gum arabic solution was administered intragastrically to mice for gastric emptying test. The animals were sacrificed by cervical dislocation 20 min later. The stomach was removed and weighed to determine the total weight (T), then cut along the greater curvature to remove the contents. The stomach was then weighed again to obtain the net weight (t). The gastric emptying rate (%) was calculated according to the following formula [1 - (X/Y)] x 100, where X = T - t, and Y is volume of semi-fluid solution.

NO content, acetylcholinesterase (AChE) and NOS activity measurement

Total of 4 g of gastric tissue were ground into a 10% homogenate solution at 4˚C in lysis buffer according to the manufacturer's instructions (NO assay kit, cat. no. A102-1; AchE assay kit, cat. no. A024-1-1; NOS typed assay kit, cat. no. A014-1; all from Nanjing Jiancheng Bioengineering Institute). After a 10-min centrifugation at 2,500-3,500 x g and 4˚C, the supernatant was collected and combined with the color development reaction solution from the aforementioned kits. The samples were then transferred to a 96-well plate and absorbance was measured with an automatic enzyme marker to calculate NO content (550 nm) and the activities of NOS (530 nm) and AChE (412 nm).

Reverse transcription-quantitative PCR (RT-qPCR)

RT-qPCR was carried out to measure the expression of the AChE, AChR, c-kit, CX43 and Ano1 genes. Total RNA was extracted from mouse gastric tissue using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.). A total of 1 µg RNA was reverse transcribed at 37˚C for 15 min and 85˚C for 5 sec, using the PrimeScript RT reagent kit (Takara Bio, Inc.). qPCRs were carried out using SYBR Premix Ex Taq II (Takara Bio, Inc.) on a 7500 Fast Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: Initial denaturation at 95˚C for 30 sec; followed by 40 cycles at 95˚C for 10 sec, 60˚C for 20 sec and 72˚C for 30 sec. All reactions were set up in triplicate for each sample. Primers were purchased from Sangon Biotech Co., Ltd. (Table I). The expression levels of mRNA were calculated using the 2-ΔΔCq method (27). Gene expression was normalized to a GAPDH internal control, and data are presented as n-fold expression difference of each sample relative to the respective control group.

Table I Primer sequences used for reverse transcription-quantitative PCR.

Table I

Primer sequences used for reverse transcription-quantitative PCR.

Gene	Primer sequence (5'→3')
AchE	F: ACCTGCTTCTCCCACACCT
	R: GGTTCCCACTCGGTAGTTCA
AchR	D: CATCTTGCTGGCTTTCATCA
	R: CACAGCCAGTAGCCCAGATT
C-kit	F: AGCGTGTGTAAATCGTGTTTG
	R: ACATTCAGCATTCCTCCCATA
Ano1	F: AGCGGAAGCAGCGCTATGA
	R: GGGTGACAAAGCCGAACTGAA
CX43	F: ACCCAACAGCAGCAGACTTTGA
	R: GCTTGGACCTTGTCCAGCAG
GAPDH	F: CGGAGTCAACGGATTTGGTCGTAT
	R: AGCCTTCTCCATGGTGGTGAAGAC

[i] Ano1, anoctamin 1; AChE, acetylcholinesterase; AChR, acetylcholine receptor; CX43, connexin 43.

Western blotting

Proteins were extracted from stomach tissue by homogenization at 4˚C in RIPA lysis buffer supplemented with phenylmethylsulphonyl fluoride (Beijing Solarbio Science & Technology Co., Ltd.). The lysate was centrifuged at 10,000 x g and 4˚C for 5 min, and protein concentration in the supernatant was quantified using a bicinchoninic acid assay kit (Beyotime Institute of Biotechnology). Protein samples (15 µg) were loaded into each lane of a 5% stacking gel and 8% resolving gel (Beijing Solarbio Science & Technology Co., Ltd.) and separated by SDS-PAGE. Proteins were electrotransferred to PVDF membranes. The membranes were then blocked in 5% milk for 1 h at room temperature, then incubated at 37˚C for 1 h with the following primary antibodies against the following proteins purchased from BIOSS: i) CX43 (1:500), cat. no. bs-0651R; ii) c-kit (1:500), cat. no. bs-0672R; iii) ano1 (1:300), cat. no. bs-9061R; and iv) GAPDH (1:500), cat. no. bs-0755R. After three washes with 1X TBS + 0.1% Tween-20, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (goat anti-rabbit IgG (H+L)/HRP antibody (1:3,000), cat. no. bs-40295G-HRP; Beijing Biosynthesis Biotechnology Co., Ltd.) for 1 h at room temperature. Protein bands were visualized with ECL Western Blotting Substrate (Thermo Fisher Scientific, Inc.). Densitometry was carried out using ImageJ software (version no. 1.52; National Institutes of Health).

Statistical analysis

All assays in the present study were repeated three times. Data analysis was performed using SPSS 17.0 (SPSS, Inc.). Data are expressed as the mean ± SD. Multigroup comparisons were analyzed using ANOVA, followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Changes in gastric emptying rate in the L-arginine model

Following L-arginine treatment, the gastric emptying rate significantly decreased, compared with the control (P<0.01; Fig. 1A). However, curcumin pre-treatment significantly improved the delayed gastric emptying rate caused by L-arginine (P<0.01). In addition, the administration of curcumin alone had no significant effect on the gastric emptying rate, compared with control mice (P>0.05).

Figure 1 Changes in gastric emptying rates and the relative biomarkers of NO following Cur and L-arg treatment. (A) Changes in gastric emptying rates. (B) NO content. (C) TNOS and (C) iNOS activity. Data are presented as the mean ± SD; ##P<0.01 vs. Control; **P<0.01 vs. L-arg. Cur, curcumin; gprot, grams of protein; iNOS, inducible NO synthase; L-arg, L-arginine; mgprot, milligrams of protein; NO, nitric oxide; TNOS, total NO synthase.

Changes in NO content, total NOS (TNOS) and inducible NOS (iNOS) activity in the L-arginine model

L-arginine administration significantly increased NO content, as well as TNOS and iNOS activities compared with the control group (P<0.01). However, pretreatment with curcumin led to a decrease in all three parameters compared with L-arginine-treated mice (P<0.01). Moreover, curcumin alone had no significant effect on NO content, TNOS activity and iNOS activity compared with control mice (P>0.05, respectively; Fig. 1B and C).

Changes in the expression of ICC markers in the L-arginine model

Following the administration of L-arginine, the relative mRNA levels of c-kit, ano1 and CX43 significantly decreased compared with control (P<0.01). Pretreatment with curcumin increased c-kit, ano1 and CX43 mRNA expression compared with L-arginine alone (P<0.01). There was no difference in gene expression of these markers following treatment with curcumin alone compared with controls (P>0.05, respectively; Fig. 2A). Similar results for protein expression levels were demonstrated by western blot analysis (Fig. 2B).

Figure 2 Changes in relative expression levels interstitial cells of Cajal markers following Cur and L-arg treatment. (A) Reverse transcription-quantitative PCR and (B) Western blot analysis. Data are presented as the mean ± SD; #P<0.05 and ##P<0.01, vs. Control; *P<0.05 and **P<0.01 vs. L-arg. Ano1, anoctamin 1; CX43, connexin 43; Cur, curcumin; L-arg, L-arginine.

Changes in gastric emptying rates in the atropine model

The gastric emptying rate significantly decreased following atropine treatment compared with the control group (P<0.01). However, curcumin pre-treatment significantly improved the delayed gastric emptying rate induced by atropine (P<0.01). Curcumin alone had no significant effect compared with control mice (P>0.05; Fig. 3A).

Figure 3 Changes in gastric emptying rates and the relative biomarkers of ACh following Cur and Atr treatment. (A) Changes in gastric emptying rates. (B) Activity levels of AChE. (C) AChE and AChR mRNA expression levels. Data are presented as the mean ± SD; #P<0.05 and ##P<0.01 vs. Control; *P<0.05 and **P<0.01 vs. Atr. AChE, acetylcholinesterase; AChR, acetylcholine receptor; Atr, atropine; Cur, curcumin; mgprot, milligrams of protein.

Changes in AChE and AChR levels in the atropine model

Following the administration of atropine, the activity of AChE (P<0.01), and the relative mRNA expression levels of AChE (P<0.01) and AChR (P<0.05) significantly decreased compared with the control group. Pretreatment with curcumin increased AChE activity (P<0.01) and mRNA expression of AChE (P<0.05) and AChR (P<0.05) compared with atropine alone. Curcumin alone had no significant effect on AChE activity (P>0.05) and gene expression of AChE (P>0.05) and AChR (P>0.05) (Fig. 3B and C, respectively).

Changes in the expression of ICC markers in the atropine model

Following atropine treatment, the relative mRNA levels of c-kit, ano1 and CX43 significantly decreased, compared with control (P<0.01). However, curcumin pre-treatment significantly increased the mRNA levels of c-kit (P<0.01), ano1 (P<0.01) and CX43 (P<0.05) compared with atropine alone. Curcumin alone had no significant effect on the expression of ICC markers compared with control mice (P>0.05; Fig. 4A). Similar results of the protein expression levels were demonstrated by western blot analysis (Fig. 4B).

Figure 4 Changes in relative expression levels of interstitial cells of Cajal markers following Cur and Atr treatment. (A) Reverse transcription-quantitative PCR and (B) Western blot analysis. Data are presented as the mean ± SD; #P<0.05 and ##P<0.01, vs. Control; *P<0.05 and **P<0.01 vs. Atr. Ano1, anoctamin 1; atr, atropine; Cur, curcumin; CX43, connexin 43.

Discussion

NO acts as an inhibitory neurotransmitter that relaxes gastrointestinal smooth muscles. However, excessive NO production can induce gastrointestinal motility dysfunction (10). Previous studies have reported that curcumin can inhibit iNOS activity, thereby reducing NO production in an in vitro model of inflamed human intestinal mucosa (28,29). In the present study, pretreatment with curcumin improved the gastric emptying rate in vivo using a murine model of gastric emptying disorders. In the L-arginine-induced model, curcumin pre-treatments decreased NO content and inhibited iNOS activity. It has been reported that curcumin promotes the degradation of iNOS and suppresses its enzyme activities in various types of cells (30,31). However, to the best of our knowledge, there are no previous reports about curcumin improving gastrointestinal dysfunction by inhibiting the activity of iNOS. The present findings provide additional evidence that curcumin ameliorates functional gastrointestinal dysfunction through the inhibition of iNOS activity.

ACh is a neurotransmitter that can induce contraction of gastrointestinal smooth muscles by binding to the AChR. Once released into the synapse, ACh is rapidly hydrolyzed by AChE to choline and acetic acid (32), and AChE activity can be measured by detecting the amount of choline in tissues. A previous study suggested that ACh release could increase AChE mRNA levels (33). Thus, the activity and mRNA level of AChE can reflect the release of ACh. In the atropine-induced mouse model of gastric emptying disorders, curcumin pre-treatment led to an increase in the activity and mRNA levels of AChE, suggesting that curcumin improved gastric emptying rate by stimulating ACh release in gastric tissues. This was also confirmed by the increased expression of AChR mRNA. The findings of the present study are in agreement with previous studies carried out in animal models. For example, curcumin increases AChE activity in the mice brain (34). Moreover, curcumin promoted ACh release in rat brain tissue (35). Nevertheless, how curcumin promotes ACh release is not fully understood.

Gastrointestinal motility is regulated by NO-mediated inhibition (12) and ACh-mediated stimulation (13) of ICC. In the present study, changes in the expression levels of ICC markers were also evaluated in murine gastric tissue. In both the L-arginine and atropine models, c-kit, ano1 and CX43 mRNA levels significantly decreased. However, pretreatment with curcumin inhibited the downregulation of these markers, suggesting that functional gastric emptying disorders caused by L-arginine and atropine may be related to ICC dysfunction. Thus, curcumin may alleviate functional gastric emptying disorders partly through an increase of related ICC signaling.

Through inhibiting exogenous NO production, promoting ACh release and improving signaling of ICC, curcumin may improve gastric emptying in the L-arginine and atropine mouse models, indicating that curcumin may promote delayed gastric emptying to some degree. Curcumin did not significantly affect the gastric emptying rate when administered alone. It is possible that a dose of 200 mg/kg curcumin intragastrically administered was not sufficient to affect the normal gastrointestinal tract. All indexes were observed 24 h after last application of curcumin. This time point fully ruled out the direct stimulation of curcumin in the stomach, which could more reasonably explain the effects of curcumin pre-treatment for more than 10 days. The dose and days of curcumin were chosen according to our previous study (9).

The use of curcumin has also been assessed in clinical trials, and early-phase trials have highlighted its safety and efficacy in patients (36). A previous study suggesting that high doses of curcumin were well-tolerated orally (37). However, the experimental biological benefits of curcumin have not yet been replicated in clinical trials, owing to its low bioavailability following oral administration (38). Nonetheless, since curcumin metabolites are detectable in the plasma following oral administration (38,39), it is possible that the effects of curcumin are also mediated by its metabolites. In addition, several strategies have been employed to improve the solubility of curcumin (40,41), which could improve its use and applicability.

In conclusion, the present study demonstrated that curcumin could reduce gastric emptying dysfunction. Thus, in addition to anti-inflammatory and antioxidant properties, curcumin could affect gastrointestinal peristalsis through inhibiting exogenous NO production, promoting ACh release and improving signaling of ICC. These findings identified a potential application for curcumin in the prevention of gastrointestinal disorders. However, the mechanism through which curcumin might exert its effect on gastric tissue, including ICC signal transduction, remains unclear. Owing to the complexity of regulation of gastrointestinal motility, other mechanisms of curcumin should be further examined.

Acknowledgements

Not applicable.

Funding

Funding: This work was supported by The Natural Science Foundation of Shandong Province (grant no. ZR2014HM033).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

PL, BL and XY contributed to the experimental design, carried out experiments and wrote the manuscript. JY, FS, HZ and JX carried out experiments and data analysis. All authors agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of The Qingdao University (Qingdao, China; approval no. QYFY WZLL 2017-10-16).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References