SFMBT2 positively regulates SOX9 and chondrocyte proliferation

  • Authors:
    • Safdar Hussain
    • Mengyao Sun
    • Yuanxu Guo
    • Nosheen Mushtaq
    • Yitong Zhao
    • Ying Yuan
    • Nazim Hussain
    • Ezra Osoro
    • Abubakar Suleiman
    • Muhammad Sadiq
    • Fujun Zhang
    • Yan Han
    • Jian Sun
    • Shemin Lu
  • View Affiliations

  • Published online on: September 25, 2018     https://doi.org/10.3892/ijmm.2018.3894
  • Pages: 3503-3512
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

SRY‑box 9 (SOX9) is the master regulator of the chondrocyte phenotype, which is essential for differentiating chondrogenic mesenchymal condensations into chondrocytes, and is involved in regulating every stage of chondrocyte differentiation. SOX9 deletion in chondrocytes at the late stages of cartilage development results in decreased chondrocyte proliferation; inhibited expression of cartilage matrix genes, including Indian hedgehog and the downstream parathyroid hormone‑related protein; and premature conversion of proliferating chondrocytes into hypertrophic chondrocytes, which mineralize their matrix prematurely. Therefore, SOX9 is considered vital for the majority of phases of chondrocyte lineage, from early condensations to the differentiation of proliferating chondrocytes, leading to chondrocyte hypertrophy. It has been reported that SOX9 expression is decreased in osteoarthritis (OA) cartilage. Regeneration or repair of cartilage degradation in OA remains a challenge. Previous studies have indicated that overexpression of SOX9 can promote cartilage repair and can be used as a potential therapeutic agent at the early stages of human OA. The present study identified Scm‑like with four malignant brain tumor domains 2 (SFMBT2) as a novel regulator of SOX9 expression in human chondrocytes. Our previous study revealed that SFMBT2 is negatively regulated in OA cartilage, and decreased levels of SFMBT2 contribute to the catabolic phenotype of chondrocytes. The present study detected increased expression levels of SFMBT2 in early cartilage development and during the early phases of chondrogenesis. Overexpression of SFMBT2 in C28/I2 cells upregulated SOX9 expression in a dose‑dependent manner. Furthermore, SFMBT2 positively regulated C28/I2 cell proliferation and restored the decreased levels of SOX9 in chondrocytes following tumor necrosis factor‑α treatment. Additional studies may reveal novel insights into the molecular mechanism involved and the potential role of SFMBT2 in cartilage repair and OA management.

Introduction

Mature chondrocytes are metabolically slow, highly differentiated cells with a limited proliferation rate and, unlike other tissues such as bone, a restricted ability to self-repair cartilage degeneration (1,2). Despite their low numbers and being the sole cell type of the cartilage, chondrocytes serve fundamental roles in regulating tissue properties, such as organization, remodeling, synthesis and degradation of the surrounding matrix (3,4). During skeletal development, chondrocytes arise from mesenchymal progenitors to synthesize the templates or cartilage anlagen for the developing bone (5). Chondrogenesis occurs as a result of condensation of mesenchymal cells. The process can be generally divided into two phases: i) Early chondrogenesis, which is characterized by upregulated collagen type II α1 chain (COL2A1) and SRY-box 9 (SOX9), and ii) hypertrophy, which is characterized by upregulated collagen type X α1 chain (COL10A1) and runt-related transcription factor 2. These two stages are regulated by numerous factors and signaling pathways (6), and they function to repress each other (7-10).

The metabolic behavior of chondrocytes can be modified by various factors, including aging, genetic makeup, and other mechanical and chemical factors, such as joint loading and inflammation. Proinflammatory cytokines, including tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) exert catabolic and anabolic effects, and serve important roles in the degradation and synthesis of the extracellular matrix (ECM) (11). In osteoarthritis (OA), cartilage deterioration is associated with disruption of the metabolic homeostasis of chondrocytes and dysregulation of their physiological behavior, which is reflected by the appearance of cartilage surface fibrillation, formation of chondrocyte clusters and alterations in the composition of ECM components (12).

SOX9 is considered the master regulator and a key transcriptional factor in chondrocyte condensation, proliferation and differentiation (13-16). In chondrogenesis, SOX9 acts as a homo-dimer (17), which is stabilized by two other SOX members of the SoxD family: L-SOX5 and SOX6 (18). These molecules are co-expressed with SOX9 during cell differentiation, and are associated with the production of collagen types II and IX, as well as aggrecan (ACAN), which is the major proteoglycan (19). SOX9 is expressed in all prechon-drocytic and chondrocytic cells during mouse embryonic development, whereas its expression is completely abolished in hypertrophic chondrocytes (20-22). Mutations in the SOX9 gene lead to campomelic dysplasia, a disease characterized by skeletal malformation and 46,XY sex reversal (23).

Polycomb group (PcG) proteins are known to regulate developmental genes, and abnormal expression of these proteins may cause cancer (24,25). Scm-like with four malignant brain tumor (MBT) domains 2 (SFMBT2) is a member of the PcG protein family (26), which has been reported to be involved in prostate cancer cell growth, through repression of the homeobox B13 gene in DU145 cells (27). SFMBT2 consists of a sterile α motif domain and four MBT domains, which are crucial for gene regulation by recognizing and binding to methylated lysine residues in the tails of histones H3 and H4 (28). However, to the best of our knowledge, no study regarding its role in cartilage or OA has been published to date.

Our previous study screened differentially expressed genes in OA cartilage using the suppression subtractive hybridization technique, and identified SFMBT2 as a candidate gene from the reverse-subtracted cDNA library by sequence analysis and similarity search with BLAST (29). Our recent study verified the negative association of this gene with OA by analyzing the expression of SFMBT2 in damaged cartilages from human patients with OA compared with normal cartilages from control individuals, and established that the down-regulation of SFMBT2 contributes to the catabolic phenotype of chon-drocytes (30). The aim of the present study was to examine the expression of SFMBT2 in cartilage at different stages of its development, and during the process of chondrogenesis. Understanding the mechanisms underlying cartilage remod-eling during development, OA and aging, and identifying the novel factors involved in these mechanisms may lead to the development of more effective strategies, preventing cartilage damage and promoting repair.

Materials and methods

Rats

Dark agouti (DA) rats, which originated from Medical Inflammation Research, Lund University (Lund, Sweden), were bred and maintained in polystyrene cages containing sterile wood shavings in a specific pathogen-free animal house at the Department of Biochemistry and Molecular Biology, Xi'an Jiaotong University (Xi'an, China). Rats were fed standard rodent chow and water ad libitum and were maintained in a climate-controlled environment (temperature: 20-26°C; relative humidity: 40-70%) under a 12 h light/dark cycle. Femoral head cartilages were surgically removed from 12 age/weight-matched rats, four for each developmental stage (two females, two males), after sacrificing the rats on postnatal days 0 (D0), 21 (D21) and 42 (D42). The cartilage samples were immediately placed in liquid nitrogen after cleaning with PBS and were stored at -80°C for further analysis. The experiments were approved by the Institutional Animal Ethics Committee of Xi'an Jiaotong University (Xi'an, China).

Cell culture

The ATDC5 murine chondroblast cell line was obtained from the European Collection of Authenticated Cell Cultures (Salisbury, UK) and was cultured in Dulbecco's modified Eagle's medium (DMEM)/Ham's F12 (HyClone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 5% fetal bovine serum (FBS; Shanghai ExCell Biology, Inc., Shanghai, China). Chondrogenesis was induced by adding ITS-supplement (insulin, 1 mg/ml; transferrin, 0.55 mg/ml; and selenium, 0.5 µg/ml) directly into the medium. The medium was changed every 2nd or 3rd day. The cells were harvested for RNA and protein isolation on D0, D3, D7 and D14 post-induction.

The C28/I2 human juvenile costal chondrocyte cell line was kindly provided by Prof. Junling Cao (Institute of Endemic Diseases, Xi'an Jiaotong University, Health Science Center, Xi'an, China). Chondrocytes were cultured in DMEM/F12 containing 10% FBS and 1% penicillin-streptomycin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Both chondrocyte lines were maintained at 37°C in the presence of 5% CO2. Once the cells reached 90% confluence, they were detached by treatment with 0.05% trypsin (Shanghai ExCell Biology, Inc.) and passaged.

Transient transfection/infection with small interfering RNAs (siRNAs)/adenovirus vectors

For the knockdown experiments, siRNAs against SFMBT2 (si-SFMBT2) and SOX9 (si-SOX9), and the scrambled negative control siRNA (si-NC), were synthe-sized (Shanghai GenePharma Co., Ltd., Shanghai, China). C28/I2 cells were seeded in 12-well plates (1x105 cells/well), after which, they were transfected with the 80 nM si-SFMBT2, 60 nM si-SOX9 or 60 nM si-NC using Lipofectamine® 2000 (cat. no. 11668-019; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), according to the manufacturer's protocol. Briefly, C28/I2 cells were incubated with transfection complexes in serum-free medium for 4 h at 37°C in a CO2 incubator. After 4 h, the medium was replaced with fresh, complete medium (containing 10% FBS), and cells were incubated at 37°C in the presence of 5% CO2. Effects of siRNA interference were determined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting 12-72 h post-transfection, as indicated. The siRNA sequences used in the present study were as follows: si-NC, sense, UUC UCC GAA CGU GUC ACG UTT and antisense, CGU GAC ACG UUC GGA GAA TT; si-SFMBT2, sense, 5′-GCA CUU UGU CAG CUU CCA ATT-3′ and antisense, 5′-UUG GAA GCU GAC AAA GUG CTT-3′; and si-SOX9, sense, 5′-GCA GCG ACG UCA UCU CCA AdT dT-3′ and antisense, 5′-CGU CGC UGC AGU AGA GGU UdT dT-3′.

The FLAG-green fluorescent protein-tagged SFMBT2 adenovirus vector (ad-SFMBT2; 1x1010 PFU/ml) and the control adenovirus vector (ad-NC; 2x1010 PFU/ml) were purchased from Hanbio Biotechnology Co., Ltd. (Shanghai, China). For overexpression of SFMBT2, C28/I2 cells were seeded in 12-well plates (1x105 cells/well) or 96-well plates (1x104 cells/well), and were incubated with ad-NC or ad-SFMBT2, which were added directly into the medium at the indicated titers/multiplicities of infection (MOIs) for 4 h at 37°C in a CO2 incubator. After 4 h, the medium containing the viral vectors was removed and replaced with fresh medium, and the cells were incubated at 37°C in the presence of 5% CO2. The chondrocytes were harvested at the indicated time intervals (0-72 h) after adenoviral infection for RNA and protein extraction.

Chondrocyte treatment with TNF-α and IL-1β

C28/I2 cells were serum starved for 10 h prior to the addition of TNF-α (10 ng/ml) or IL-1β (10 ng/ml) (both from Sino Biological Inc., Beijing, China) into the culture medium. The cells were then incubated at 37°C in the presence of 5% CO2 and were harvested for protein isolation 24 h post-treatment. C28/I2 cells infected with ad-NC or ad-SFMBT2 were treated with TNF-α 24 h post-adenoviral infection, and were harvested for protein isolation at the indicated time points (0-48 h) following TNF-α treatment.

Total RNA extraction and RT-qPCR

Total RNA was extracted from the cultured chondrocytes (1x105 cells/well) using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and was reverse transcribed to cDNA using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Gene expression levels were detected by qPCR (Agilent Stratagene Mx3005; Agilent Technologies, Inc., Santa Clara, CA, USA) using the SYBR Green system (Roche Diagnostics, Indianapolis, IN, USA). Thermocycling conditions were as follows: 95°C for 10 min (activation), followed by 40 cycles at 95°C for 15 sec (denaturation), 61/64°C for 30 sec (annealing) and 72°C for 30 sec (extension). Data collection was performed during each extension phase. Relative quantification of the target genes, normalized to the control, was calculated using the comparative Cq (ΔΔCq) method (31). The primers used for RT-qPCR analysis are listed in Table I.

Table I

mRNA-specific primers used in reverse transcription-quantitative polymerase chain reaction.

Table I

mRNA-specific primers used in reverse transcription-quantitative polymerase chain reaction.

GeneSequence (5′-3′)Ta (°C)
ms-SFMBT2F: TAACTGCTGTCCTGCCTGCT61
R: TGTGACATGGCCTACAGCTC
ms-SOX9F: TATGTGGATGTGTGCGTGTG61
R: CCAGCCACAGCAGTGAGTAA
ms-COL2A1F: AGAGCGGAGACTACTGGATTG61
R: CGTTAGCGGTGTTGGGAG
ms-COL10A1F: TGGGATGCCTCTTGTCAGTG61
R: GTGGGCGTGCCATTCTTAT
ms-β-actinF: AACAGTCCGCCTAGAAGCAC61
R: CGTTGACATCCGTAAAGACC
hsa-SFMBT2F: ACGAAACAGGAGGAGGAGGAGAG64
R: GGAAGGGTCAGAAGCAGGAGTG
hsa-SOX9F: CGCACATCAAGACGGAGCAG61
R: TGTAGGTGAAGGTGGAGTAGAGG
hsa-GAPDHF: CACCCACTCCTCCACCTTTG61
R: CCACCACCCTGTTGCTGTAG

[i] COL10A1, collagen type X α1 chain; COL2A1, collagen type II α1 chain; F, forward; hsa, Homo sapiens; ms, mouse; R, reverse; SFMBT2, Scm-like with four malignant brain tumor domains 2; SOX9, SRY-box 9; Ta, annealing temperature; F, forward; R, reverse.

Protein isolation and quantification

Total protein was isolated from the cultured chondrocytes (1x105 cells/well) using radio-immunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) containing protease and phosphatase inhibitor mixture (Bimake, Houston, TX, USA). The whole cell lysates were incubated on ice for 30 min, centrifuged at 12,000 x g for 15 min at 4°C to remove cellular debris, and the supernatants were transferred to clean 1.5 ml tubes. Protein concentration in the cleared lysates was determined by Bicinchoninic Acid Protein Assay (Tiangen Biotech Co., Ltd., Beijing, China).

Protein sample preparation and immunoblotting

The clear lysates were mixed with SDS loading dye and heated at 95°C for 5 min. Subsequently, ~20 µg proteins were separated by 10% SDS-PAGE and transferred to the polyvinylidene fluoride membrane (EMD Millipore, Billerica, MA, USA). The membrane was blocked in 5% non-fat milk or 5% bovine serum albumin (BSA, Amresco; VWR, Radnor, PA, USA) at room temperature for 2 h, and then incubated at 4°C overnight with primary antibodies. After washing three times with Tris-buffered saline containing 0.1% Tween-20, the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody for 2 h at room temperature. The blots were detected using the enhanced chemiluminescence detection system (EMD Millipore). Western blots were scanned using the GeneGnome XRQ system (Syngene, Frederick, MD, USA), and densitometry of the bands was analyzed with GeneTools analysis software V 4.01 (Syngene). The antibodies and their dilutions are shown in Table II.

Table II

Antibodies used in the present study.

Table II

Antibodies used in the present study.

Antibody (origin)TypeSpecies specificityCat. no.CompanyApplication (dilution)
SFMBT2 (Rb)PolyclonalHuman, mouse25256-1-APProteinTech Group, Inc. (Chicago, IL, USA)WB (1:500)
SFMBT2 (Rb)PolyclonalHuman, ratbs-21105RBIOSS (Beijing, China)IHC (1:50)
SOX9 (Rb)MonoclonalHuman, mouseab182579Abcam (Cambridge, MA, USA)WB (1:1,000)
COL2A1 (Rb)PolyclonalHuman, mouseBA0533Wuhan Boster Biological Technology, Ltd. (Wuhan, China)WB (1:200)
COL10A1 (Rb)PolyclonalHuman, mouseBA2023Wuhan Boster Biological Technology, LtdWB (1:500)
GAPDH (Rb)PolyclonalHuman, mouse10494-1-APProteinTech Group, Inc.WB (1:2,000)
HRP-conjugated IgG (goat)PolyclonalRabbit31460Thermo Fisher Scientific, Inc. (Waltham, MA, USA)WB (1:2,000)

[i] COL10A1, collagen type X α1 chain; COL2A1, collagen type II α1 chain; HRP, horseradish peroxidase; IgG, immunoglobulin G; IHC, immunohistochemistry; Rb, rabbit; SFMBT2, Scm-like with four malignant brain tumor domains 2; SOX9, SRY-box 9; WB, western blotting.

Immunohistochemistry

Immunohistochemical staining was performed using the standard streptavidin peroxidase complex method. Cartilage tissues were fixed in 4% buffered paraformaldehyde for >2 days at room temperature, and were decalcified with buffered EDTA (12.5% EDTA, pH 7.4) for 4 weeks at room temperature. Subsequently, the samples were dehydrated through a graded series of alcohol, embedded in paraffin and 5-µm sections were obtained; the tissue sections were deparaffinized in xylene and rehydrated through a graded series of alcohol. Following treatment with 3% H2O2 for 10 min at room temperature and enzymatic digestion (Antigen Retrieval Buffer, cat. no. AR0022; Wuhan Boster Biological Technology, Ltd.) for 10 min at 37°C, tissue sections were blocked with 5% BSA for 20 min at 4°C and were incubated with the anti-SFMBT2 primary antibody (Table II) overnight at 4°C. Subsequently, sections were incubated with the bioti-nylated secondary antibody (1:1,000) for 30 min at 37°C and horseradish peroxidase-conjugated streptavidin (1:1,000) for 30 min at 37°C, both of which were contained within the DAB substrate kit (Wuhan Boster Biological Technology, Ltd.). Sections were counterstained with hematoxylin and mounted with neutral balsam. Images of the staining were captured under a fluorescence microscope (Olympus BX51; Olympus Corporation, Tokyo, Japan) and staining was semi-quantified using Image-Pro® Plus (V6.0) software (Media Cybernetics, Inc., Rockville, MD, USA).

Cell proliferation assay

Cell Counting kit-8 (CCK-8; Bimake) assay was used to evaluate the proliferative abilities of chondrocytes. As previously reported (32), C28/I2 cells were seeded in 96-well plates (1x104 cells/well) in DMEM/Ham's F12 and were maintained at 37°C in the presence of 5% CO2. Subsequently, cells were transfected/infected with si-SFMBT2/ad-SFMBT2, alongside the respective controls (si-NC/ad-NC). At 12, 24, 48 and 72 h post-transfection/infection, 10 µl CCK-8 solution was added directly into each well and the cells were incubated for a further 4 h. Absorbance was measured at 450 nm using a microplate reader (Thermo Scientific Multiskan® Spectrum; Thermo Fisher Scientific, Inc.). Experiments were repeated in triplicate.

Statistical analysis

All of the cell experiments were performed in triplicate with at least three independent biological replicates. GraphPad Prism (V5.0) software (GraphPad Software, Inc., La Jolla, CA, USA) was used for statistical analyses. Data are presented as the means ± standard error of the mean from at least three independent values. Student's t-test or one-way analysis of variance with Tukey's multiple comparison test were used to compare differences between the experimental groups. P<0.05 was considered to indicate a statistically significant difference.

Results

SFMBT2 is abundantly expressed during the early stages of cartilage development

To examine the expression of SFMBT2 in articular cartilage, femoral head cartilages were surgically isolated from DA rats at D0, D21 and D42, which represent newborn/baby (0 years old), ablactation/child (5 years old) and juvenile (11 years old) developmental stages in humans, respectively (33). Immunohistochemical staining of the cartilage samples using a specific antibody against SFMBT2 revealed that the protein expression levels of SFMBT2 were markedly higher at D0 (~80%) and D21 (~63%), whereas the expression was significantly decreased at D42 (~18%) (P<0.05; Fig. 1).

SFMBT2 is upregulated during the proliferative phase of chondrogenesis

Chondrogenesis was induced in ATDC5 cells, and chondrocyte differentiation was verified through the expression of key chondrogenic markers, including SOX9, COL2A1 and COL10A1. The mRNA and protein expression levels were analyzed at specific time-points by RT-qPCR and western blotting, respectively. As shown in Fig. 2A, the mRNA expression levels of SFMBT2, SOX9 and COL2A1 were markedly increased on days 3 and 7 (proliferation), but were significantly decreased at day 14 (hypertrophy) compared with at day 7 by >7-, >2- and >16-fold, respectively (P<0.05). COL10A1 transcription remained low during the prolifera-tive phase (days 3-7) but was increased at day 14 by >3-fold (P<0.05), compared with D0-D7. Western blotting results were consistent with the RT-qPCR data (Fig. 2B). These findings indicated that SFMBT2 may be involved in the proliferation of chondrocytes during chondrogenesis.

SFMBT2 regulates SOX9 expression in human chondrocytes

The expression levels of SFMBT2 were suppressed in C28/I2 cells in response to si-SFMBT2. Endogenous SFMBT2 was knocked down >70% by 80 nM si-SFMBT2 (Fig. 3A and B). Decreased levels of SFMBT2 in C28/I2 cells led to a significant reduction in SOX9, both at the mRNA (>1.7-fold; P<0.05) and protein levels (>2-fold; P<0.05), as determined by RT-qPCR and western blotting (Fig. 3A and B), respectively. Conversely, overexpression of SFMBT2 in C28/I2 cells was achieved by infecting the cells with ad-SFMBT2. Compared with ad-NC, chondrocytes infected with 400 MOI ad-SFMBT2 exhibited >18-fold higher levels of SFMBT2 (P<0.05), which resulted in significant upregulation of SOX9 at the mRNA (>2.4-fold; P<0.05) (Fig. 3C) and protein levels (>7-fold; P<0.05) (Fig. 3D).

SFMBT2 suppresses SOX9 reduction in TNF-α-treated C28/I2 cells

Different titers (MOIs) of ad-SFMBT2 were use to observe its effects on protein levels; as expected, ad-SFMBT2 upregulated SOX9 protein expression in a dose-dependent manner, as determined by western blotting (Fig. 4A). To investigate whether SOX9 could regulate SFMBT2, si-SOX9 was used. C28/I2 cells transfected with 60 nM si-SOX9 exhibited a marked decrease (>70%) in the protein expression levels of SOX9 compared with in cells transfected with si-NC. However, no change in the expression levels of SFMBT2 was observed (Fig. 4B), thus suggesting that SFMBT2 is located upstream of SOX9. Subsequently, SOX9 and SFMBT2 expression was examined in C28/I2 cells treated with IL-1β (10 ng/ml) or TNF-α (10 ng/ml). The results of a western blot analysis revealed that SOX9 expression was decreased in response to IL-1β and TNF-α treatment (by >2 and >3-fold, respectively). SFMBT2 expression was not significantly altered in response to IL-1β; however, it was decreased by >1.4-fold in response to 24 h of treatment with TNF-α (Fig. 4C). Furthermore, C28/I2 cells were treated with TNF-α for various durations. As shown in Fig. 4D, SOX9 expression was decreased in TNF-α-treated chondrocytes in a time-dependent manner. However, infecting cells with 400 MOI ad-SFMBT2 prevented SOX9 reduction, and increased SOX9 protein levels in TNF-α-treated chondrocytes.

Figure 4

Exogenous SFMBT2 attenuates the reduction in SOX9 expression in C28/I2 chondrocytes under TNF-α treatment. (A) Left panel, dose-dependent effect of SFMBT2 overexpression on SOX9 in C28/12 cells harvested at 48 h post-infection, as determined by western blotting (ad-SFMBT2 was used at 200, 400 and 800 MOI, whereas ad-NC was used at 400 MOI). Right panel, Statistical analysis of the relative protein expression levels normalized to GAPDH. (B) Relative protein expression levels of SOX9 and SFMBT2 in C28/I2 cells transfected with 60 nM si-NC or si-SOX9 and harvested 48 h post-transfection, as analyzed by western blotting. (C) Effects of IL-1β and TNF-α on the expression levels of SOX9 and SFMBT2 in C28/I2 cells harvested 48 h post-treatment. (D) Relative protein expression levels of SOX9 in C28/I2 cells infected with ad-NC or ad-SFMBT2 (400 MOI) for 24 h and incubated with TNF-α (10 ng/ml). The cells were harvested for protein isolation at the indicated time points post-TNF-α treatment and were analyzed by western blotting. GAPDH was used as the internal control in western blot analyses. *P<0.05, **P<0.01, ***P<0.001 vs. the Mock and ad-NC groups; ##P<0.01, ###P<0.001 vs. the indicated group. NS, non-significant. ad, adenovirus; IL, interleukin; MOI, multiplicity of infection; NC, negative control; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; SFMBT2, Scm-like with four malignant brain tumor domains 2; si, small interfering; SOX9, SRY-box 9; TNF, tumor necrosis factor.

SFMBT2 positively regulates chondrocyte proliferation

The proliferation of C28/I2 chondrocytes was observed using the CCK-8. C28/12 cells were transfected/infected with si-SFMBT2 or ad-SFMBT2, alongside their respective controls. The results demonstrated that si-SFMBT2 transfection decreased the proliferation of chondrocytes compared with in the si-NC group (Fig. 5A). Conversely, chondrocytes infected with ad-SFMBT2 exhibited increased proliferation compared with in the ad-NC group, as measured at the indicated time intervals (Fig. 5B).

Discussion

A previous study reported that SFMBT2 is highly expressed in extra-embryonic tissues, such as the placenta and yolk sac, and is required for trophoblast maintenance and placental development (34). The present study analyzed the expression levels of SFMBT2 during cartilage development. For that purpose, DA rats were raised and sacrificed at the indicated time points. Immunohistochemical staining of femoral head cartilage specimens collected at various stages of cartilage development revealed that SFMBT2 was markedly expressed during the early stages of development (D0 and D21), thus suggesting that this gene may be involved in early cartilage development. Notably, SFMBT2 expression was reduced in hypertrophic chondrocytes, and at D42 its expression was confined to the proliferating zone, thus indicating that SFMBT2 may participate in chondrocyte proliferation. The downregulation of SFMBT2 expression observed at D42 may indicate a lack of function of this gene in mature articular cartilage. However, due to the complex mechanism underlying maintenance of cartilage anabolic and catabolic homeostasis, certain levels of molecular factors are crucial to retain that balance. This was witnessed in our previous SFMBT2 knockdown experiments, where C28/I2 cells transfected with si-SFMBT2 displayed altered expression levels of metabolic marker genes, suggesting that downregulation of SFMBT2 may disturb the homeostatic balance of chondrocytes (30).

Chondrogenesis is a process by which cartilage is formed. It is primarily driven by the activity and expression of the transcription factor SOX9, which stimulates and maintains the expression of numerous cartilage-related genes, including COL2A1 and ACAN (14,35). As a prerequisite for chondro-genesis in vivo, SOX9 activates COL2A1 transcription by binding to the first intron enhancer through its high mobility group DNA-binding domain (36,37). Later phases of chon-drogenesis are marked and regulated by the sequential activation of genes, including Indian hedgehog, runt-related transcription factor 2, COL10A1 and matrix metalloproteinase 13 (MMP13), and the simultaneous downregulation of SOX9 and COL2A1 (38). Following chondrogenesis, chondrocytes remain as resting cells forming the articular cartilage, or undergo proliferation, terminal differentiation to chondrocyte hypertrophy and apoptosis in a process termed endochondral ossification, whereby the hypertrophic cartilage is replaced by bone (39).

ATDC5 cells are derived from mouse teratocarcinoma cells (40) and are characterized as prechondrogenic cells that remain undifferentiated if cultured in regular medium. However, when grown in medium containing a chondrogenic differentiation supplement, these cells can replicate the events of chondrogenesis, from cell condensation to cartilage nodule formation (41,42). Therefore, the ATDC5 cell line is considered a promising in vitro cell model to study the sequential events of cartilage formation and the factors that influence chondrocyte behaviors during chondrogenesis. In the present study, the expression levels of SFMBT2 were increased in chondrogenic ATDC5 cells during the early phase of chon-drogenesis (proliferating chondrocytes) alongside SOX9 and COL2A1, but were decreased in the later phases (hyper-trophic differentiation) when COL10A1 was upregulated, indicating that SFMBT2 may be involved in the proliferation of chondrocytes. The high levels of COL10A1 at D14 are in accordance with hypertrophic degeneration, which physiologically precedes endochondral ossification. Under normal physiological conditions, mature articular cartilage behaves quite differently; SOX9 and COL2A1 levels are maintained even in the presence of low cellular turnover. In general, in normal tissues, cellular proliferation and differentiation are inversely related. The chondrocytes in adult human cartilage are normally quiescent and maintain the matrix in a low turnover state. Healthy hyaline cartilage does not express high levels of COL10A1 and has a very low rate of proliferation, simultaneously maintaining high SOX9 and COL2A1 levels. Conversely, during OA development, modifications towards hypertrophy take place (43-47).

SFMBT2 expression during the process of chondrogenesis was almost consistent with that of SOX9. Therefore, it was hypothesized that SFMBT2 may affect SOX9 expression in articular chondrocyte. The present study examined the effects of SFMBT2 knockdown and overexpression in C28/I2 cells using siRNA and adenoviral vectors, respectively. In mature articular chondrocytes, following SFMBT2 knockdown in vitro, SOX9 was significantly downregulated at the mRNA and protein levels, whereas overexpression of SFMBT2 upregulated SOX9. SOX9 is a pivotal transcriptional regulator, which is essential for chondrocyte phenotypic stability, differentiation (13) and proliferation (36). Downregulation of SOX9 may induce angiogenesis, cartilage resorption, and formation of bone marrow and endochondral bone trabeculae (22), which are associated with the progression of OA. The present study also investigated whether SOX9 could regulate SFMBT2 expression. For that purpose, SOX9 expression in C28/I2 cells was suppressed by targeting SOX9 mRNA using a specific siRNA sequence; however, si-SOX9 did not affect SFMBT2 expression levels in chondrocytes, indicating that SFMBT2 is upstream of SOX9.

Studies on chondrocyte behavior in OA suggest that at different stages and/or locations within articular cartilage, the processes of cartilage matrix anabolism and catabolism are regulated through coordinated mechanisms that are not fully understood. The degradation of articular cartilage due to cata-bolic behavior of chondrocytes, thus leading to the destruction of ECM components, is a characteristic of OA (48,49). In OA, the normally quiescent chondrocytes undergo a phenotypic shift and become ‘activated’ cells, characterized by cell proliferation, cluster formation, and increased production of matrix proteins and matrix-degrading enzymes (49). It is generally considered that inflammation is absent or weakly present in OA (50); however, numerous studies have confirmed the presence of immune cells and proinflammatory cytokines within the synovial tissues of patients with OA (51-54). The most acknowledged background theory is that the cartilage fragments and the degraded products fall into the joint and come into contact with the synovium (50). Considering them foreign bodies, synovial cells produce inflammatory cytokines in response to these cartilage fragments, which results in further activation of chondrocytes, the production of matrix-degrading enzymes [i.e. MMPs and a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTSs)] and subsequent increased cartilage destruction (55).

Numerous studies have confirmed the upregulation of IL-1β and TNF-α in OA joints (51-54). Nuclear factor (NF)-κB, which is a negative regulator of SOX9 expression, is mainly regulated by TNF-α and IL-1β (56). Activation of NF-κB and other inflammatory pathways, such as the mitogen-activated protein kinase signaling pathway, is required for chondro-cytes to express MMPs, ADAMTSs and inflammatory cytokines (44,57). In vitro studies have suggested that NF-κB is an upstream inducer of hypoxia-inducible factor-2α, which is another transactivator of genes expressed in hypertrophic chondrocytes, including COL10A1, MMP13 and vascular endothelial growth factor (58). These findings suggest that the anabolic-catabolic balance is under the influence of a complex network of signals that regulate chondrocyte behavior and tissue homeostasis (59). Catabolic activity is higher in OA (60), and due to their low turnover rate, chon-drocytes are not able to substitute the degraded ECM (61). However, increased production of collagen type II and ACAN is commonly considered an early response to cartilage degeneration in in vivo and in vitro OA models (62,63). SOX9 is a potent transcriptional activator of COL2A1, which participates in cartilage development and can maintain the chondrocyte phenotype (13,20,64,65). When C28/I2 cells were incubated with various concentrations (MOIs) of ad-SFMBT2, SOX9 protein levels were elevated in a dose-dependent manner compared with in the ad-NC group. Furthermore, TNF-α treatment reduced SOX9 protein levels in C28/I2 cells. Infection with ad-SFMBT2 not only protected the cells from a reduction in SOX9 levels, but also increased its expression in a time-dependent manner.

The present study investigated whether alterations in SFMBT2 levels could affect the proliferation of C28/I2 cells. SFMBT2 was knocked down in chondrocytes, which were subjected to a cell proliferation assay using the CCK-8. SFMBT2 knockdown decreased cell proliferation compared with in the si-NC-transfected cells. Conversely, the ad-SFMBT2 group displayed an increased proliferative rate compared with in the ad-NC group. These results suggested that SFMBT2 may function as a positive regulator of cell proliferation in human chondrocytes.

In conclusion, the present study revealed that SFMBT2 could target and regulate the expression of SOX9, and could protect chondrocytes from losing SOX9 expression under TNF-α treatment. SFMBT2 also promoted chondrocyte proliferation. Further studies may reveal this promising molecule as a potential therapeutic agent against OA.

Acknowledgements

The C28/I2 cell line was provided by Prof. Junling Cao (Institute of Endemic Diseases, Xi'an Jiaotong University, Health Science Center).

Funding

The present study was supported by grants from the National Natural Science Foundation of China (grant nos. 81371986, 81772410 and 81301598), the Shaanxi Province Natural Science Foundation (grant no. S2016YFJM1171) and the Fundamental Research Funds for the Central Universities (grant no. xjj2015073).

Availability of data and materials

The datasets used and/or analyzed during this study are available from the corresponding author on reasonable request.

Authors' contributions

SH designed and executed the experiments, analyzed the data and wrote the manuscript. MS and YG helped in the analyses and interpretation of data. NM, YZ, YY, NH, EO, AS, MS, FZ and YH helped perform the experiments. JS and SL conceived and designed the study, critically reviewed and drafted the manuscript and take responsibility for the integrity of the work as a whole. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The animal study was approved by the Institutional Animal Ethics Committee of Xi'an Jiaotong University, Health Science Center.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Sandell LJ, Sugai JV and Trippel SB: Expression of collagens I, II, X, and XI and aggrecan mRNAs by bovine growth plate chondrocytes in situ. J Orthop Res. 12:1–14. 1994. View Article : Google Scholar : PubMed/NCBI

2 

Cleland KA, James MJ, Neumann MA, Gibson RA and Cleland LG: Differences in fatty acid composition of immature and mature articular cartilage in humans and sheep. Lipids. 30:949–953. 1995. View Article : Google Scholar : PubMed/NCBI

3 

Muir H: The chondrocyte, architect of cartilage Biomechanics, structure, function and molecular biology of cartilage matrix macromolecules. Bioessays. 17:1039–1048. 1995. View Article : Google Scholar : PubMed/NCBI

4 

Kinner B, Capito RM and Spector M: Regeneration of articular cartilage. Adv Biochem Eng Biotechnol. 94:91–123. 2005.PubMed/NCBI

5 

Goldring MB, Tsuchimochi K and Ijiri K: The control of chon-drogenesis. J Cell Biochem. 97:33–44. 2006. View Article : Google Scholar

6 

Aigner T, Zhu Y, Chansky HH, Matsen FA III, Maloney WJ and Sandell LJ: Reexpression of type IIA procollagen by adult articular chondrocytes in osteoarthritic cartilage. Arthritis Rheum. 42:1443–1450. 1999. View Article : Google Scholar : PubMed/NCBI

7 

Cheng A and Genever PG: SOX9 determines RUNX2 trans-activity by directing intracellular degradation. J Bone Miner Res. 25:2680–2689. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Yamashita S, Andoh M, Ueno-Kudoh H, Sato T, Miyaki S and Asahara H: Sox9 directly promotes Bapx1 gene expression to repress Runx2 in chondrocytes. Exp Cell Res. 315:2231–2240. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Chen H, Ghori-Javed FY, Rashid H, Adhami MD, Serra R, Gutierrez SE and Javed A: Runx2 regulates endochondral ossification through control of chondrocyte proliferation and differentiation. J Bone Miner Res. 29:2653–2665. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Ulrich C, Rolauffs B, Abele H, Bonin M, Nieselt K, Hart ML and Aicher WK: Low osteogenic differentiation potential of placenta-derived mesenchymal stromal cells correlates with low expression of the transcription factors Runx2 and Twist2. Stem Cells Dev. 22:2859–2872. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Buckwalter JA and Mankin HJ: Articular cartilage: Tissue design and chondrocyte-matrix interactions. Instr Course Lect. 47:477–486. 1998.PubMed/NCBI

12 

Goldring MB and Goldring SR: Osteoarthritis. J Cell Physiol. 213:626–634. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Bi W, Deng JM, Zhang Z, Behringer RR and de Crombrugghe B: Sox9 is required for cartilage formation. Nat Genet. 22:85–89. 1999. View Article : Google Scholar : PubMed/NCBI

14 

Akiyama H, Chaboissier MC, Martin JF, Schedl A and de Crombrugghe B: The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6. Genes Dev. 16:2813–2828. 2002. View Article : Google Scholar : PubMed/NCBI

15 

Furumatsu T, Tsuda M, Taniguchi N, Tajima Y and Asahara H: Smad3 induces chondrogenesis through the activation of SOX9 via CREB-binding protein/p300 recruitment. J Biol Chem. 280:8343–8350. 2005. View Article : Google Scholar

16 

Akiyama H and Lefebvre V: Unraveling the transcriptional regulatory machinery in chondrogenesis. J Bone Miner Metab. 29:390–395. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Linn FC and Sokoloff L: Movement and Composition of interstitial fluid of cartilage. Arthritis Rheum. 8:481–494. 1965. View Article : Google Scholar : PubMed/NCBI

18 

Yamashita S, Miyaki S, Kato Y, Yokoyama S, Sato T, Barrionuevo F, Akiyama H, Scherer G, Takada S and Asahara H: L-Sox5 and Sox6 proteins enhance chondrogenic miR-140 microRNA expression by strengthening dimeric Sox9 activity. J Biol Chem. 287:22206–22215. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Lefebvre V, Behringer RR and de Crombrugghe B: L-Sox5, Sox6 and Sox9 control essential steps of the chondrocyte differentiation pathway. Osteoarthritis Cartilage. 9(Suppl A): S69–S75. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Ng LJ, Wheatley S, Muscat GE, Conway-Campbell J, Bowles J, Wright E, Bell DM, Tam PP, Cheah KS and Koopman P: SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse. Dev Biol. 183:108–121. 1997. View Article : Google Scholar : PubMed/NCBI

21 

Zhao Q, Eberspaecher H, Lefebvre V and De Crombrugghe B: Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev Dyn. 209:377–386. 1997. View Article : Google Scholar : PubMed/NCBI

22 

Hattori T, Muller C, Gebhard S, Bauer E, Pausch F, Schlund B, Bösl MR, Hess A, Surmann-Schmitt C, von der Mark H, et al: SOX9 is a major negative regulator of cartilage vascularization, bone marrow formation and endochondral ossification. Development. 137:901–911. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Foster JW, Dominguez-Steglich MA, Guioli S, Kwok C, Weller PA, Stevanović M, Weissenbach J, Mansour S, Young ID, Goodfellow PN, et al: Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature. 372:525–530. 1994. View Article : Google Scholar : PubMed/NCBI

24 

Bracken AP and Helin K: Polycomb group proteins: Navigators of lineage pathways led astray in cancer. Nat Rev Cancer. 9:773–784. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Tsai HC and Baylin SB: Cancer epigenetics: Linking basic biology to clinical medicine. Cell Res. 21:502–517. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Klymenko T, Papp B, Fischle W, Köcher T, Schelder M, Fritsch C, Wild B, Wilm M and Müller J: A Polycomb group protein complex with sequence-specific DNA-binding and selective methyl-lysine-binding activities. Genes Dev. 20:1110–1122. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Lee K, Na W, Maeng JH, Wu H and Ju BG: Regulation of DU145 prostate cancer cell growth by Scm-like with four mbt domains 2. J Biosci. 38:105–112. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Wu S, Trievel RC and Rice JC: Human SFMBT is a transcriptional repressor protein that selectively binds the N-terminal tail of histone H3. FEBS Lett. 581:3289–3296. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Wang W, Zhong B, Sun J, Cao J, Tian J, Zhong N, Zhao W, Tian L, Xu P, Guo D, et al: Down-regulated HS6ST2 in osteoarthritis and Kashin-Beck disease inhibits cell viability and influences expression of the genes relevant to aggrecan metabolism of human chondrocytes. Rheumatology (Oxford). 50:2176–2186. 2011. View Article : Google Scholar

30 

Hussain S, Sun M, Min Z, Guo Y, Xu J, Mushtaq N, Heng L, Huang H, Zhao Y, Yuan Y, et al: Down-regulated in OA cartilage, SFMBT2 contributes to NF-κB mediated ECM degradation. J Cell Mol Med. Aug 22–2018. View Article : Google Scholar

31 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

32 

Wei X, Peng G, Zheng S and Wu X: Differentiation of umbilical cord mesenchymal stem cells into steroidogenic cells in comparison to bone marrow mesenchymal stem cells. Cell Prolif. 45:101–110. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Fox JG, Cohen BJ and Loew FM: Laboratory Animal Medicine. Academic Press Inc, Harcourt Brace Jovanovich; San Diego, CA: 1984

34 

Miri K, Latham K, Panning B, Zhong Z, Andersen A and Varmuza S: The imprinted polycomb group gene Sfmbt2 is required for trophoblast maintenance and placenta development. Development. 140:4480–4489. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Horton WA: Skeletal development: Insights from targeting the mouse genome. Lancet. 362:560–569. 2003. View Article : Google Scholar : PubMed/NCBI

36 

Lefebvre V, Li P and de Crombrugghe B: A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondro-genesis and cooperatively activate the type II collagen gene. Embo J. 17:5718–5733. 1998. View Article : Google Scholar : PubMed/NCBI

37 

Leung KK, Ng LJ, Ho KK, Tam PP and Cheah KS: Different cis-regulatory DNA elements mediate developmental stage- and tissue-specific expression of the human COL2A1 gene in transgenic mice. J Cell Biol. 141:1291–1300. 1998. View Article : Google Scholar : PubMed/NCBI

38 

Zuscik MJ, Hilton MJ, Zhang X, Chen D and O'Keefe RJ: Regulation of chondrogenesis and chondrocyte differentiation by stress. J Clin Invest. 118:429–438. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Lefebvre V and Smits P: Transcriptional control of chondrocyte fate and differentiation. Birth Defects Res C Embryo Today. 75:200–212. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Atsumi T, Miwa Y, Kimata K and Ikawa Y: A chondrogenic cell line derived from a differentiating culture of AT805 teratocarcinoma cells. Cell Differ Dev. 30:109–116. 1990. View Article : Google Scholar : PubMed/NCBI

41 

Shukunami C, Shigeno C, Atsumi T, Ishizeki K, Suzuki F and Hiraki Y: Chondrogenic differentiation of clonal mouse embryonic cell line ATDC5 in vitro: Differentiation-dependent gene expression of parathyroid hormone (PTH)/PTH-related peptide receptor. J Cell Biol. 133:457–468. 1996. View Article : Google Scholar : PubMed/NCBI

42 

Shukunami C, Ohta Y, Sakuda M and Hiraki Y: Sequential progression of the differentiation program by bone morphogenetic protein-2 in chondrogenic cell line ATDC5. Exp Cell Res. 241:1–11. 1998. View Article : Google Scholar : PubMed/NCBI

43 

Henry SP, Liang S, Akdemir KC and de Crombrugghe B: The postnatal role of Sox9 in cartilage. J Bone Miner Res. 27:2511–2525. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Goldring MB: Chondrogenesis, chondrocyte differentiation, and articular cartilage metabolism in health and osteoarthritis. Ther Adv Musculoskelet Dis. 4:269–285. 2012. View Article : Google Scholar : PubMed/NCBI

45 

Salminen H, Vuorio E and Saamanen AM: Expression of Sox9 and type IIA procollagen during attempted repair of articular cartilage damage in a transgenic mouse model of osteoarthritis. Arthritis Rheum. 44:947–955. 2001. View Article : Google Scholar : PubMed/NCBI

46 

Binette F, McQuaid DP, Haudenschild DR, Yaeger PC, McPherson JM and Tubo R: Expression of a stable articular cartilage phenotype without evidence of hypertrophy by adult human articular chondrocytes in vitro. J Orthop Res. 16:207–216. 1998. View Article : Google Scholar : PubMed/NCBI

47 

Hoyland JA, Thomas JT, Donn R, Marriott A, Ayad S, Boot-Handford RP, Grant ME and Freemont AJ: Distribution of type X collagen mRNA in normal and osteoarthritic human cartilage. Bone Miner. 15:151–163. 1991. View Article : Google Scholar : PubMed/NCBI

48 

Goldring MB, Otero M, Tsuchimochi K, Ijiri K and Li Y: Defining the roles of inflammatory and anabolic cytokines in cartilage metabolism. Ann Rheum Dis. 67(Suppl 3): iii75–iii82. 2008. View Article : Google Scholar : PubMed/NCBI

49 

Goldring MB and Marcu KB: Cartilage homeostasis in health and rheumatic diseases. Arthritis Res Ther. 11:2242009. View Article : Google Scholar : PubMed/NCBI

50 

Berenbaum F: Osteoarthritis as an inflammatory disease (osteoarthritis is not osteoarthrosis!). Osteoarthritis Cartilage. 21:16–21. 2013. View Article : Google Scholar

51 

Pelletier JP and Martel-Pelletier J: Evidence for the involvement of interleukin 1 in human osteoarthritic cartilage degradation: Protective effect of NSAID. J Rheumatol. 18:19–27. 1989.

52 

Farahat MN, Yanni G, Poston R and Panayi GS: Cytokine expression in synovial membranes of patients with rheumatoid arthritis and osteoarthritis. Ann Rheum Dis. 52:870–875. 1993. View Article : Google Scholar : PubMed/NCBI

53 

Tetlow LC, Adlam DJ and Woolley DE: Matrix metalloproteinase and proinflammatory cytokine production by chondrocytes of human osteoarthritic cartilage: Associations with degenerative changes. Arthritis Rheum. 44:585–594. 2001. View Article : Google Scholar : PubMed/NCBI

54 

Muñoz-Valle JF, Oregón-Romero E, Rangel-Villalobos H, Martínez-Bonilla GE, Castañeda-Saucedo E, Salgado-Goytia L, Leyva-Vázquez MA, Illades-Aguiar B, Alarcón-Romero Ldel C, Espinoza-Rojo M and Parra-Rojas I: High expression of TNF alpha is associated with -308 and -238 TNF alpha polymorphisms in knee osteoarthritis. Clin Exp Med. 14:61–67. 2014. View Article : Google Scholar

55 

Kim KI, Park YS and Im GI: Changes in the epigenetic status of the SOX-9 promoter in human osteoarthritic cartilage. J Bone Miner Res. 28:1050–1060. 2013. View Article : Google Scholar

56 

Sitcheran R, Cogswell PC and Baldwin AS Jr: NF-kappaB mediates inhibition of mesenchymal cell differentiation through a posttranscriptional gene silencing mechanism. Genes Dev. 17:2368–2373. 2003. View Article : Google Scholar : PubMed/NCBI

57 

Schroeppel JP, Crist JD, Anderson HC and Wang J: Molecular regulation of articular chondrocyte function and its significance in osteoarthritis. Histol Histopathol. 26:377–394. 2011.PubMed/NCBI

58 

Yang S, Kim J, Ryu JH, Oh H, Chun CH, Kim BJ, Min BH and Chun JS: Hypoxia-inducible factor-2alpha is a catabolic regulator of osteoarthritic cartilage destruction. Nat Med. 16:687–693. 2010. View Article : Google Scholar : PubMed/NCBI

59 

Mueller MB and Tuan RS: Anabolic/Catabolic balance in pathogenesis of osteoarthritis: Identifying molecular targets. PM R. 3(Suppl 1): S3–S11. 2011. View Article : Google Scholar : PubMed/NCBI

60 

Madry H, Luyten FP and Facchini A: Biological aspects of early osteoarthritis. Knee Surg Sports Traumatol Arthrosc. 20:407–422. 2012. View Article : Google Scholar

61 

Wang M, Shen J, Jin H, Im HJ, Sandy J and Chen D: Recent progress in understanding molecular mechanisms of cartilage degeneration during osteoarthritis. Ann N Y Acad Sci. 1240:61–69. 2011. View Article : Google Scholar : PubMed/NCBI

62 

Matyas JR, Adams ME, Huang D and Sandell LJ: Discoordinate gene expression of aggrecan and type II collagen in experimental osteoarthritis. Arthritis Rheum. 38:420–425. 1995. View Article : Google Scholar : PubMed/NCBI

63 

Cs-Szabó G, Melching LI, Roughley PJ and Glant TT: Changes in messenger RNA and protein levels of proteoglycans and link protein in human osteoarthritic cartilage samples. Arthritis Rheum. 40:1037–1045. 1997. View Article : Google Scholar : PubMed/NCBI

64 

Lefebvre V and de Crombrugghe B: Toward understanding SOX9 function in chondrocyte differentiation. Matrix Biol. 16:529–540. 1998. View Article : Google Scholar : PubMed/NCBI

65 

Lefebvre V, Huang W, Harley VR, Goodfellow PN and de Crombrugghe B: SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol Cell Biol. 17:2336–2346. 1997. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

December-2018
Volume 42 Issue 6

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Hussain S, Sun M, Guo Y, Mushtaq N, Zhao Y, Yuan Y, Hussain N, Osoro E, Suleiman A, Sadiq M, Sadiq M, et al: SFMBT2 positively regulates SOX9 and chondrocyte proliferation. Int J Mol Med 42: 3503-3512, 2018.
APA
Hussain, S., Sun, M., Guo, Y., Mushtaq, N., Zhao, Y., Yuan, Y. ... Lu, S. (2018). SFMBT2 positively regulates SOX9 and chondrocyte proliferation. International Journal of Molecular Medicine, 42, 3503-3512. https://doi.org/10.3892/ijmm.2018.3894
MLA
Hussain, S., Sun, M., Guo, Y., Mushtaq, N., Zhao, Y., Yuan, Y., Hussain, N., Osoro, E., Suleiman, A., Sadiq, M., Zhang, F., Han, Y., Sun, J., Lu, S."SFMBT2 positively regulates SOX9 and chondrocyte proliferation". International Journal of Molecular Medicine 42.6 (2018): 3503-3512.
Chicago
Hussain, S., Sun, M., Guo, Y., Mushtaq, N., Zhao, Y., Yuan, Y., Hussain, N., Osoro, E., Suleiman, A., Sadiq, M., Zhang, F., Han, Y., Sun, J., Lu, S."SFMBT2 positively regulates SOX9 and chondrocyte proliferation". International Journal of Molecular Medicine 42, no. 6 (2018): 3503-3512. https://doi.org/10.3892/ijmm.2018.3894