Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
May-2023 Volume 25 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2023 Volume 25 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Potential role of TREM2 in high cholesterol‑induced cell injury and metabolic dysfunction in SH‑SY5Y cells

  • Authors:
    • Qiang Zheng
    • Yinxiu Han
    • Min Fan
    • Xinran Gao
    • Mengdie Ma
    • Jingxian Xu
    • Sen Liu
    • Jinfang Ge
  • View Affiliations / Copyright

    Affiliations: School of Pharmacy, Anhui Medical University, Hefei, Anhui 230032, P.R. China
    Copyright: © Zheng et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 205
    |
    Published online on: March 22, 2023
       https://doi.org/10.3892/etm.2023.11904
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Triggering receptor expressed on myeloid cells 2 (TREM2) is an important member of the immunoglobulin family of inflammatory stimulating receptors and is involved in a number of pathophysiological processes. The present study aimed to investigate the role of TREM2 in neurotoxicity induced by high cholesterol levels in SH‑SY5Y cells and explore the potential mechanism. SH‑SY5Y cells were routinely cultured and stimulated with a range of cholesterol concentrations. Cell viability was assessed using an MTT assay, morphological changes were observed, and the cell cycle distribution was measured using flow cytometry. Lipid deposition was measured by Oil red O staining, and the mRNA and protein expression levels of SRBEP‑1 and SRBEP‑2 were detected by quantitative PCR and western blotting, respectively. Moreover, the protein expression levels of BDNF, Copine‑6, TREM1, TREM2, and key molecules of the Wnt signaling pathways were detected by western blotting. Finally, TREM2 was overexpressed to investigate its potential role in high cholesterol‑induced neurotoxicity. The results showed that cell viability was significantly decreased in SH‑SY5Y cells stimulated with cholesterol (0.1~100 µM) in a dose‑ and time‑dependent manner. Stimulation with 100 µM cholesterol for 24 h resulted in morphological injuries, increased the proportion of SH‑SY5Y cells at G0/G1, the degree of lipid accumulation, and the protein expression levels of sterol regulatory element binding protein (SREBP)1 and SREBP2, markedly decreased the protein expression levels of BDNF, Copine‑6, and TREM2, and the p‑β‑catenin/β‑catenin ratio, and increased the expression levels of nesfatin‑1, TREM1 and the p‑GSK3β/GSK3β ratio. Furthermore, the imbalanced expression of BDNF, Copine‑6, nesfatin‑1, and p‑GSK3β induced by high cholesterol levels was reversed after overexpression of TREM2. These results suggest that a high concentration of cholesterol could induce cell injury and lipid deposition in SH‑SY5Y cells and that the underlying mechanism may be associated with imbalanced TREM2 expression.

Introduction

Cholesterol is a major component of brain lipids and plays a crucial role in the maintenance of neuronal cell function, neurotransmission, and synapse formation; however, an increasing number of studies have demonstrated the adverse effects of excessive plasma cholesterol levels (1-3). In 2018, the new version of the Blood Cholesterol Management Guidelines was jointly developed and released by the American College of Cardiology, American Heart Association, and other departments, and this version clearly notes that high levels of cholesterol, particularly low-density lipoprotein cholesterol (LDL-C), can increase the risk of cardiovascular and cerebrovascular diseases such as heart attack and stroke (4,5). Moreover, excessive cholesterol is reportedly closely related to the progression of cognitive impairment and even Alzheimer's disease (AD) (6-8). Cholesterol is normally maintained at low levels in neurons, which inhibits β-amyloid (Aβ) accumulation and enables astrocytes to regulate Aβ accumulation by cholesterol signaling (9). However, imbalanced plasma cholesterol levels, particularly elevated LDL-C and decreased high-density lipoprotein cholesterol levels, are negative factors affecting cognitive function (7,10,11) and are positively correlated with abnormal amyloid deposition in the brain (11). Moreover, disturbed neuronal cholesterol homeostasis has been observed in AD (12), and the accumulation of intracellular cholesterol reportedly reduces the clearance of defective mitochondria (13) and thus contributes to the pathogenesis of AD. Furthermore, it has been reported that the targeted deletion of cholesterol synthesis in astrocytes decreases the burden of amyloid and tau in an AD mouse model (9). In our previous study, high-fat diet-fed rats showed not only hyperglycemia and hyperlipidemia with increased plasma concentrations of total cholesterol (TC), total triglycerides, and LDL-C, but also neuropsychiatric impairments, including decreased learning and memory abilities, as well as depression-like behavior, accompanied by reduced expression of brain-derived neurotrophic factor (BDNF) and related changes in synaptic plasticity in the hippocampus and prefrontal cortex (PFC) (14). These findings suggest a strong potency of high cholesterol against neuropsychiatric injuries. However, there remain other controversial results suggesting that high levels of cholesterol are a potential protective factor for cognitive decline (15) and are negatively correlated with the occurrence of dementia (16). Therefore, it is important to investigate the exact effects of cholesterol on neural cells and whether there is a clear connection and causality between turmoil lipids and cognitive impairment (17).

Sterol regulatory element binding proteins (SREBPs) are important regulators of cholesterol homeostasis that regulate several enzymes needed for the synthesis of cholesterol, fatty acids, triacylglycerol, and phospholipids (18). Dysregulation of SREBP-2 signaling has been observed in AD and related models, and this dysregulation is attributed to increased cholesterol levels and alterations in the tau protein (12). Nesfatin-1 is a peptide of 82 amino acids produced by hydrolysis of the N-terminus of nucleobindin2, which is widely distributed in central and peripheral tissues (19). Increased plasma concentrations of nesfatin-1 have been detected in diabetic patients (20) and rats with metabolic syndrome (21), and are involved in the regulation of glucose and lipid metabolism (22). It has been reported that chronic infusion of nesfatin-1 can prevent hepatic steatosis, partly by downregulating the expression of SREBP1(23). Furthermore, nesfatin-1 has been demonstrated to be associated with the regulation of cognition and mood (24,25). In line with these findings, an increased plasma concentration of nesfatin-1 has been observed in rats with hyperlipidemia (26) or stress (27) in our previous studies (28,29), and the results showed that the intraperitoneal injection of nesfatin-1 induced anxiety and depression-related behaviors in rats accompanied by adaptive changes in the expression of BDNF and synaptic plasticity in the hippocampus and PFC. These findings suggest the potential role of nesfatin-1 in linking metabolic disorders with neuropsychiatric injuries.

The classic Wnt/β-catenin signaling pathway is a highly conserved signaling pathway and one of the most conserved regulators of evolution in embryonic development and adult tissue homeostasis (30-32). Dysfunction of the Wnt/β-catenin signaling pathway has been demonstrated to play an important role in the pathogenesis of AD, Parkinson's disease, depression, and other neuropsychiatric diseases (10,33), and is partly involved in controlling neuronal activity-regulated BDNF secretion (34,35). The results of our previous study showed that the impaired learning and memory abilities and decreased expression of BDNF found in the hippocampus and PFC of high-fat diet-fed rats were associated with imbalanced expression of key molecules in the Wnt/β-catenin signaling pathway, including increased expression of CyclinD1 and decreased expression of phosphorylated β-catenin (26). Taken together with the protective role of BDNF in regulating cholesterol homeostasis (36), these findings suggest that the Wnt/β-catenin signaling pathway may be involved in neuropsychiatric dysfunction and the changes in the BDNF abundance caused by glucose and lipid metabolism disorders (37).

Triggering receptor expressed on myeloid cells (TREM), which was first discovered in 2000, is a relatively novel type of immunoglobulin family inflammatory stimulating receptor (38). TREM1 and TREM2 are two subtypes of this receptor, and they have been demonstrated to be involved in not only inflammatory and immune responses but also the regulation of neuropsychiatric function, including learning and memory. In addition to the relationship between AD and the gene polymorphisms of TREM1 or TREM2(39), it has also been reported that TREM2 can promote the survival of microglia by activating the Wnt/β-catenin pathway (40), accelerate the clearance of amyloid protein and reduce oxidative stress injury in hippocampal neurons (41). Upregulation of the expression of TREM2 can inhibit hippocampal neuronal apoptosis (12) and improve the spatial cognitive impairment in a mouse model of AD (42). In addition, inhibiting the expression of TREM2 can promote the abnormal accumulation of amyloid protein (43) and aggravate the impairment of spatial learning ability in P301S transgenic mice (44). However, Jiang et al (42) reported that the overexpression of TREM2 in microglia could effectively improve AD-like neuropathological changes and spatial learning and memory impairments in 7-month-old APPswe/PS1dE9 mice, including amyloid deposition, neuroinflammation, and neuronal and synaptic loss. However, their subsequent study revealed that the same intervention could not improve neuropathological damage and memory impairment in 18-month-old APPswe/PS1dE9 mice (45). These findings suggest that the role of TREM2 may be altered according to different pathological statuses. Consistently, in our previous study, differential expression levels of TREM2 were found in the hippocampus of rats of different ages and this was correlated with their performance in the Morris water maze. Moreover, imbalanced expression of TREM2 was also found in the hippocampus and PFC of rats fed a high-fat diet, suggesting that TREM2 may be involved in neuropsychiatric injury caused by abnormal glucose and lipid metabolism (46).

The aim of the present study was to investigate the effect of high cholesterol stimulation on the morphology and function of neuronal cells, and to explore the potential mechanism of action of TREM2 in neuronal cells.

Materials and methods

Cell culture

The neuroblastoma cell line SH-SY5Y was obtained from Wuhan Sunnbio Technology Co, Ltd. The cells were plated in DMEM (HyClone, Cytiva), 10% FBS (Biological Industries; Sartorius AG), and 1% penicillin/streptomycin (Beyotime Institute of Biotechnology) in a humidified incubator at 37˚C and supplied with 5% CO2.

Cholesterol challenge

16 mg of water-soluble cholesterol (MilliporeSigma) was dissolved in 10 ml PBS buffer solution to prepare a cholesterol mixture of 1,000 µM, which was successively diluted 10 times with DMEM before use. In the MTT assay, the cells were stimulated with 0.1-100 µM cholesterol for 3, 6, 9, 12, 24, or 48 h, and the effects of different concentrations and times on cell viability were observed. For all subsequent experiments, cells were treated with 100 µM for 24 h.

MTT assay

SH-SY5Y cells were plated in a 96-well culture plate at a density of 1x104 cells per well. After treatment with cholesterol, 10 µl MTT (Beijing Solarbio Science & Technology Co., Ltd.) was added to each well and the plate was incubated at 37˚C for 4 h. The supernatant was discarded, 150 µl DMSO was added per well, and the plate was incubated at 37˚C for 10 min. Net, the absorbance was measured with a microplate reader at 490 nm.

Oil red O staining

SH-SY5Y cells were plated in 6-well culture plates at a density of 2x105 cells per well. At the end of the stimulation period, the cells were washed three times with PBS and fixed with 4% paraformaldehyde for 10 min at 37˚C. Next, cells were washed twice, then stained with 0.5% Oil red O for 30 min at 37˚C. After staining, the cells were washed once with 60% isopropanol, washed with PBS until a colorless solution was obtained, and observed under a fluorescent inverted microscope at 50x magnification.

Cell cycle analysis

Cells (5x106) were collected and fixed in 70% ice-cold ethanol at -20˚C overnight. The cells were then collected and resuspended in PBS supplemented with 100 ng/ml RNase A and 50 ng/ml propidium iodide (PI) for 30 min at 37˚C. After staining, the distribution of cell cycle stage was assessed using a flow cytometer (CytoFLEX A00-1-1102, Beckman Coulter Biotechnology) and analysis software (CytExpert 2.4, Beckman Coulter Biotechnology).

Western blotting

SH-SY5Y cells were lysed using RIPA lysis buffer (cat. no. P0013B, Beyotime Institute of Biotechnology) supplemented with containing protease inhibitors (cat. no. ST507-10mL, Beyotime Institute of Biotechnology) and phosphatase inhibitors (cat. no. ST019-10mM, Beyotime Institute of Biotechnology). The protein samples were prepared, resolved using 12.5% SDS gels by SDS-PAGE, and transferred to PVDF membranes (cat. no. IPVH00010; MilliporeSigma). The membranes were blocked using 5% skimmed milk for 2 h at room temperature and incubated with antibodies against β-catenin, p-β-catenin (1:800; Abcam), TREM1 (1:2,000; Abcam), TREM2 (1:1,000; Abcam), CyclinD1 (1:1,000; Abcam), nesfatin-1 (1:5,000; Technology), GSK3β, p-GSK3β (Ser9) (1:1,000; Cell Signaling Technology, Inc.), Copine-6 (1:1,000; Santa Cruz Biotechnology, Inc.), BDNF (1:1,000; Abcam), or β-actin (1:1,000; OriGene Technologies, Inc.) overnight at 4˚C and then incubated with a horseradish peroxidase-conjugated secondary antibody (1:5,000; OriGene Technologies, Inc.) at 37˚C for 2 h. Densitometry analysis was performed using ImageJ 1.53 (National Institute of Health).

Reverse transcription-quantitative (RT-q)PCR

Total RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and converted to cDNA using a RT kit according to the manufacturer's protocol (Takara Bio, Inc.). qPCR was performed in a thermal cycler with the following amplification program: 95˚C for 3 min followed by 40 cycles of 95˚C for 10 sec and 55˚C for 30 sec. The sequences of the primers used were: Human SREBP1 forward, 5'ACACAGCAACCAGAAACTCAA3' and reverse, 5'AGTGTGTCCTCCACCTCAGTCT3'; human SREBP2 forward, 5'AGCAGAGTTCCTTCTGCCAT3' and reverse, 5'GACAGTAGCAGGTCACAGGT3'; and human β-actin forward, 5'TTGCCGACAGGATGCAGAA3' and reverse, 5'GCCGATCCACACGGAGTACTT3'. Expression was calculated using the 2-∆∆Cq method and normalized to the respective loading control.

Overexpression of TREM2

During the logarithmic growth phase, SH-SY5Y cells were counted and plated into 6-well culture plates with 2 ml cell suspension (2x105 cells/well). After the cells had adhered, the medium was discarded, and the cells were washed with PBS twice. A total of 1,600 µl Opti-MEM (Thermo Fisher Scientific, Inc.) was gently added to each well and the cells were then incubated at 37˚C for 12 h. Subsequently, 0.5 µg empty vector (pCMV-T7-3xFLAG-MCS-Neo, Wuhan MiaoLing Plasmid Company) or 0.5 µg TREM2 vector (pECMV-3xFLAG-TREM2, Wuhan MiaoLing Plasmid Company) were dissolved in 20 µl of sterile water, and 5 µl of the dissolved plasmid was added to 5 µl Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.) and 200 µl Opti-MEM, and this solution was incubated at room temperature for 20 min. After incubation, the mixture was added to the corresponding wells in the 6-well plate, and the cells were incubated at 37˚C for a further 8 h. Next, the culture medium was removed, the cells were washed with PBS twice, and treated with either control (normal medium) or cholesterol-containing medium, and further incubated at 37˚C for 24 h. The experiment consisted of six groups: Control, cholesterol, control + empty vector, control + TREM2 vector, cholesterol empty vector, and cholesterol + TREM2 vector.

Statistical analysis

All data were analyzed using SPSS (version 17.0, SPSS Inc.). Data are presented as the means ± SEM of at least three repeats. Data were compared using Student's t-test or a one-way ANOVA followed by a Tukey's post hoc test. GraphPad Prism 8 (GraphPad Software, Inc.) was used for Pearson correlation analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Dose- and time-dependent effects of cholesterol treatment on the viability of SH-SY5Y cells. SH-SY5Y cells were cultured and treated with cholesterol (0.1, 1, 10, or 100 µM) for 24 h. As shown in Fig. 1A, compared with that of the control group, the viability of SH-SY5Y cells gradually decreased in a dose-dependent manner, and the viability of cells treated with 100 µM cholesterol was ~50% (F0.05, 4=70.344, P≤0.0001). Fig. 1B shows the time-dependent effect of cholesterol on cell viability; a plateau in the effect of time was observed at 24 h (F0.05, 6=24.095, P≤0.0001). Therefore, for subsequent experiments, cells were treated with 100 µM cholesterol for 24 h.

Figure 1

Dose- and time-dependent effects of cholesterol treatment on the viability of SH-SY5Y cells. Data are presented as the means ± SEM of three repeats each from two separate passages (n=6). SH-SY5Y cells were treated with (A) increasing concentrations of cholesterol (0.1-100.0 µM) or (B) for increasing lengths of time from 3-48 h. **P<0.01 vs. control.

Effect of high cholesterol treatment on the cell cycle distribution of SH-SY5Y cells

As shown in Fig. 2, the number of SH-SY5Y cells in the G0/G1 after 24 h of stimulation with 100 µM cholesterol was significantly higher than that of the control group (t=4.354, P=0.022). However, cholesterol treatment had no significant effect on the proportion of cells in the S and G2/M phases.

Figure 2

Effect of high cholesterol on the cell cycle distribution of SH-SY5Y cells. Data are presented as the mean ± SEM of two repeats each from two separate passages (n=4). The number of SH-SY5Y cells in the G0/G1 phase increased significantly after 24 h of stimulation with 100 µM cholesterol. (A) Control, (B) Model, (C) statistical analysis of the cell cycle distribution results. *P<0.05 vs. control. Model, SH-SY5Y cells treated with 100 µM for 24 h.

Effects of high cholesterol treatment on lipid deposition and SREBP expression in SH-SY5Y cells

Fig. 3A and B show a typical graph of the Oil red O staining of each group. Compared with the results observed in the control group, high cholesterol treatment altered the morphology of SH-SY5Y cells from a spindle-like to an oval-like shape and increased the number of Oil red O-stained cells, with stained fat granules observed both inside and outside the cell. The protein (Fig. 3C-F) and mRNA (Fig. 3G and H) expression levels of SREBP1 (t=7.655, P≤0.0001 and t=6.994, P=0.020; respectively) and SREBP2 (t=5.643, P≤0.0001, t=1.582, P=0.254) in the cholesterol-stimulated SH-SY5Y cells were markedly higher than that in the control group.

Figure 3

Effects of high cholesterol treatment on lipid deposition and SREBP expression in SH-SY5Y cells. Data are presented as the mean ± SEM of three repeats from two separate passages (n=6). (A and B) Morphological changes in SH-SY5Y cells and lipid accumulation were detected by Oil red O staining. Magnification, x50. (C and D) Representative blots of SREBP1 and SREBP2 protein expression. (E and F) Densitometry analysis of the western blotting results. (G and H) Quantification of SREBP1 and SREBP2 mRNA expression levels. *P<0.05, **P<0.01 vs. control. Model, SH-SY5Y cells treated with 100 µM for 24 h; SREBP, sterol regulatory element binding protein.

Effect of high cholesterol treatment on the expression of BDNF, Copine-6, TREM1, and TREM2 in SH-SY5Y cells

Fig. 4A and B show the protein expression levels of BDNF, Copine-6, TREM1, and TREM2 in SH-SY5Y cells. Treatment with 100 µM cholesterol for 24 h markedly decreased the protein expression levels of BDNF (t=2.732, P=0.020), Copine-6 (t=6.144, P≤0.0001), and TREM2 (t=8.189, P≤0.0001) and markedly increased the protein expression levels of TREM1 (t=2.871, P=0.015) compared with that in the control group. Pearson correlation analysis showed that the protein expression levels of BDNF in SH-SY5Y cells were positively correlated with the expression of Copine-6 (r=0.888, P=0.003, Fig. 4C) and TREM2 (r=0.901, P=0.002, Fig. 4D) but negatively correlated with the expression of TREM1 (r=-0.715, P=0.046, Fig. 4E).

Figure 4

Effect of high cholesterol on the protein expression levels of BDNF, Copine-6, TREM1, and TREM2 in SH-SY5Y cells. Data are presented as the mean ± SEM of three repeats each from two separate passages (n=6). (A) Representative blots of BDNF, Copine-6, TREM1, and TREM2 expression in SH-SY5Y cells. (B) Densitometry analysis of the western blotting. (C-E) Pearson correlation analysis of BDNF with Copine-6, TREM1 and TREM2. *P<0.05, **P<0.01 vs. control. Model, SH-SY5Y cells treated with 100 µM for 24 h; TREM, triggering receptor expressed on myeloid cells.

Effects of high cholesterol treatment on the protein expression levels of nesfatin-1 and key molecules in the Wnt/β-catenin signaling pathway in SH-SY5Y cells

As shown in Fig. 5A and B, the cholesterol-stimulated SH-SY5Y cells exhibited a lower p-β-catenin/β-catenin protein expression ratio and higher protein expression levels of nesfatin-1 (t=4.299, P=0.001) and CyclinD1 (t=5.619, P≤0.0001) and an increase in the p-GSK3β/GSK3β ratio (t=2.883, P=0.015) compared with the control cells. No significant differences in CyclinD1 expression levels were observed between the two groups. Pearson correlation analysis showed that the protein expression levels of nesfatin-1 in SH-SY5Y cells was positively correlated with the expression of p-GSK3β (r=0.821, P=0.013, Fig. 5C), CyclinD1 (r=0.764, P=0.027, Fig. 5D) and TREM1 (r=0.706, P=0.050, Fig. 5E) but negatively correlated with the expression of TREM2 (r=-0.719, P=0.044, Fig. 5F), p-β-catenin (r=-0.869, P=0.005, Fig. 5G) and Copine-6 (r=-0.760, P=0.029, Fig. 5H).

Figure 5

Effects of high cholesterol on the protein expression levels of nesfatin-1 and key molecules in the Wnt/β-catenin signaling pathway in SH-SY5Y cells. Data are presented as the mean ± SEM of three repeats each from two separate passages (n=6). (A) Representative blots of nesfatin-1, CyclinD1, p-β-catenin, β-catenin, p-GSK3β, GSK3β protein expression in SH-SY5Y cells. (B) Densitometry analysis of the western blotting results. (C-H) Pearson correlation analysis of nesfatin-1 with p-GSK3β, CyclinD1, TREM1, TREM2, p-β-catenin and Copine 6. *P<0.05, **P<0.01 vs. control. Model, SH-SY5Y cells treated with 100 µM for 24 h.

Effect of TREM2 overexpression on dysregulation of BDNF, Copine-6, TREM1, and TREM2 protein expression induced by high cholesterol in SH-SY5Y cells

The mRNA (t=16.188, P=0.004) and protein (t=9.849, P=0.010) expression levels of TREM2 after transfection of the TREM2-overexpressing plasmid were significantly increased (Fig. 6A-C) compared with those of the control group. These results indicated the successful establishment of the TREM2 overexpression model.

Figure 6

Protein and mRNA expression levels of TREM2 after transfection of the TREM2-overexpressing plasmid in SH-SY5Y cells Data are presented as the mean ± SEM of three repeats each from two separate passages (n=6). (A) Representative blots of TREM2 in SH-SY5Y cells. (B) Densitometry analysis of the western blotting results. (C) Quantification of TREM2 mRNA expression levels. **P<0.01 vs. control. Model, SH-SY5Y cells treated with 100 µM for 24 h; TREM, triggering receptor expressed on myeloid cells.

As shown in Fig. 7A and B, the cholesterol-stimulated SH-SY5Y cells exhibited lower protein expression levels of BDNF (F0.05, 5=7.497, P=0.033) and Copine-6 (F0.05, 5=4.565, P=0.044) and higher expression of TREM1 (F0.05, 5=5.597, P=0.024) compared with the control cells. However, this imbalance in expression was reversed after overexpression of TREM2 as shown in Fig. 7B.

Figure 7

Effects of TREM2 overexpression on the protein expression levels of BDNF, Copine-6, TREM1, TREM2, nesfatin-1, and key molecules in the Wnt/β-catenin signaling pathway following treatment with 100 µM cholesterol in SH-SY5Y cells. Data are presented as the mean ± SEM of three repeats each from two separate passages (n=6). (A) Representative blots of BDNF, Copine-6, TREM1, and TREM2 expression in SH-SY5Y cells. (B) Densitometry analysis of the western blotting results. (C) Representative blots of nesfatin-1, CyclinD1, p-β-catenin, β-catenin, p-GSK3β, GSK3β expression in SH-SY5Y cells. (D) Densitometry analysis of the western blotting results. *P<0.05, **P<0.01 vs. control. #P<0.05, ##P<0.01 vs. cholesterol. &P<0.05, &&P<0.01 vs. cholesterol + empty vector.

Effects of TREM2 overexpression on the protein expression levels of nesfatin-1 and key molecules in the Wnt/β-catenin signaling pathway induced by high cholesterol in SH-SY5Y cells

As shown in Fig. 7C and D, cholesterol-stimulated SH-SY5Y cells showed higher expression levels of nesfatin-1 (F0.05, 5=2.824, P=0.015) and p-GSK3β (F0.05, 5=19.835, P≤0.0001) and lower expression levels of p-β-catenin (F0.05, 5=1.222, P=0.046) compared with the control cells. Overexpression of TREM2 reversed the increase in expression of nesfatin-1, and p-GSK3β induced by cholesterol treatment, and no significant change in the expression of CyclinD1 and p-β-catenin was observed in the TREM2 overexpression group.

Discussion

In the present study, the potential role of TREM2 in cell injury and metabolic dysfunction induced by high cholesterol in SH-SY5Y cells was investigated and the potential mechanism was explored. The results showed that cholesterol could induce cell injury and lipid accumulation in SH-SY5Y cells, as indicated by the decrease in cell viability, changes in cell morphology from a spindle to an oval shape, an increase in the number of cells in the G0/G1 phase, an increase in the number of Oil-red O-positive cells, and higher protein expression levels of the SREBPs. Moreover, cholesterol-stimulated SH-SY5Y cells showed marked decreases in the protein expression levels of BDNF, nesfatin-1, Copine-6, TREM2, and p-β-catenin and increases in the expression of TREM1 and p-GSK3β. However, the imbalanced expression of BDNF, Copine-6, nesfatin-1 and p-GSK3β induced by cholesterol in SH-SY5Y cells was reversed after the overexpression of TREM2. These results suggested that TREM2 was associated with the neurotoxicity of cholesterol in SH-SY5Y cells.

As the basic structural component of the cell plasma membrane, cholesterol participates in the formation of dense myelin and plays an extremely important role in the structure and function of the central nervous system (47,48). An increasing body of evidence has demonstrated that hypercholesterolemia is an important risk factor for neuropsychiatric diseases, including AD (49,50). The results of a 13-year follow-up study (49) showed that higher levels of TC and LDL-C increased the risk of AD and accelerated the accumulation of β-amyloid molecules by 20-fold (51), the latter of which is a key factor in neuropathological damage in patients with AD (52,53). Consistent with the findings that excessive cholesterol levels can cause nerve cell injury and apoptosis (54), the results of the present study showed that stimulation with high cholesterol resulted in a decrease in the viability of SH-SY5Y cells in a dose- and time-dependent manner accompanied by morphological changes from a spindle-like shape to an oval-like shape, and a significant increase in the proportion of cells in the G0/G1 phase. Moreover, after stimulation with cholesterol, SH-SY5Y cells exhibited significantly higher lipid accumulation, as indicated by the increase in the number of Oil red O-positive cells, and in the protein expression levels of SREBP1 and SREBP2. These results indicated that cholesterol could induce dyslipidemia resulting in cell injuries and intracellular lipid deposition.

Synaptic plasticity is an important characteristic of the neural system that plays a significant role in maintaining the structure and function of the neural system. BDNF is a member of the neurotrophic factor family, and Copine-6 is a brain-specific, calcium-dependent protein. These molecules play important roles in regulating synaptic plasticity (55,56), and their secretion and abundance are involved in the activity of the Wnt/β-catenin signaling pathway (57). Moreover, BDNF participates in the regulation of cholesterol homeostasis (58,59) and improves nerve damage induced by high cholesterol levels (58). Consistently, the BDNF-related imbalance in the expression of Copine-6 and synapse-associated proteins in the hippocampus and PFC of stressed (60) or hyperlipidemic (14,46) rats has been demonstrated in our previous studies. In line with these findings, the results from the present study showed that cholesterol-induced downregulation of BDNF and Copine-6 protein expression in SH-SY5Y cells, and the expression of these molecules was positively correlated with each other. These results again suggest the role of BDNF-related Copine-6 expression in high cholesterol-related neural injury.

Nesfatin-1 may be involved in mediating metabolic disorders and neuropsychiatric injury. Our previous study showed that the plasma concentration of nesfatin-1 was markedly increased in high-fat diet-induced nonalcoholic fatty liver disease rats and was significantly correlated with impaired learning and memory abilities and imbalanced protein expression of BDNF in the hippocampus (46). In line with this finding, the protein expression levels of nesfatin-1 in SH-SY5Y cells were upregulated after stimulation with high cholesterol. In addition, SH-SY5Y cells stimulated with high cholesterol showed decreased expression of p-β-catenin, a key molecule in the Wnt signaling pathway, and increased expression of p-GSK3β. The results from the correlation analysis showed that the expression of nesfatin-1 was positively correlated with the expression of p-GSK3β and Cyclin-D1 and negatively correlated with the expression of p-β-catenin. This result was consistent with the previous finding that cholesterol metabolism is closely related to the activity and function of the Wnt signaling pathway (61).

Given the findings that the variants of TREM2 could markedly increase the risk of AD, this receptor has been a major focus in the neuroscience (62-64). Although studies have shown that TREM2 is exclusively expressed in microglia (62), double immunofluorescence staining has demonstrated that TREM2 is expressed in microglia (ionized calcium-binding adapter molecule 1), astrocytes (glial fibrillary acidic protein), and neurons (neuronal nucleus) in the brain (35,65).

TREM2 is required by microglia to respond to Aβ deposition and to limit neuronal degeneration, and microglia fail to colocalize with Aβ plaques in TREM2-/- mice (9). Moreover, TREM2 could regulate microglial cholesterol metabolism upon chronic phagocytic challenge, and loss of TREM2 or apolipoprotein E may result in dysregulated cholesterol transport and metabolism in microglia (13,66). TREM2 deletion not only causes cholesterol ester overload in microglia but also abrogates the recruitment of macrophages to enlarged adipocytes, leading to massive adipocyte hypertrophy, systemic hypercholesterolemia, inflammation, and glucose intolerance (67). These findings suggest that brain cholesterol metabolism and lipid signaling through TREM2 play major roles in age-related neurodegeneration processes (18,67). However, little is known regarding the role of TREM2 in cholesterol metabolism in neurons. Using SH-SY5Y cells, Huang et al (54) demonstrated that cholesterol overload in neuronal cells could result in an imbalance in cholesterol homeostasis and increase protein expression levels of truncated tyrosine kinase B, flotillin-2, Beta-Secretase (BACE) and β-amyloid (Aβ) and thereby inducing cell apoptosis, and the underlying mechanism involved the downregulation of BDNF. Consistent with these findings, the results of the present study showed that in addition to decreased viability, increased lipid accumulation, and imbalanced synaptic plasticity in SH-SY5Y cells, high cholesterol induced a decrease in the protein expression levels of TREM2. Moreover, the dysregulated expression of BDNF, Copine-6, and p-GSK3 in SH-SY5Y cells induced by cholesterol could be reversed by overexpression of TREM2. Taken together with the findings that microglia in the brains of TREM2-/- mice could phagocytose myelin debris but failed to clear myelin cholesterol, resulting in cholesteryl ester accumulation (66), and the significant correlation between TREM2 protein expression and BDNF, Copine-6 and nesfatin-1, these results suggested that TREM2 also plays a major role in cholesterol metabolism in neuronal cells.

This study has several limitations that should be addressed in future studies. First, only one cell line was used in this study, and the role of TREM2 in nerve injury induced by high cholesterol should be verified using additional types of neuronal cells, particularly primary neurons. Second, the effect of high cholesterol on the protein expression levels of BDNF, Copine-6, and key proteins in the Wnt/β-catenin signaling pathway has been detected regardless of the overexpression of TREM2. In addition, an explanation for the fact that TREM1 and TREM2 are inversely correlated with each, as in other experimental models, could not be provided, and the accurate mechanism should be explored in detail in the future.

In conclusion, the results of the present study suggest that a high concentration of cholesterol can induce cell injury in SH-SY5Y cells, and that an imbalance expression in TREM2 may play an important role in these injuries. A summary schematic is shown in Fig. 8.

Figure 8

High cholesterol concentrations induced cell injury in SH-SY5Y cells, and the imbalance in TREM2 expression may serve an important role in injury.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by the National Natural Science Foundation of China (grant nos. 81870403 and 81701327), the Top Talents in University of Anhui Province (grant no. gxbjZD2022013), the Scientific Research Promotion Plan of Anhui Medical University (grant no. 2022xkjT009), and the Comprehensive Reform Pilot Project of ‘San Quan Education’ of Anhui Medical University (grant no. 2021xsqyr03).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JG, ZQ and YH conceived and designed the study. YH and QZ performed the experiments, analyzed the data, and drafted the manuscript. MF, MM, and JX analyzed and interpreted the data. XG and SL performed cell culture. JG, YH and QZ confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Sun L, Clarke R, Bennett D, Guo Y, Walters RG, Hill M, Parish S, Millwood IY, Bian Z, Chen Y, et al: Causal associations of blood lipids with risk of ischemic stroke and intracerebral hemorrhage in Chinese adults. Nat Med. 25:569–574. 2019.PubMed/NCBI View Article : Google Scholar

2 

Yusuf S, Bosch J, Dagenais G, Zhu J, Xavier D, Liu L, Pais P, Lopez-Jaramillo P, Leiter LA, Dans A, et al: Cholesterol lowering in intermediate-risk persons without cardiovascular disease. N Engl J Med. 374:2021–2031. 2016.PubMed/NCBI View Article : Google Scholar

3 

Alenghat FJ and Davis AM: Management of blood cholesterol. JAMA. 321:800–801. 2019.PubMed/NCBI View Article : Google Scholar

4 

Grundy SM, Stone NJ, Bailey AL, Beam C, Birtcher KK, Blumenthal RS, Braun LT, de Ferranti S, Faiella-Tommasino J, Forman DE, et al: 2018 AHA/ACC/AACVPR/AAPA/ABC/ACPM/ADA/AGS/APhA/ASPC/NLA/PCNA Guideline on the Management of Blood Cholesterol: A Report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines. Circulation. 139:e1082–e1143. 2019.PubMed/NCBI View Article : Google Scholar

5 

Wilson PWF, Polonsky TS, Miedema MD, Khera A, Kosinski AS and Kuvin JT: Systematic Review for the 2018 AHA/ACC/AACVPR/AAPA/ABC/ACPM/ADA/AGS/APhA/ASPC/NLA/PCNA Guideline on the Management of Blood Cholesterol: A Report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines. Circulation. 139:e1144–e1161. 2019.PubMed/NCBI View Article : Google Scholar

6 

Holt RI, Phillips DI, Jameson KA, Cooper C, Dennison EM and Peveler RC: Hertfordshire Cohort Study Group. The relationship between depression, anxiety and cardiovascular disease: Findings from the Hertfordshire Cohort Study. J Affect Disord. 150:84–90. 2013.PubMed/NCBI View Article : Google Scholar

7 

Stough C, Pipingas A, Camfield D, Nolidin K, Savage K, Deleuil S and Scholey A: Increases in total cholesterol and low density lipoprotein associated with decreased cognitive performance in healthy elderly adults. Metab Brain Dis. 34:477–484. 2019.PubMed/NCBI View Article : Google Scholar

8 

Song Y, Liu J, Zhao K, Gao L and Zhao J: Cholesterol-induced toxicity: An integrated view of the role of cholesterol in multiple diseases. Cell Metab. 33:1911–1925. 2021.PubMed/NCBI View Article : Google Scholar

9 

Zhu X, Tang HD, Dong WY, Kang F, Liu A, Mao Y, Xie W, Zhang X, Cao P, Zhou W, et al: Distinct thalamocortical circuits underlie allodynia induced by tissue injury and by depression-like states. Nat Neurosci. 24:542–553. 2021.PubMed/NCBI View Article : Google Scholar

10 

Zou Y, Zhu Q, Deng Y, Duan J, Pan L, Tu Q, Dai R, Zhang X, Chu LW and Lu Y: Vascular risk factors and mild cognitive impairment in the elderly population in Southwest China. Am J Alzheimers Dis Other Demen. 29:242–247. 2014.PubMed/NCBI View Article : Google Scholar

11 

Reed B, Villeneuve S, Mack W, DeCarli C, Chui HC and Jagust W: Associations between serum cholesterol levels and cerebral amyloidosis. JAMA Neurol. 71:195–200. 2014.PubMed/NCBI View Article : Google Scholar

12 

Liu AH, Chu M and Wang YP: Up-Regulation of Trem2 inhibits hippocampal neuronal apoptosis and alleviates oxidative stress in epilepsy via the PI3K/Akt pathway in mice. Neurosci Bull. 35:471–485. 2019.PubMed/NCBI View Article : Google Scholar

13 

Roca-Agujetas V, de Dios C, Abadin X and Colell A: Upregulation of brain cholesterol levels inhibits mitophagy in Alzheimer disease. Autophagy. 17:1555–1557. 2021.PubMed/NCBI View Article : Google Scholar

14 

Gao XR, Chen Z, Fang K, Xu JX and Ge JF: Protective effect of quercetin against the metabolic dysfunction of glucose and lipids and its associated learning and memory impairments in NAFLD rats. Lipids Health Dis. 20(164)2021.PubMed/NCBI View Article : Google Scholar

15 

Leritz EC, McGlinchey RE, Salat DH and Milberg WP: Elevated levels of serum cholesterol are associated with better performance on tasks of episodic memory. Metab Brain Dis. 31:465–473. 2016.PubMed/NCBI View Article : Google Scholar

16 

Zhou F, Deng W, Ding D, Zhao Q, Liang X, Wang F, Luo J, Zheng L, Guo Q and Hong Z: High Low-density lipoprotein cholesterol inversely relates to dementia in community-dwelling older adults: The shanghai aging study. Front Neurol. 9(952)2018.PubMed/NCBI View Article : Google Scholar

17 

Banach M, Rizzo M, Nikolic D, Howard G, Howard V and Mikhailidis D: Intensive LDL-cholesterol lowering therapy and neurocognitive function. Pharmacol Ther. 170:181–191. 2017.PubMed/NCBI View Article : Google Scholar

18 

Bertolio R, Napoletano F, Mano M, Maurer-Stroh S, Fantuz M, Zannini A, Bicciato S, Sorrentino G and Del Sal G: Sterol regulatory element binding protein 1 couples mechanical cues and lipid metabolism. Nat Commun. 10(1326)2019.PubMed/NCBI View Article : Google Scholar

19 

Oh IS, Shimizu H, Satoh T, Okada S, Adachi S, Inoue K, Eguchi H, Yamamoto M, Imaki T, Hashimoto K, et al: Identification of nesfatin-1 as a satiety molecule in the hypothalamus. Nature. 443:709–712. 2006.PubMed/NCBI View Article : Google Scholar

20 

Zhang Z, Li L, Yang M, Liu H, Boden G and Yang G: Increased plasma levels of nesfatin-1 in patients with newly diagnosed type 2 diabetes mellitus. Exp Clin Endocrinol Diabetes. 120:91–95. 2012.PubMed/NCBI View Article : Google Scholar

21 

Catak Z, Aydin S, Sahin I, Kuloglu T, Aksoy A and Dagli AF: Regulatory neuropeptides (ghrelin, obestatin and nesfatin-1) levels in serum and reproductive tissues of female and male rats with fructose-induced metabolic syndrome. Neuropeptides. 48:167–177. 2014.PubMed/NCBI View Article : Google Scholar

22 

Prinz P and Stengel A: Nesfatin-1: Current status as a peripheral hormone and future prospects. Curr Opin Pharmacol. 31:19–24. 2016.PubMed/NCBI View Article : Google Scholar

23 

Yin Y, Li Z, Gao L, Li Y, Zhao J and Zhang W: AMPK-dependent modulation of hepatic lipid metabolism by nesfatin-1. Mol Cell Endocrinol. 417:20–26. 2015.PubMed/NCBI View Article : Google Scholar

24 

Stengel A, Goebel M, Wang L, Rivier J, Kobelt P, Mönnikes H, Lambrecht NW and Taché Y: Central nesfatin-1 reduces dark-phase food intake and gastric emptying in rats: Differential role of corticotropin-releasing factor2 receptor. Endocrinology. 150:4911–4919. 2009.PubMed/NCBI View Article : Google Scholar

25 

Yoshida N, Maejima Y, Sedbazar U, Ando A, Kurita H, Damdindorj B, Takano E, Gantulga D, Iwasaki Y, Kurashina T, et al: Stressor-responsive central nesfatin-1 activates corticotropin-releasing hormone, noradrenaline and serotonin neurons and evokes hypothalamic-pituitary-adrenal axis. Aging (Albany NY). 2:775–784. 2010.PubMed/NCBI View Article : Google Scholar

26 

Han YX, Tao C, Gao XR, Wang LL, Jiang FH, Wang C, Fang K, Chen XX, Chen Z and Ge JF: BDNF-related imbalance of copine 6 and synaptic plasticity markers couples with depression-like behavior and immune activation in CUMS rats. Front Neurosci. 12(731)2018.PubMed/NCBI View Article : Google Scholar

27 

Xu YY, Ge JF, Qin G, Peng YN, Zhang CF, Liu XR, Liang LC, Wang ZZ, Chen FH and Li J: Acute, but not chronic, stress increased the plasma concentration and hypothalamic mRNA expression of NUCB2/nesfatin-1 in rats. Neuropeptides. 54:47–53. 2015.PubMed/NCBI View Article : Google Scholar

28 

Ge JF, Xu YY, Qin G, Pan XY, Cheng JQ and Chen FH: Nesfatin-1, a potent anorexic agent, decreases exploration and induces anxiety-like behavior in rats without altering learning or memory. Brain Res. 1629:171–181. 2015.PubMed/NCBI View Article : Google Scholar

29 

Ge JF, Xu YY, Qin G, Peng YN, Zhang CF, Liu XR, Liang LC, Wang ZZ and Chen FH: Depression-like behavior induced by nesfatin-1 in rats: Involvement of increased immune activation and imbalance of synaptic vesicle proteins. Front Neurosci. 9(429)2015.PubMed/NCBI View Article : Google Scholar

30 

Liu J, Xiao Q, Xiao J, Niu C, Li Y, Zhang X, Zhou Z, Shu G and Yin G: Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal Transduct Target Ther. 7(3)2022.PubMed/NCBI View Article : Google Scholar

31 

Schlupf J and Steinbeisser H: IGF antagonizes the Wnt/β-Catenin pathway and promotes differentiation of extra-embryonic endoderm. Differentiation. 87:209–219. 2014.PubMed/NCBI View Article : Google Scholar

32 

Xu X, Wang L, Liu B, Xie W and Chen YG: Activin/Smad2 and Wnt/β-catenin up-regulate HAS2 and ALDH3A2 to facilitate mesendoderm differentiation of human embryonic stem cells. J Biol Chem. 293:18444–18453. 2018.PubMed/NCBI View Article : Google Scholar

33 

Logan CY and Nusse R: The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 20:781–810. 2004.PubMed/NCBI View Article : Google Scholar

34 

Yi H, Hu J, Qian J and Hackam AS: Expression of brain-derived neurotrophic factor is regulated by the Wnt signaling pathway. Neuroreport. 23:189–194. 2012.PubMed/NCBI View Article : Google Scholar

35 

Chen J, Park CS and Tang SJ: Activity-dependent synaptic Wnt release regulates hippocampal long term potentiation. J Biol Chem. 281:11910–11916. 2006.PubMed/NCBI View Article : Google Scholar

36 

Spagnuolo MS, Donizetti A, Iannotta L, Aliperti V, Cupidi C, Bruni AC and Cigliano L: Brain-derived neurotrophic factor modulates cholesterol homeostasis and Apolipoprotein E synthesis in human cell models of astrocytes and neurons. J Cell Physiol. 233:6925–6943. 2018.PubMed/NCBI View Article : Google Scholar

37 

Ge JF, Xu YY, Qin G, Cheng JQ and Chen FH: Resveratrol ameliorates the anxiety- and depression-like behavior of subclinical hypothyroidism rat: Possible Involvement of the HPT Axis, HPA Axis, and Wnt/beta-Catenin pathway. Front Endocrinol (Lausanne). 7(44)2016.PubMed/NCBI View Article : Google Scholar

38 

Ford JW and McVicar DW: TREM and TREM-like receptors in inflammation and disease. Curr Opin Immunol. 21:38–46. 2009.PubMed/NCBI View Article : Google Scholar

39 

Ulland TK and Colonna M: TREM2-a key player in microglial biology and Alzheimer disease. Nat Rev Neurol. 14:667–675. 2018.PubMed/NCBI View Article : Google Scholar

40 

Zheng H, Jia L, Liu CC, Rong Z, Zhong L, Yang L, Chen XF, Fryer JD, Wang X, Zhang YW, et al: TREM2 Promotes Microglial Survival by Activating Wnt/β-Catenin Pathway. J Neurosci. 37:1772–1784. 2017.PubMed/NCBI View Article : Google Scholar

41 

Fan Y, Ma Y, Huang W, Cheng X, Gao N, Li G and Tian S: Up-regulation of TREM2 accelerates the reduction of amyloid deposits and promotes neuronal regeneration in the hippocampus of amyloid beta1-42 injected mice. J Chem Neuroanat. 97:71–79. 2019.PubMed/NCBI View Article : Google Scholar

42 

Jiang T, Tan L, Zhu XC, Zhang QQ, Cao L, Tan MS, Gu LZ, Wang HF, Ding ZZ, Zhang YD and Yu JT: Upregulation of TREM2 ameliorates neuropathology and rescues spatial cognitive impairment in a transgenic mouse model of Alzheimer's disease. Neuropsychopharmacology. 39:2949–2962. 2014.PubMed/NCBI View Article : Google Scholar

43 

Parhizkar S, Arzberger T, Brendel M, Kleinberger G, Deussing M, Focke C, Nuscher B, Xiong M, Ghasemigharagoz A, Katzmarski N, et al: Loss of TREM2 function increases amyloid seeding but reduces plaque-associated ApoE. Nat Neurosci. 22:191–204. 2019.PubMed/NCBI View Article : Google Scholar

44 

Jiang T, Tan L, Zhu XC, Zhou JS, Cao L, Tan MS, Wang HF, Chen Q, Zhang YD and Yu JT: Silencing of TREM2 exacerbates tau pathology, neurodegenerative changes, and spatial learning deficits in P301S tau transgenic mice. Neurobiol Aging. 36:3176–3186. 2015.PubMed/NCBI View Article : Google Scholar

45 

Jiang T, Wan Y, Zhang YD, Zhou JS, Gao Q, Zhu XC, Shi JQ, Lu H, Tan L and Yu JT: TREM2 Overexpression has No Improvement on Neuropathology and Cognitive Impairment in Aging APPswe/PS1dE9 Mice. Mol Neurobiol. 54:855–865. 2017.PubMed/NCBI View Article : Google Scholar

46 

Chen Z, Xu YY, Wu R, Han YX, Yu Y, Ge JF and Chen FH: Impaired learning and memory in rats induced by a high-fat diet: Involvement with the imbalance of nesfatin-1 abundance and copine 6 expression. J Neuroendocrinol. (29)2017.PubMed/NCBI View Article : Google Scholar : doi: 10.1111/jne.12462.

47 

Arenas F, Garcia-Ruiz C and Fernandez-Checa JC: Intracellular cholesterol trafficking and impact in neurodegeneration. Front Mol Neurosci. 10(382)2017.PubMed/NCBI View Article : Google Scholar

48 

Dietschy JM and Turley SD: Thematic review series: Brain Lipids. Cholesterol metabolism in the central nervous system during early development and in the mature animal. J Lipid Res. 45:1375–1397. 2004.PubMed/NCBI View Article : Google Scholar

49 

Schilling S, Tzourio C, Soumare A, Kaffashian S, Dartigues JF, Ancelin ML, Samieri C, Dufouil C and Debette S: Differential associations of plasma lipids with incident dementia and dementia subtypes in the 3C Study: A longitudinal, population-based prospective cohort study. PLoS Med. 14(e1002265)2017.PubMed/NCBI View Article : Google Scholar

50 

Chen H, Du Y, Liu S, Ge B, Ji Y and Huang G: Association between serum cholesterol levels and Alzheimer's disease in China: A case-control study. Int J Food Sci Nutr. 70:405–411. 2019.PubMed/NCBI View Article : Google Scholar

51 

Knowles TP, Vendruscolo M and Dobson CM: The amyloid state and its association with protein misfolding diseases. Nat Rev Mol Cell Biol. 15:384–396. 2014.PubMed/NCBI View Article : Google Scholar

52 

Habchi J, Chia S, Galvagnion C, Michaels TCT, Bellaiche MMJ, Ruggeri FS, Sanguanini M, Idini I, Kumita JR, Sparr E, et al: Cholesterol catalyses Abeta42 aggregation through a heterogeneous nucleation pathway in the presence of lipid membranes. Nat Chem. 10:673–683. 2018.PubMed/NCBI View Article : Google Scholar

53 

Di Scala C, Chahinian H, Yahi N, Garmy N and Fantini J: Interaction of Alzheimer's β-amyloid peptides with cholesterol: Mechanistic insights into amyloid pore formation. Biochemistry. 53:4489–4502. 2014.PubMed/NCBI View Article : Google Scholar

54 

Huang YN, Lin CI, Liao H, Liu CY, Chen YH, Chiu WC and Lin SH: Cholesterol overload induces apoptosis in SH-SY5Y human neuroblastoma cells through the up regulation of flotillin-2 in the lipid raft and the activation of BDNF/Trkb signaling. Neuroscience. 328:201–209. 2016.PubMed/NCBI View Article : Google Scholar

55 

Reinhard JR, Kriz A, Galic M, Angliker N, Rajalu M, Vogt KE and Ruegg MA: The calcium sensor Copine-6 regulates spine structural plasticity and learning and memory. Nat Commun. 7(11613)2016.PubMed/NCBI View Article : Google Scholar

56 

Burk K, Ramachandran B, Ahmed S, Hurtado-Zavala JI, Awasthi A, Benito E, Faram R, Ahmad H, Swaminathan A, McIlhinney J, et al: Regulation of Dendritic Spine Morphology in Hippocampal Neurons by Copine-6. Cereb Cortex. 28:1087–1104. 2018.PubMed/NCBI View Article : Google Scholar

57 

Zhang W, Shi Y, Peng Y, Zhong L, Zhu S, Zhang W and Tang SJ: Neuron activity-induced Wnt signaling up-regulates expression of brain-derived neurotrophic factor in the pain neural circuit. J Biol Chem. 293:15641–15651. 2018.PubMed/NCBI View Article : Google Scholar

58 

Motamedi S, Karimi I and Jafari F: The interrelationship of metabolic syndrome and neurodegenerative diseases with focus on brain-derived neurotrophic factor (BDNF): Kill two birds with one stone. Metab Brain Dis. 32:651–665. 2017.PubMed/NCBI View Article : Google Scholar

59 

Sharma D, Barhwal KK, Biswal SN, Srivastava AK, Bhardwaj P, Kumar A, Chaurasia OP and Hota SK: Hypoxia-mediated alteration in cholesterol oxidation and raft dynamics regulates BDNF signalling and neurodegeneration in hippocampus. J Neurochem. 148:238–251. 2019.PubMed/NCBI View Article : Google Scholar

60 

Sayed FA, Telpoukhovskaia M, Kodama L, Li Y, Zhou Y, Le D, Hauduc A, Ludwig C, Gao F, Clelland C, et al: Differential effects of partial and complete loss of TREM2 on microglial injury response and tauopathy. Proc Natl Acad Sci USA. 115:10172–10177. 2018.PubMed/NCBI View Article : Google Scholar

61 

Sheng R, Kim H, Lee H, Xin Y, Chen Y, Tian W, Cui Y, Choi JC, Doh J, Han JK and Cho W: Cholesterol selectively activates canonical Wnt signalling over non-canonical Wnt signalling. Nat Commun. 5(4393)2014.PubMed/NCBI View Article : Google Scholar

62 

Damisah EC, Hill RA, Rai A, Chen F, Rothlin CV, Ghosh S and Grutzendler J: Astrocytes and microglia play orchestrated roles and respect phagocytic territories during neuronal corpse removal in vivo. Sci Adv. 6(eaba3239)2020.PubMed/NCBI View Article : Google Scholar

63 

Wang S, Mustafa M, Yuede CM, Salazar SV, Kong P, Long H, Ward M, Siddiqui O, Paul R, Gilfillan S, et al: Anti-human TREM2 induces microglia proliferation and reduces pathology in an Alzheimer's disease model. J Exp Med. 217(e20200785)2020.PubMed/NCBI View Article : Google Scholar

64 

Zhou Y, Song WM, Andhey PS, Swain A, Levy T, Miller KR, Poliani PL, Cominelli M, Grover S, Gilfillan S, et al: Human and mouse single-nucleus transcriptomics reveal TREM2-dependent and TREM2-independent cellular responses in Alzheimer's disease. Nat Med. 26:131–142. 2020.PubMed/NCBI View Article : Google Scholar

65 

Diaz-Lucena D, Kruse N, Thüne K, Schmitz M, Villar-Piqué A, da Cunha JEG, Hermann P, López-Pérez Ó, Andrés-Benito P, Ladogana A, et al: TREM2 expression in the brain and biological fluids in prion diseases. Acta Neuropathol. 141:841–859. 2021.PubMed/NCBI View Article : Google Scholar

66 

Nugent AA, Lin K, van Lengerich B, Lianoglou S, Przybyla L, Davis SS, Llapashtica C, Wang J, Kim DJ, Xia D, et al: TREM2 regulates microglial cholesterol metabolism upon chronic phagocytic challenge. Neuron. 105:837–854.e839. 2020.PubMed/NCBI View Article : Google Scholar

67 

Jaitin DA, Adlung L, Thaiss CA, Weiner A, Li B, Descamps H, Lundgren P, Bleriot C, Liu Z, Deczkowska A, et al: Lipid-Associated macrophages control metabolic homeostasis in a Trem2-Dependent manner. Cell. 178:686–698.e14. 2019.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zheng Q, Han Y, Fan M, Gao X, Ma M, Xu J, Liu S and Ge J: Potential role of TREM2 in high cholesterol‑induced cell injury and metabolic dysfunction in SH‑SY5Y cells. Exp Ther Med 25: 205, 2023.
APA
Zheng, Q., Han, Y., Fan, M., Gao, X., Ma, M., Xu, J. ... Ge, J. (2023). Potential role of TREM2 in high cholesterol‑induced cell injury and metabolic dysfunction in SH‑SY5Y cells. Experimental and Therapeutic Medicine, 25, 205. https://doi.org/10.3892/etm.2023.11904
MLA
Zheng, Q., Han, Y., Fan, M., Gao, X., Ma, M., Xu, J., Liu, S., Ge, J."Potential role of TREM2 in high cholesterol‑induced cell injury and metabolic dysfunction in SH‑SY5Y cells". Experimental and Therapeutic Medicine 25.5 (2023): 205.
Chicago
Zheng, Q., Han, Y., Fan, M., Gao, X., Ma, M., Xu, J., Liu, S., Ge, J."Potential role of TREM2 in high cholesterol‑induced cell injury and metabolic dysfunction in SH‑SY5Y cells". Experimental and Therapeutic Medicine 25, no. 5 (2023): 205. https://doi.org/10.3892/etm.2023.11904
Copy and paste a formatted citation
x
Spandidos Publications style
Zheng Q, Han Y, Fan M, Gao X, Ma M, Xu J, Liu S and Ge J: Potential role of TREM2 in high cholesterol‑induced cell injury and metabolic dysfunction in SH‑SY5Y cells. Exp Ther Med 25: 205, 2023.
APA
Zheng, Q., Han, Y., Fan, M., Gao, X., Ma, M., Xu, J. ... Ge, J. (2023). Potential role of TREM2 in high cholesterol‑induced cell injury and metabolic dysfunction in SH‑SY5Y cells. Experimental and Therapeutic Medicine, 25, 205. https://doi.org/10.3892/etm.2023.11904
MLA
Zheng, Q., Han, Y., Fan, M., Gao, X., Ma, M., Xu, J., Liu, S., Ge, J."Potential role of TREM2 in high cholesterol‑induced cell injury and metabolic dysfunction in SH‑SY5Y cells". Experimental and Therapeutic Medicine 25.5 (2023): 205.
Chicago
Zheng, Q., Han, Y., Fan, M., Gao, X., Ma, M., Xu, J., Liu, S., Ge, J."Potential role of TREM2 in high cholesterol‑induced cell injury and metabolic dysfunction in SH‑SY5Y cells". Experimental and Therapeutic Medicine 25, no. 5 (2023): 205. https://doi.org/10.3892/etm.2023.11904
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team