Regulation of myo-inositol biosynthesis by p53-ISYNA1 pathway

  • Authors:
    • Tomoyuki Koguchi
    • Chizu Tanikawa
    • Jinichi Mori
    • Yoshiyuki Kojima
    • Koichi Matsuda
  • View Affiliations

  • Published online on: March 24, 2016     https://doi.org/10.3892/ijo.2016.3456
  • Pages: 2415-2424
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

In response to various cellular stresses, p53 exerts its tumor suppressive effects such as apoptosis, cell cycle arrest, and senescence through the induction of its target genes. Recently, p53 was shown to control cellular homeostasis by regulating energy metabolism, glycolysis, antioxidant effect, and autophagy. However, its function in inositol synthesis was not reported. Through a microarray screening, we found that five genes related with myo-inositol metabolism were induced by p53. DNA damage enhanced intracellular myo-inositol content in HCT116 p53+/+ cells, but not in HCT116 p53-/- cells. We also indicated that inositol 3-phosphate synthase (ISYNA1) which encodes an enzyme essential for myo-inositol biosynthesis as a direct target of p53. Activated p53 regulated ISYNA1 expression through p53 response element in the seventh exon. Ectopic ISYNA1 expression increased myo-inositol levels in the cells and suppressed tumor cell growth. Knockdown of ISYNA1 caused resistance to adriamycin treatment, demonstrating the role of ISYNA1 in p53-mediated growth suppression. Furthermore, ISYNA1 expression was significantly associated with p53 mutation in bladder, breast cancer, head and neck squamous cell carcinoma, lung squamous cell carcinoma, and pancreatic adenocarcinoma. Our findings revealed a novel role of p53 in myo-inositol biosynthesis which could be a potential therapeutic target.

Introduction

p53 is one of the most frequently mutated tumor suppressor genes (1, 2). In response to various cellular stresses, ATM-Chk2 cascade stabilizes p53 protein through the phosphorylation of its N-terminal domain (3). Activated p53 functions as a transcription factor and exerts its tumor suppressive effects such as apoptosis, cell cycle arrest, and senescence through the induction of its target genes (1,2). In addition to genes related with cell proliferation, regulation of glycolysis (4), energy metabolism, antioxidant effect (5), autophagy (6), and respiration with mitochondria are reported as novel functions of p53. Thus, p53 regulates not only tumor cell growth but also pathways related with cellular homeostasis. Since inactivation of p53 is the most common feature of cancer cells, the elucidation of p53 signaling pathways would contribute to the understanding of tumor cells as well as for drug development.

Myo-inositol is water-soluble vitamin found in a variety of food products, and are also synthesized in cells (7). Previous studies indicated that myo-inositol has various functions including glucose and lipid metabolism (8,9), neurotropic effect (10), and tumor suppression (1113). However, the regulation of myo-inositol biosynthesis in cancer tissues has not been disclosed yet. Through a cDNA microarray screening using mRNAs isolated from HCT116 p53+/+ and HCT116 p53−/− cells, we identified ISYNA1 which encodes an enzyme essential for myo-inositol biosynthesis as a novel p53 target.

Materials and methods

cDNA microarray

Gene expression analysis was performed using SurePrint G3 Human GE 8×60K microarray (Agilent, Santa Clara, CA, USA) according to the manufacturer's protocol. Briefly, HCT116 p53+/+ or HCT116 p53−/− cells were treated with 2 μg/ml of adriamycin (ADR) for 2 h and incubated at 37°C until harvest. At 12, 24 and 48 h after treatment, total RNA was isolated from the cells using standard protocols. Each RNA sample was labeled and hybridized to array slides.

Cell culture and treatment

Human embryonic kidney cells HEK293T were obtained from Riken Cell Bank. Human cancer cell lines U373MG (astrocytoma), HepG2 (hepatocellular carcinoma), and HCT116 (colorectal adenocarcinoma) were purchased from American Type Culture Collection. HCT116 p53+/+ and HCT116 p53−/− cells lines were gifts from B. Vogelstein (Johns Hopkins University, Baltimore, MD, USA). HEK293T, HCT116, and HepG2 cells were transfected with plasmids using FuGENE 6 (Promega, Madison, WI, USA). U373 MG cells were transfected with plasmids using FuGENE 6 or Lipofectamine LTX (Invitrogen, Carlsbad, CA, USA). Small interfering RNA (siRNA) oligonucleotides, commercially synthesized by Sigma Genosys, were transfected with Lipofectamine RNAiMAX reagent (Invitrogen). Sequences of siRNA oligonucleotides are shown in Table I. We generated and purified replication-deficient recombinant viruses expressing p53 (Ad-p53) or LacZ (Ad-LacZ) as described previously (14). U373MG (p53-mutant) cells were infected with viral solutions at various amounts of multiplicity of infection (MOI) and incubated at 37°C until the time of harvest. For treatment with genotoxic stress, cells were incubated with 2 μg/ml of ADR for 2 h.

Table I

Sequence of primers and oligonucleotides.

Table I

Sequence of primers and oligonucleotides.

siRNASenseAntisense
siISYNA1-A GCGCUUCUGUGAGGUGAUUTT AAUCACCUCACAGAAGCGCTT
siISYNA1-B GCCUCAAGACCAUGUCCAUTT AUGGACAUGGUCUUGAGGCTT
siISYNA1-C UCAAGUCAGGCCAGACCAATT UUGGUCUGGCCUGACUUGATT
sip53 GACUCCAGUGGUAAUCUACTT GUAGAUUACCACUGGAGUCTT
siEGFP GCAGCACGACUUCUUCAAGTT CUUGAAGAAGUCGUGCUGCTT

Expression vecterForwardReverse

ISYNA1 isoform 1 CCCGATATCGCCGCGATGGAGGCCGCCGC CCCCTCGAGGGTGGTGGGCATTGGGGGC
ISYNA1 isoform 4 CCCGATATCCTGCCCATGGTGGCGCCC CCCCTCGAGGGTGGTGGGCATTGGGGGC

Quantitative real-time PCRForwardReverse

hISYNA1 AGTCCGTGCTTGTGGACTTC CCGATAGGTTCTCCCCATC
hGAPDH ACCATGGGGAAGGTGAAG AATGAAGGGGTCATTGATGG
mIsyna1 CCTTGGTGCTCCATAATACCTG AGTCTGTGCAGAAGCTCACG
mGapdh AATGTGTCCGTCGTGGATCTGA GATGCCTGCTTCACCACCTTCT

Gene reporter assayForwardReverse

RE1 CCCCTCGAGTGTATTGAGACGGGGTTTCC CCCAAGCTTCACCCAGTCTGCTCCCTTTAAG
RE2 CCCCTCGAGGCCTTCCTCAATGGGTCTC CCCAAGCTTTCACGATGGACATGGTCTGTG
mRE CCCCTCGAGATACCCAAGTGCTGGAGGTG CCCAAGCTTACCTTGTGTGTGGTCCCTTC

Chromatin immunoprecipitation assayForwardReverse

RE2 GATGACTTCAAGTCAGGCCAGAC CCCACGCACCTTGAGGCCGG

MutagenesisForwardReverse

ISYNA1 isoform 2 AGGCCAACTACTACGGCTCGCTGA CCTTGAGAACGCCACCCTCGCGGC
RE1mt CACTGTTCCTGGCTGACTGCCTATTTTTCG GCTAATACCTGTAATCCTAGCACTTTGGGAG
RE2mt GTGTTTTTGGACTTCCTCATTGGCTCCGGC GGAATTAACTTTGGTCTGGCCTGACTTGAAG
mREmt GGGTTATTTACCACCACTGATGCCGTGACC AGGAATACTGGCCCTGTACACCCGTGCTTG
Plasmid construction

The entire coding sequence of ISYNA1 isoforms 1 and 4 were amplified by PCR using KOD-Plus DNA polymerase (Toyobo, Osaka, Japan), and inserted into the EcoRV and XhoI sites of pCAGGS vector. ISYNA1 isoform 2 expression vector was constructed by site-directed mutagenesis using ISYNA1 isoform 1 as a template. The construct was confirmed by DNA sequence analysis. Primers are shown in Table I.

Quantitative real-time PCR

Total RNA was isolated from human cells and mouse tissues using RNeasy Plus Mini kits (Qiagen, Valencia, CA, USA) and RNeasy Plus Universal Mini kits (Qiagen) according to the manufacturer's instructions. Complementary DNAs were synthesized using Super Script III reverse transcriptase (Invitrogen). Quantitative real-time PCR (qPCR) was conducted using SYBR Green Master Mix on a Light Cycler 480 (Roche, Basel, Switzerland). Primer sequences are shown in Table I.

Western blot analysis

To prepare whole cell extracts, cells were collected and lysed in chilled RIPA buffer (50 mmol/l Tris-HCl at pH 8.0, 150 mmol/l NaCl, 0.1% SDS, 0.5% sodium deoxycholate, and 1% NP40) containing 1 mM phenyl-methylsulphonyl fluoride (PMSF), 0.1 mM DTT and 0.1% Calbiochem Protease Inhibitor Cocktail Set III, EDTA-Free (EMD Chemicals Inc., Merck KGaA, Darmstadt, Germany). Samples were sonicated for 15 min with a 30 sec on/30 sec off cycle using Bioruptor UCD-200 (Cosmobio, Tokyo, Japan). After centrifugation at 16,000 × g for 15 min, supernatants were collected and boiled in SDS sample buffer (Bio-Rad, Hercules, CA, USA). SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was performed for each sample, and the proteins were then transferred to a nitrocellulose membrane (Hybond™ ECL™, Amersham, Piscataway, NJ, USA). Protein bands on western blots were visualized by chemiluminescent detection (ECL, Amersham and Immobilon, Millipore). Anti-β-actin monoclonal antibody (AC-15) was purchased from Abcam (Cambridge, UK). Anti-ISYNA1 monoclonal antibody (sc-271830) and anti-p53 monoclonal antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-p21WAF1 monoclonal antibody (OP64) was purchased from Merck Millipore (Darmstadt, Germany).

Immunocytochemical analyses

Cells were seeded on coverslips in 24-well plates. After each treatment indicated in the text, cells were washed in phosphate-buffered saline (PBS) before fixation in 4% paraformaldehyde. Cells were immunostained overnight with primary antibodies followed by incubation with Alexa Fluor 488-conjugated secondary IgG (Molecular Probes) for 1 h. Cells were subjected to 4′-6-diamidino-2-phenylindole (DAPI) staining to visualize cell nuclei. Immunofluorescence was visualized and recorded on an Olympus FV1000D laser confocal microscope. Images were processed using Olympus FV10-ASW software and Adobe Photoshop CS3.

Gene reporter assay

DNA fragments, including the potential p53-response elements (REs), were amplified and subcloned into the pGL4.24 vector (Promega). Point mutations ‘T’ were inserted at the 4th and the 14th nucleotide ‘C’ and the 7th and the 17th nucleotide ‘G’ of each RE by site-directed mutagenesis. Reporter assays were performed using the Dual Luciferase assay system (Promega) as described previously (15). Primers for amplification and mutagenesis are shown in Table I.

Chromatin immunoprecipitation (ChIP) assay

ChIP assay was performed using EZ-Magna ChIP G Chromatin Immunoprecipitation kit (Merck Millipore, Darmstadt, Germany) following the manufacturer's protocol. In brief, U373MG cells infected with Ad-p53- or Ad-LacZ at a MOI of 10 were cross-linked with 1% formaldehyde for 10 min, washed with PBS, and lysed in nuclear lysis buffer. The lysate was then sonicated using Bioruptor UCD-200 (CosmoBio) to shear DNA to ~200–1,000 bp. Supernatant from 1×106 cells was used for each immunoprecipitation with anti-p53 antibody (OP140, Merck Millipore) or normal mouse IgG (sc-2025, Santa Cruz). Column-purified DNA was quantified by qPCR. Primer sequences are shown in Table I.

Myo-inositol (MI) assay

To prepare cell homogenate, cells were collected and suspended in PBS. Samples were sonicated for 15 min with a 30 sec on/30 sec off cycle using Bioruptor UCD-200 (Cosmobio). After centrifugation at 16,000 × g for 5 min, myo-inositol content in supernatants was measured using myo-inositol assay kit (K-INOSL, Megazyme International Ireland, Bray, Wicklow, Ireland) according to the manufacturer's instructions.

Colony formation assay

HCT116 cells and HepG2 cells were seeded on 6-well flat bottomed microplates. At 24 h after seeding, cells were transfected with pCAGGS (mock) vector or pCAGGS/ISYNA1 isoform 1. HCT116 and HepG2 cells were cultured with 0.5 or 1.2 mg/ml of G418, respectively. After 2 or 3 weeks of drug selection, colonies were washed in phosphate-buffered saline and stained with 0.1% crystal violet for 24 h.

ATP assay

HCT116 p53+/+ cells were transfected with siRNAs and seeded on 24-well plates. At 24 h after transfection, cells were treated with 2 μg/ml of ADR for 2 h. At 48 h after ADR treatment, cell viability was evaluated by Cell Titer-Glo Luminescent Cell Viability assay (Promega). After removal of culture medium, cells were incubated with 100 μl of Cell Titer-Glo reagent and 100 μl of culture medium for 10 min and lysed. The luminescence of cell lysate was measured by ARVO X3 plate reader (Perkin-Elmer, Waltham, MA, USA) according to the manufacturer's protocol.

Animal models

p53−/− mice were provided by RIKEN BioResource Center (Ibaraki, Japan) (16). The mice were maintained under specific pathogen-free conditions and were handled in accordance with the Guidelines for Animal Experiments of the University of Tokyo. p53+/+ and p53−/− mice at 6 weeks of age were irradiated with 10 Gy of X-ray. At 24 h after irradiation, mice were sacrificed for liver extraction.

Database analysis

ISYNA1 expression and p53 mutation status in clinical samples were obtained from the TCGA project via data portal on 15 May 2015 (17). The association between ISYNA1 expression and the presence of the p53 gene mutation was determined by using the Student's t-test.

Results

p53 regulates genes related with myo-inositol metabolism

To screen novel p53 target genes, we conducted cDNA micro-array analysis using mRNAs isolated from HCT116 p53+/+ and HCT116 p53−/− cells that were treated with 2 μg/ml of adriamycin (ADR). Fig. 1A shows a schematic representation of inositol phosphate metabolism pathway. The result of cDNA microarray analysis indicated that five genes related with myo-inositol metabolism were induced by p53 (Fig. 1B). We selected inositol 3-phosphate synthase (ISYNA1) for further analysis, because ISYNA1 showed the highest expression among the five genes.

Figure 1

Regulation of ISYNA1 by p53. (A) Schematic representation of the inositol phosphate metabolism pathway. PI, phosphatidylinositol; PIP, phosphatidylinositol 4-phosphate; PIP2, phosphatidylinositol 4,5-bisphosphate; Ins(1,4,5)P3, inositol 1,4,5-trisphosphate; Ins(1,4)P2, inositol 1,4-bisphosphate; Ins(4) P, inositol 4-phosphate; Ins(1,3,4,5)P4, inositol 1,3,4,5-tetrakisphosphate; Ins(1,3,4)P3, inositol 1,3,4-trisphosphate; Ins(3,4)P2, inositol 3,4-phosphtate; Ins(3)P, inositol 3-phosphate; Ins(1,3)P2, inositol 1,3-bisphosphate; Ins(1)P, inositol 1-phosphate; G6P, glucose 6-phosphate; DAG, diacylglycerol; PA, phosphatidate; CDP-DAG, CDP-diacylglycerol. (B) Induction of genes related with myo-inositol biosynthesis by p53. HCT116 p53+/+ and HCT116 p53−/− cells were treated with 2 μg/ml of adriamycin (ADR) for 2 h. mRNAs isolated from these cells were subjected to microarray analysis. Five genes related with inositol phosphate metabolism were shown to be induced by p53. (C) qPCR analysis (upper) and western blotting (lower) of ISYNA1, p53, and WAF1 in HCT116 p53+/+ and HCT116 p53−/− cells at 36 h after treatment with ADR for 2 h. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin were used for the normalization of expression levels. Error bars represent SD (n=3). (D) qPCR analysis (upper) and western blotting (lower) of ISYNA1, p53, and WAF1 in HepG2 cells at 36 h after treatment with ADR for 2 h. GAPDH and β-actin were used for the normalization of expression levels. Error bars represent SD (n=3). (E and F) qPCR analysis of ISYNA1 mRNA in HepG2 (E) or U373MG (F) cells. At 24 h after transfection of each siRNA, HepG2 cells were treated with 2 μg/ml of ADR for 2 h. At 40 h after treatment, cells were harvested for qPCR analysis. U373MG cells were harvested at 36 h after infection with Ad-p53. siEGFP or Ad-LacZ were used as controls. GAPDH was used for the normalization of expression levels. Error bars represent SD (n=3).

To validate the result of cDNA microarray analysis, we performed quantitative real-time PCR (qPCR) analysis and western blotting of ISYNA1 using HCT116 p53+/+ and HCT116 p53−/− cells treated with ADR. As a result, we found dose-dependent induction of ISYNA1 mRNA and protein only in HCT116 p53+/+ cells in response to ADR treatment (Fig. 1C). We also confirmed the induction of ISYNA1 mRNA and protein by ADR treatment in HepG2 (Fig. 1D). Moreover, transfection with siRNA against p53 remarkably inhibited the induction of ISYNA1 (Fig. 1E). p53-mediated induction of ISYNA1 was also observed in U373MG glioblastoma cells that were infected with adenovirus designed to express wild-type p53 (Ad-p53) (Fig. 1F). These results clearly indicated that ISYNA1 was regulated by p53.

Expression and subcellular localization of ISYNA1

There are three major variants of human ISYNA1, namely isoform 1, 2, and 4. All isoforms are similar in domain structure as shown in Fig. 2A. We constructed plasmids expressing each isoform. Result of western blotting indicated that isoform 1 is the major ISYNA1 isoform that was expressed in HCT116 and HepG2 cells treated with ADR (Fig. 2B and C).

Then we performed immunocytochemical analysis using HCT116 p53+/+, HCT116 p53−/− cells, or HepG2 cells (Fig. 2D and E). ADR treatment increased ISYNA1 protein in the cytoplasm and the nucleus of HCT116 p53+/+ and HepG2 cells, but ISYNA1 expression was very low in HCT116 p53−/− cells or HepG2 cells treated with sip53.

Identification of ISYNA1 as a novel p53 target

To investigate whether ISYNA1 is a direct target of p53, we searched for p53 response element (RE) (18) within the ISYNA1 genomic region which is located on chromosome 19p13. We found putative p53 RE in the promoter region (RE1) and the seventh exon (RE2) (Fig. 3A). We subcloned DNA fragments including the RE1 or RE2 into pGL4.24 vector (pGL4.24/RE1 and pGL4.24/RE2) and performed gene reporter assay using U373MG cells. As a result, U373MG cells transfected with pGL4.24/RE1 or pGL4.24/RE2 showed enhanced luciferase activity only in the presence of plasmid expressing wild-type p53 (Fig. 3B). In addition, base substitutions within the RE1 and RE2 (pGL4.24/RE1mt and pGL4.24/RE2mt) completely abolished the enhancement of luciferase activity (Fig. 3B). To investigate whether p53 could directly bind to RE2 which showed higher transcriptional activatity, we performed chromatin immunoprecipitation (ChIP) assay using U373MG cells that were infected with Ad-p53 or Ad-LacZ. qPCR analysis of the immunoprecipitated DNA indicated that the p53 protein bound to the genomic fragment that included the RE2 (Fig. 3C). Taken together, p53 directly regulated ISYNA1 expression through binding to the RE2 in the seventh exon.

Growth suppressive effect of ISYNA1

ISYNA1 is the rate-limiting enzyme of myo-inositol de novo synthesis (7) which is conserved among eukaryotes (1925). To evaluate the biosynthesis of myo-inositol by ISYNA1, we performed myo-inositol (MI) assay using HEK293T cells that were transfected with mock or plasmid expressing mock or ISYNA1 isoform 1 (Fig. 4A). The results showed that intracellular myo-inositol content in cells expressing ISYNA1 isoform 1 was significantly higher than those in control cells. In addition, DNA damage significantly increased intracellular myo-inositol content in HCT116 p53+/+ cells, but did not affect the myo-inositol content in HCT116 p53−/− cells (Fig. 4B). Thus, our results indicated that p53 could regulate intracellular myo-inositol levels in response to DNA damage.

We also evaluated the effect of p53-ISYNA1 pathway on cancer cell growth. The result of colony formation assay using HCT116 and HepG2 cells indicated that ISYNA1 overexpression suppressed cell proliferation (Fig. 4C). We then designed three siRNAs (siA, siB and siC) and found that siRNAs effectively suppressed ISYNA1 mRNA and protein (Fig. 4D). We performed ATP assay using HCT116 p53+/+ cells and found that ISYNA1-silencing caused resistance to ADR treatment (Fig. 4E). These results indicated ISYNA1 is likely to be one of the key mediators of p53 induced growth suppression.

Regulation of ISYNA1 by p53 in vivo

Since ISYNA1 is conserved among eukaryotes, we investigated whether mouse Isyna1 is also regulated by p53. p53 wild-type or p53 knockout mice at 6 weeks of age were irradiated with 10 Gy of X-ray. At 24 h after irradiation, we isolated total RNA from liver tissues. qPCR analysis revealed that mouse Isyna1 mRNA was induced by DNA damage only in p53 wild-type mice (Fig. 5A). Screening of p53 RE within Isyna1 genomic region identified a putative RE (mRE) at ~10 kb upstream of the Isyna1 gene (Fig. 5B). We subcloned a DNA fragment including mRE into the pGL4.24 vector (pGL4.24/mRE) and performed gene reporter assay using U373MG cells (Fig. 5C). Luciferase activity was strongly enhanced by co-transfection with wild-type p53, but not with mutant p53. In addition, base substitutions within mRE diminished the enhancement of luciferase activity, demonstrating regulation of Isyna1 by p53 through mRE.

Figure 5

Regulation of ISYNA1 by p53 in vivo. (A) qPCR analysis of Isyna1 in mouse livers. Mice were divided into four groups; p53 wild-type mice without irradiation (W), p53 wild-type mice with irradiation (WX), p53 knockout mice without irradiation (K), p53 knockout mice with irradiation (KX) (n=6 per group). Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used for the normalization of expression level. Top bar represents maximum observation, lower bar represents minimum observation, the top side of the box represents the third quartile, and the bottom side, the first quartile. The middle bar represents the median value. The P-value was calculated by Student's t-test. (B) Upper, genomic structure of mouse Isyna1. Black boxes indicate the locations and relative sizes of exons. The white box indicates the location of the p53 response element (mRE). Lower, comparison of mRE to the consensus p53RE. R, purine; W, A or T; Y pyrimidine. (C) Luciferase assay of mRE in U373MG with or without mutation of the RE. Luciferase activity is indicated relative to the activity of the mock vectors. The plasmid expressing mouse p53 carrying a missense mutation (R172H) served as a negative control. Error bars represent the SD (n=3). (D) Box plot of ISYNA1 expression in bladder cancer, breast cancer, head and neck squamous cell carcinoma, lung squamous cell carcinoma, and pancreatic adenocarcinoma tissues from the TCGA database. The vertical axis indicates the normalized expression level of ISYNA1, top bar represents maximum observation, lower bar represents minimum observation, the top side of the box represents the third quartile, and the bottom side, the first quartile. The middle bar represents the median value. The P-value was calculated by Student's t-test.

We also analyzed whether p53 regulates ISYNA1 in human cancer tissues. Correlation between p53 mutation and ISYNA1 expression was analyzed by using omics data of various tumor tissues released from the TCGA database (17). Interestingly, ISYNA1 mRNA expression in bladder cancer, breast cancer, head and neck squamous cell carcinoma, lung squamous cell carcinoma, and pancreatic adenocarcinoma was significantly decreased in tumor tissues with p53 mutation compared with those without p53 mutation (Fig. 5D). These findings indicate that p53 regulates ISYNA1 expression in vivo.

Discussion

We identified ISYNA1 as a novel p53 target. ISYNA1 is a key enzyme which affects myo-inositol de novo synthesis (7,26,27). In addition, p53 induced INPP1 and INPP5 (28) that are involved in myo-inositol salvage pathway. Myo-inositol is one of the chemical compounds which is essential for living organisms (29), and myo-inositol depletion affects cell survival and growth (30). Myo-inositol was also reported to suppress tumor growth in vitro and in vivo (3138). Previous studies indicated that myo-inositol suppresses phosphorylation of Akt and Erk by inhibiting PI3K activity (12,13). p53 was also shown to suppress PI3K-Akt pathway by inducing PTEN (39) and Phlda3 (40). Our results suggested a novel mechanism whereby p53 negatively regulates PI3K-Akt pathway by inducing ISYNA1.

Epidemiological studies indicate that myo-inositol prevents progression of dysplasia in smokers (1113), and decreases tumorigenesis in chronic hepatitis patients (33). These findings suggested that p53 would suppress tumorigenesis by inducing biosynthesis of myo-inositol. We also found that ISYNA1 was induced in mouse liver tissue by DNA damage. To evaluate the chemopreventive effect of myo-inositol, we fed p53 knockout mice with myo-inositol in drinking water. However, oral myo-inositol did not suppress tumor development (data not shown). Although, myo-inositol was shown to suppress liver cancer (32,33), liver cancer is relatively rare for p53 knockout mice compared with lymphoma of thymus or spleen (41). In addition, although induction of Isyna1 was observed in liver tissues, Isyna1 was not induced in thymus and spleen (data not shown). Therefore, to evaluate the chemopreventive effect of myo-inositol or ISYNA1 in vivo, liver cancer model would be appropriate.

Taken together, ISYNA1 was shown to be a mediator of p53-dependent growth suppression, and ISYNA1 expression was reduced in several types of cancers with p53 mutations. Therefore, myo-inositol could be a potential anticancer agent for cancer cells with p53 mutation. Our findings revealed a novel role of p53 in myo-inositol biosynthesis which could be a possible therapeutic target.

Acknowledgements

We thank Satomi Takahashi and Misato Oshima for technical assistance. We also thank The Cancer Genome Atlas (TCGA) project and members of the Cancer Genomics Hub (CGHub) for making all TCGA data publicly accessible. This study was supported partially by grant from Japan Society for the Promotion of Science and Ministry of Education, Culture, Sports, Science and Technology of Japan to K.M and C.T., grant from Japan Agency for medical Research and Development to K.M. and C. T., grant from the Ministry of Health, Labour and Welfare, Japan to K.M., and grant in-Aid from the Tokyo Biochemical Research Foundation to K.M.

References

1 

Brady CA and Attardi LD: p53 at a glance. J Cell Sci. 123:2527–2532. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Levine AJ and Oren M: The first 30 years of p53: Growing ever more complex. Nat Rev Cancer. 9:749–758. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Hirao A, Kong YY, Matsuoka S, Wakeham A, Ruland J, Yoshida H, Liu D, Elledge SJ and Mak TW: DNA damage-induced activation of p53 by the checkpoint kinase Chk2. Science. 287:1824–1827. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Bensaad K, Tsuruta A, Selak MA, Vidal MN, Nakano K, Bartrons R, Gottlieb E and Vousden KH: TIGAR, a p53-inducible regulator of glycolysis and apoptosis. Cell. 126:107–120. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Hu W, Zhang C, Wu R, Sun Y, Levine A and Feng Z: Glutaminase 2, a novel p53 target gene regulating energy metabolism and antioxidant function. Proc Natl Acad Sci USA. 107:7455–7460. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Kenzelmann Broz D, Spano Mello S, Bieging KT, Jiang D, Dusek RL, Brady CA, Sidow A and Attardi LD: Global genomic profiling reveals an extensive p53-regulated autophagy program contributing to key p53 responses. Genes Dev. 27:1016–1031. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Ju S, Shaltiel G, Shamir A, Agam G and Greenberg ML: Human 1-D-myo-inositol-3-phosphate synthase is functional in yeast. J Biol Chem. 279:21759–21765. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Croze ML and Soulage CO: Potential role and therapeutic interests of myo-inositol in metabolic diseases. Biochimie. 95:1811–1827. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Maeba R, Hara H, Ishikawa H, Hayashi S, Yoshimura N, Kusano J, Takeoka Y, Yasuda D, Okazaki T, Kinoshita M, et al: Myo-inositol treatment increases serum plasmalogens and decreases small dense LDL, particularly in hyperlipidemic subjects with metabolic syndrome. J Nutr Sci Vitaminol (Tokyo). 54:196–202. 2008. View Article : Google Scholar

10 

Mukai T, Kishi T, Matsuda Y and Iwata N: A meta-analysis of inositol for depression and anxiety disorders. Hum Psychopharmacol. 29:55–63. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Lam S, McWilliams A, LeRiche J, MacAulay C, Wattenberg L and Szabo E: A phase I study of myo-inositol for lung cancer chemoprevention. Cancer Epidemiol Biomarkers Prev. 15:1526–1531. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Han W, Gills JJ, Memmott RM, Lam S and Dennis PA: The chemopreventive agent myoinositol inhibits Akt and extracellular signal-regulated kinase in bronchial lesions from heavy smokers. Cancer Prev Res (Phila). 2:370–376. 2009. View Article : Google Scholar

13 

Gustafson AM, Soldi R, Anderlind C, Scholand MB, Qian J, Zhang X, Cooper K, Walker D, McWilliams A, Liu G, et al: Airway PI3K pathway activation is an early and reversible event in lung cancer development. Sci Transl Med. 2:26ra252010.PubMed/NCBI

14 

Oda K, Arakawa H, Tanaka T, Matsuda K, Tanikawa C, Mori T, Nishimori H, Tamai K, Tokino T, Nakamura Y, et al: p53AIP1, a potential mediator of p53-dependent apoptosis, and its regulation by Ser-46-phosphorylated p53. Cell. 102:849–862. 2000. View Article : Google Scholar : PubMed/NCBI

15 

Tanikawa C, Matsuda K, Fukuda S, Nakamura Y and Arakawa H: p53RDL1 regulates p53-dependent apoptosis. Nat Cell Biol. 5:216–223. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Tsukada T, Tomooka Y, Takai S, Ueda Y, Nishikawa S, Yagi T, Tokunaga T, Takeda N, Suda Y, Abe S, et al: Enhanced proliferative potential in culture of cells from p53-deficient mice. Oncogene. 8:3313–3322. 1993.PubMed/NCBI

17 

Taura M, Eguma A, Suico MA, Shuto T, Koga T, Komatsu K, Komune T, Sato T, Saya H, Li JD, et al: p53 regulates Toll-like receptor 3 expression and function in human epithelial cell lines. Mol Cell Biol. 28:6557–6567. 2008. View Article : Google Scholar : PubMed/NCBI

18 

el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW and Vogelstein B: Definition of a consensus binding site for p53. Nat Genet. 1:45–49. 1992. View Article : Google Scholar : PubMed/NCBI

19 

Michell RH: Inositol derivatives: Evolution and functions. Nat Rev Mol Cell Biol. 9:151–161. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Seelan RS, Lakshmanan J, Casanova MF and Parthasarathy RN: Identification of myo-inositol-3-phosphate synthase isoforms: Characterization, expression, and putative role of a 16-kDa gamma(c) isoform. J Biol Chem. 284:9443–9457. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Konarzewska P, Esposito M and Shen CH: INO1 induction requires chromatin remodelers Ino80p and Snf2p but not the histone acetylases. Biochem Biophys Res Commun. 418:483–488. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Valluru R and Van den Ende W: Myo-inositol and beyond - emerging networks under stress. Plant Sci. 181:387–400. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Deranieh RM, He Q, Caruso JA and Greenberg ML: Phosphorylation regulates myo-inositol-3-phosphate synthase: A novel regulatory mechanism of inositol biosynthesis. J Biol Chem. 288:26822–26833. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Parthasarathy RN, Lakshmanan J, Thangavel M, Seelan RS, Stagner JI, Janckila AJ, Vadnal RE, Casanova MF and Parthasarathy LK: Rat brain myo-inositol 3-phosphate synthase is a phosphoprotein. Mol Cell Biochem. 378:83–89. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Henry SA, Gaspar ML and Jesch SA: The response to inositol: Regulation of glycerolipid metabolism and stress response signaling in yeast. Chem Phys Lipids. 180:23–43. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Guan G, Dai P and Shechter I: cDNA cloning and gene expression analysis of human myo-inositol 1-phosphate synthase. Arch Biochem Biophys. 417:251–259. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Chauvin TR and Griswold MD: Characterization of the expression and regulation of genes necessary for myo-inositol biosynthesis and transport in the seminiferous epithelium. Biol Reprod. 70:744–751. 2004. View Article : Google Scholar

28 

Ye Y, Jin L, Wilmott JS, Hu WL, Yosufi B, Thorne RF, Liu T, Rizos H, Yan XG, Dong L, et al: PI(4,5)P2 5-phosphatase A regulates PI3K/Akt signalling and has a tumour suppressive role in human melanoma. Nat Commun. 4:15082013. View Article : Google Scholar : PubMed/NCBI

29 

Ohnishi T, Murata T, Watanabe A, Hida A, Ohba H, Iwayama Y, Mishima K, Gondo Y and Yoshikawa T: Defective craniofacial development and brain function in a mouse model for depletion of intracellular inositol synthesis. J Biol Chem. 289:10785–10796. 2014. View Article : Google Scholar : PubMed/NCBI

30 

Eagle H, Oyama VI, Levy M and Freeman AE: Myo-inositol as an essential growth factor for normal and malignant human cells in tissue culture. J Biol Chem. 226:191–205. 1957.PubMed/NCBI

31 

Hecht SS, Upadhyaya P, Wang M, Bliss RL, McIntee EJ and Kenney PM: Inhibition of lung tumorigenesis in A/J mice by N-acetyl-S-(N-2-phenethylthiocarbamoyl)-L-cysteine and myo-inositol, individually and in combination. Carcinogenesis. 23:1455–1461. 2002. View Article : Google Scholar : PubMed/NCBI

32 

Lee HJ, Lee SA and Choi H: Dietary administration of inositol and/or inositol-6-phosphate prevents chemically-induced rat hepatocarcinogenesis. Asian Pac J Cancer Prev. 6:41–47. 2005.PubMed/NCBI

33 

Nishino H: Phytochemicals in hepatocellular cancer prevention. Nutr Cancer. 61:789–791. 2009. View Article : Google Scholar

34 

Vucenik I and Shamsuddin AM: Protection against cancer by dietary IP6 and inositol. Nutr Cancer. 55:109–125. 2006. View Article : Google Scholar : PubMed/NCBI

35 

Wattenberg LW and Estensen RD: Chemopreventive effects of myo-inositol and dexamethasone on benzo[a]pyrene and 4-(methyl-nitrosoamino)-1-(3-pyridyl)-1-butanone-induced pulmonary carcinogenesis in female A/J mice. Cancer Res. 56:5132–5135. 1996.PubMed/NCBI

36 

Witschi H, Espiritu I and Uyeminami D: Chemoprevention of tobacco smoke-induced lung tumors in A/J strain mice with dietary myo-inositol and dexamethasone. Carcinogenesis. 20:1375–1378. 1999. View Article : Google Scholar : PubMed/NCBI

37 

Kassie F, Kalscheuer S, Matise I, Ma L, Melkamu T, Upadhyaya P and Hecht SS: Inhibition of vinyl carbamate-induced pulmonary adenocarcinoma by indole-3-carbinol and myo-inositol in A/J mice. Carcinogenesis. 31:239–245. 2010. View Article : Google Scholar :

38 

Kassie F, Matise I, Negia M, Lahti D, Pan Y, Scherber R, Upadhyaya P and Hecht SS: Combinations of N-Acetyl-S-(N-2-Phenethylthiocarbamoyl)-L-Cysteine and myo-inositol inhibit tobacco carcinogen-induced lung adenocarcinoma in mice. Cancer Prev Res (Phila). 1:285–297. 2008. View Article : Google Scholar

39 

Memmott RM and Dennis PA: The role of the Akt/mTOR pathway in tobacco carcinogen-induced lung tumorigenesis. Clin Cancer Res. 16:4–10. 2010. View Article : Google Scholar :

40 

Kawase T, Ohki R, Shibata T, Tsutsumi S, Kamimura N, Inazawa J, Ohta T, Ichikawa H, Aburatani H, Tashiro F, et al: PH domain-only protein PHLDA3 is a p53-regulated repressor of Akt. Cell. 136:535–550. 2009. View Article : Google Scholar : PubMed/NCBI

41 

Jacks T, Remington L, Williams BO, Schmitt EM, Halachmi S, Bronson RT and Weinberg RA: Tumor spectrum analysis in p53-mutant mice. Curr Biol. 4:1–7. 1994. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

June-2016
Volume 48 Issue 6

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Koguchi T, Tanikawa C, Mori J, Kojima Y and Matsuda K: Regulation of myo-inositol biosynthesis by p53-ISYNA1 pathway. Int J Oncol 48: 2415-2424, 2016.
APA
Koguchi, T., Tanikawa, C., Mori, J., Kojima, Y., & Matsuda, K. (2016). Regulation of myo-inositol biosynthesis by p53-ISYNA1 pathway. International Journal of Oncology, 48, 2415-2424. https://doi.org/10.3892/ijo.2016.3456
MLA
Koguchi, T., Tanikawa, C., Mori, J., Kojima, Y., Matsuda, K."Regulation of myo-inositol biosynthesis by p53-ISYNA1 pathway". International Journal of Oncology 48.6 (2016): 2415-2424.
Chicago
Koguchi, T., Tanikawa, C., Mori, J., Kojima, Y., Matsuda, K."Regulation of myo-inositol biosynthesis by p53-ISYNA1 pathway". International Journal of Oncology 48, no. 6 (2016): 2415-2424. https://doi.org/10.3892/ijo.2016.3456