Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
September-2019 Volume 55 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2019 Volume 55 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Review

Regulation of GKN1 expression in gastric carcinogenesis: A problem to resolve (Review)

  • Authors:
    • Judit Alarcón‑Millán
    • Dinorah Nashely Martínez‑Carrillo
    • Oscar Peralta‑Zaragoza
    • Gloria Fernández‑Tilapa
  • View Affiliations / Copyright

    Affiliations: Clinical Research Laboratory, Faculty of Biological Chemical Sciences, Guerrero Autonomous University, Chilpancingo, Guerrero 39070, México, Direction of Chronic Infections and Cancer, Research Center in Infection Diseases, National Institute of Public Health, Cuernavaca, Morelos 62100, México
  • Pages: 555-569
    |
    Published online on: July 16, 2019
       https://doi.org/10.3892/ijo.2019.4843
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Gastrokine 1 (GKN1) is a protein expressed on the surface mucosa cells of the gastric antrum and fundus, which contributes to maintaining gastric homeostasis, inhibits inflammation and is a tumor suppressor. The expression of GKN1 decreases in mucosa that are either inflamed or infected by Helicobacter pylori, and is absent in gastric cancer. The measurement of circulating GKN1 concentration, the protein itself, or the mRNA in gastric tissue may be of use for the early diagnosis of cancer. The mechanisms that modulate the deregulation or silencing of GKN1 expression have not been completely described. The modification of histones, methylation of the GKN1 promoter, or proteasomal degradation of the protein have been detected in some patients; however, these mechanisms do not completely explain the absence of GKN1 or the reduction in GKN1 levels. Only NKX6.3 transcription factor has been shown to be a positive modulator of GKN1 transcription, although others also have an affinity with sequences in the promoter of this gene. While microRNAs (miRNAs) are able to directly or indirectly regulate the expression of genes at the post‑transcriptional level, the involvement of miRNAs in the regulation of GKN1 has not been reported. The present review analyzes the information reported on the determination of GKN1 expression and the regulation of its expression at the transcriptional, post‑transcriptional and post‑translational levels; it proposes an integrated model that incorporates the regulation of GKN1 expression via transcription factors and miRNAs in H. pylori infection.

1. Introduction

The gastric epithelium is continually renewed over a lifetime, and is maintained through the proliferation and differentiation of pluripotent stem cells from the isthmus of the gastric gland (1). Stem cells generate precursors that migrate to the gastric lumen and, in turn, generate parietal, gastric zymogenic and foveolar cells. Parietal cells produce hydrochloric acid, while gastric zymogenic cells have a half-life of ~6 months and synthesize trefoil factor 2 and mucin 6 (1-3). Foveolar cells or surface mucous cells (SMCs), whose half-life is 2-3 days, produce mucous granules, mucin 5AC, gastrokine 1 (GKN1) and trefoil factor 1 (1-3) and play an important role in the restitution of the gastric mucosa in the event of Helicobacter pylori infection (4). The integrity and continuity of the gastric epithelium are rapidly restored after damage, prior to cell proliferation (5). Epithelial restitution is achieved through the migration of epithelial cells from the adjacent area or the cell stratum below the surface cells in the injured area. Epithelial cell restitution in the stomach of mammals takes place in minutes (5).

GKN1 is a protein secreted by SMCs of the gastric antrum and fundus (6), which contributes to maintaining gastric homeostasis, inhibits inflammation and acts as a tumor suppressor (7-16). The expression of GKN1 decreases due to H. pylori infection, inflammation or atrophy, and is absent in gastric cancer (17-25).

Although methylation of the GKN1 promoter (20), modification of histones (26) and proteasomal degradation of GKN1 in some cases (27) have been reported, the mechanisms that cause a decrease in GKN1 levels or its absence entirely have not been completely described. A total of ~10% of gastric tumors contain the Epstein-Barr virus (EBV), while the Epstein-Barr nuclear antigen 1 (EBNA1) binds to the promoter region of the GKN1 gene and induces the reduction of its transcription (28,29).

Epigenetic modifications are as important to the regulation of gene expression and the initial stages of disease as genetic modifications. Differential changes have been documented in the expression profile of microRNAs (miRNAs) in gastritis or cancer patients infected with H. pylori (17,30-33), gastric cancer cell lines (34-36), CD4 T lymphocytes, macrophages, monocytes and dendritic cells (37-39). It has been proposed that some components of H. pylori induce the activation of signals that modify the expression of miRNAs in the host cells, and that changes in the global expression profile of miRNAs are related to the genotype of the bacteria (31).

The reduction of GKN1 cannot be explained by mutations in its gene, the methylation of its promoter or the protea-somal degradation of the protein (20,26,27). It is probable that some miRNAs modulate the decreased translation of GKN1 mRNA and, consequently, the reduction of the level of protein in the gastric mucosa. The role of miRNAs in the regulation of GKN1 expression in the normal gastric mucosa, or mucosa infected with H. pylori, affected by preneoplasic lesions or with gastric cancer, has not been explored. The present review comprises an analysis of the information published on the regulation of GKN1 expression, proposing a model that integrates the probable regulatory mechanisms at the transcriptional, post-transcriptional and translational levels.

2. GKN1

GKN1 (also known as CA11, AMP-18, foveolin or TFIZ2) is a small protein of 181-184 amino acids, specifically expressed in the stomach. The GKN1 gene is located on chromosome 2p13.3 and is composed of six exons separated by relatively short introns (6). GKN1 is composed of: i) A hydrophobic signal peptide in the extreme NH2-terminal, whose processing generates a protein of 160 amino acids with a molecular mass of 18 kDa; ii) a BRICHOS domain with three conserved amino acid residues, one aspartic acid residue and two cysteine acid residues; and iii) a COOH-terminal domain (6,19,40-43). GKN1 is a member of the BRICHOS superfamily of proteins, which includes proteins associated with the development of cancer. It is a protein with both an autocrine and paracrine function, which promotes the healing of the mucosa and facilitates cellular restitution and proliferation (43). GKN1 modulates the progression of the cell cycle, cellular proliferation and viability, and apoptosis.

Additionally, GKN1 regulates the production of reactive oxygen species (ROS) and the PI3K/Akt signaling pathway, thus influencing epithelial mesenchymal transition (EMT) and the migration of cancerous cells. GKN1 significantly inhibits the expression of the mRNA of DNA (cytosine-5)-methyltransferase 1 (DNMT1) and histone-lysine N-methyltransferase EZH2 (EZH2) and the activity of DNMT1, functions that link this protein to the inhibition and progression of cancer (43,44).

In the normal gastric mucosa, GKN1 is expressed by epithelial cells on the surface, but not at the depth of the glands of the gastric mucosa (21,45,46). GKN1 reduces the expression of the gastrin receptor, gastrin/cholecystokinin type B receptor, thus inhibiting the cell proliferation induced by this hormone (13). GKN1 activates the p16/Rb and p21 signaling pathways, inhibits cell growth and drives cells to senescence (46). GKN1 modulates the expression of cytokines and other inflammatory mediators associated with gastric carcinogenesis, inducing the increased expression of interleukin (IL)-8 and IL-17 and the decreased expression of nuclear factor (NF)-κB, IL-6 and IL-10. Thus, it regulates the immune response and inhibits the progression of epithelial gastric cells to cancerous cells. GKN1 suppresses the activation of NF-κB, and thus inhibits the onco-genic signaling regulated by this transcription factor (9).

3. GKN1, H. pylori infection and gastric cancer

GKN1 and H. pylori infection. Infection with H. pylori cagA+ strains increases the risk of gastric cancer and is related to the reduced expression of GKN1 in the mucosa (47). In mice infected with H. pylori-cagA+, the increased expression of the antiapoptotic proteins Bcl-2, Bcl-XL and induced myeloid leukemia cell differentiation protein Mcl-1, as well as NF-κB and proteins related to EMT, is found, while the expression of p53, p21, p16 and stress response genes decreases (48). The ectopic expression of GKN1 suppresses the effects of H. pylori-cagA+ in the human gastric cancer cell lines AGS, MKN1 and MKN28. Based on these findings, it has been suggested that GKN1 suppresses the malignant transformation of gastric epithelial cells and the progression to gastric cancer (48).

The expression of GKN1 decreases at the mRNA and protein levels in dyspeptic patients and is not detected in the mucosa of subjects with intestinal-type gastric cancer, both with and without H. pylori infection (19,20,21,22,30,49-52), or with a diffuse-type cancer (19,23,25).

GKN1 and gastric cancer

GKN1 is absent in human gastric tumors and acts as a tumor suppressor, regulating cell proliferation, apoptosis, migration and invasion in gastric cancer cell lines (10). Stimulating the expression of Fas receptor and the activation of caspase-3, this protein modulates apoptotic signals, playing an important role in the repair of tissues during the early stages of neoplastic transformation (7).

In AGS, MKN-1 and MKN-28 gastric cancer cell lines transfected with GKN1, the re-expression of p16 and a reduction in CDK4, cyclin D1 and E2F levels was observed (8) In gastric cancer SGC7901 cells, GKN1 reduces the expression of MMP2, through the deactivation of NF-κB (15), and induces the expression of miRNA (miR)-185. The extreme 3′ untranslated region (UTR) of RhoA mRNA has sequences with affinity to miR-185 and, when this hybrid miRNA with RhoA mRNA reduces its translation, the silencing of RhoA is indirectly mediated by GKN1. c-Myc is a transcription factor that activates RhoA expression and is a target of miR-34a, a miRNA whose expression is promoted by GKN1. Thus, GKN1 also deactivates RhoA via miR-34a. These data suggest that GKN1 inhibits cell motility and invasion by means of the deactivation of RhoA (16).

4. GKN1 as a potential biomarker of gastric carcinogenesis

In ~80% of gastric cancer cases, symptoms are scarce and non-specific at the early stages of the disease, with the majority of patients diagnosed at an advanced stage with metastasis already occurring (44,53). Thus, the treatment of this malignancy is ineffective and the prognosis for patients is unfavorable. Due to the late diagnosis and consequent limited therapy options for most patients, the 5-year survival rate is <20% (54). The lack of criteria and useful markers for early diagnosis has led to studies being conducted on the expression of genes associated with gastric carcinogenesis, with the objective of identifying biomarkers characteristic of premature stages of the disease. GKN1 is one of the proteins considered to be potential biomarker of carcinogenesis.

There are few reports in the available literature on the identification of GKN1 in samples taken from patients. Nardone et al (17) identified the presence of GKN1 in human gastric tissue, finding that its expression decreases in the event of H. pylori infection, deteriorates progressively from chronic gastritis to atrophic gastritis, and is not detected in areas in which intestinal metaplasia or H. pylori-positive tumors are found (17). GKN1 is absent in cases of gastric cancer without H. pylori infection (17-25). Villano et al (55) analyzed the level of GKN1 mRNA in serum taken from patients with gastric cancer and apparently healthy volunteers, finding no statistically significant differences between patients with cancer and healthy volunteers. The aforementioned results indicate that GKN1 mRNA is not a useful biomarker for the diagnosis of gastric cancer (55). Yoon et al (56) found that the serum levels of GKN1 are significantly lower in gastric cancer patients than in either apparently healthy subjects or patients with hepatocel-lular and colorectal carcinoma (P<0.0001). These data suggest that the serum levels of GKN1 may be used for the differentiation of patients with gastric cancer from those with other malignancies of the digestive system and clinically healthy subjects. The authors concluded that the serum concentration of GKN1 may be an informative diagnostic biomarker for gastric cancer (56). Dokhaee et al (44) reported that GKN1 mRNA is significantly reduced in the gastric tissue of patients with gastric cancer, compared to normal tissue. The results led to the hypothesis that GKN1 may be a reliable biomarker for the detection of gastric cancer in its early stages.

The aforementioned data indicate that the measurement of circulating GKN1 concentration, the protein or the mRNA in gastric tissue may be of utility for the early diagnosis of cancer. However, it is necessary to strengthen these findings with more research in patients with preneoplasic lesions (atrophic gastritis, intestinal metaplasia and dysplasia) and cancer in distinct stages of evolution.

5. Regulation of GKN1 expression in mucosa infected with H. pylori or with gastric cancer

At the chromosomal level, cytogenetic aberrations, such as duplications, translocations, deletions or the loss of heterozygosity in the 2p13 chromosome (in which the GKN1 gene is found) have not been detected (57,58).

The sequence of the GKN1 gene was analyzed in 81 gastric tumors and 40 adenomas, confirming a lack of mutations (20) These data suggested that the reduction of GKN1 cannot be attributed to cytogenetic aberrations or mutations, and that other mechanisms are involved in the deregulation of this protein.

Gene expression is regulated at different levels, from transcription to translation (59). At the transcriptional level, regulation occurs via epigenetic modifications, such as the modification of histones and the methylation of DNA (60,61). At the post-transcriptional level, the role of small RNAs (miRNAs) in the modulation of translation should be taken into account (62), while at post-translational level, ubiquitination, followed by the proteasomal degradation of the marked protein, is the best-known mechanism involved in the reduction in cytoplasmic levels of proteins (61).

Transcription factors

Transcription factors are able to activate or repress the expression of a gene (63,64). Little is known about the transcriptional regulation of GKN1. Yoon et al (65), using luciferase and chromatin immunoprecipitation assays, confirmed that NKX6.3 is a transcription factor for GKN1, and located the recognition sequence corresponding to NKX6.3 in the promoter region of the GKN1 gene (Fig. 1A). NKX6.3 positively modulates the transcription of GKN1, which is reflected in the increased level of both mRNA and protein (65).

Figure 1

Regulation of GKN1 expression. (A) NKX6.3 is the only transcription factor validated as a positive regulator of GKN1 transcription. It is likely that another transcription factor or factors act as activators or repressors of GKN1 transcription during the infection of the gastric epithelium by H. pylori. Evidence indicates that H. pylori activates different signaling pathways that induce the expression of various transcription factors. The decrease in or loss of GKN1 expression in gastric cancer may be a consequence of: (B) GKN1 promoter methylation; (C) EBNA1 binding to the transcriptional complex; or (D) histone modification, such as trimethylation of lysine 9 in histone 3. Additionally, it is possible that the GKN1 mRNA is targeted by some miRNAs. By in silico analysis, miRNAs were found with sequences complementary to sites located in the 3' untranslated region of GKN1 mRNA, and are likely to contribute to its negative post-transcriptional regulation through: (E) Inhibition of translation; or (F) mRNA degradation. The expression of the proposed miRNAs may or not be induced by H. pylori. GKN1 is degraded in the cytoplasm of epithelial cells when (G) the ubiquitin ligase UBR5 marks GKN1 for its degradation in the proteasome. These and other mechanisms can act synergistically to promote the diminution or silencing of GKN1 expression, manifesting as a decreased or absent mRNA and protein expression in gastric tissue or in the circulation. Figure created using BioRender. com. TFs, transcription factors; GKN1, gastrokine 1; UBR5, E3 ubiquitin-protein ligase UBR5; EBNA1, Epstein Barr nuclear antigen 1; EBV, Epstein Barr virus; RISC, RNA-induced silencing complex; H. pylori, Helicobacter pylori; miRNA, microRNA; Ub, ubiquitin; NF-κB, nuclear factor-κB; TSS, transcriptional start site.

By means of in silico analysis, conducted using the MatInspector (66) (http://www.genomatix.de/matinspector.html), AliBaba2.1 (67) (http://gene-regulation.com/pub/programs/alibaba2/index.html) and TfsiteScan 68) (http://www.ifti.org) programs, transcription factors were identified with affinity to recognition sequences in the GKN1 promoter region (Fig. 2A and Table I). It is likely that one or more of these transcription factors, predicted bioinformatically, are involved in the transcriptional regulation of GKN1. Experimental confirmation of the effect exerted by the proposed transcription factors on the modulation of GKN1 expression will improve understanding of the mechanisms involved in the regulation of the expression of this protein.

Figure 2

Transcription factors and miRNAs predicted in silico as regulators of GKN1 expression. By in silico analysis (A) transcription factors were identified with affinity to recognition sequences in the GKN1 promotor region and (B) miRNAs were found with sequences complementary to sites located in the 3'UTR of GKN1 mRNA. It is likely that the transcription factors act as activators or repressors of the transcriptional regulation of GKN1, and the miRNAs contribute to post-transcriptional regulation, inhibiting translation or inducing mRNA degradation. Figure created using BioRender.com TSS, transcriptional start site; UTR, untranslated region; miRNA/miR, microRNA; GKN1, gastrokine 1; GATA3, T-cell-specific transcription factor GATA-3; NFAT, nuclear factor of activated T cells; CEBPα, CCAAT enhancer binding protein-α; AP-1, AP-1 transcription factor; Sp1, transcription factor Sp1; CREB, cyclic AMP-responsive element-binding protein 3-like protein 4.

Table I

Transcription factors with affinity to binding sequences in the gastrokine 1 gene promoter region.

Table I

Transcription factors with affinity to binding sequences in the gastrokine 1 gene promoter region.

Transcription factorNumber of binding sitesBinding sequenceGenomic position of binding sequencea
GATA-37CAGAGATAAAATG 68974044-68974056
CEBPα7 GAAATTGAGGAAGGT 68974539-68974553
Oct-16 GTCATGCAATTGATC 68973972-68973986
AP-14TGATGAGTCAGGT 68974444-68974456
STAT-33 AGGTTTCCTGGTACACTGG 68974502-68974520
Sp12 GCTGTGGGCGTGAGTAT 68974361-68974377
STAT-11 AGTGTACCAGGAAACCTTT 68974500-68974518
CREB1 AGGGTCCTATGTAATAAGATT 68973801-68973821
NFAT1 CTTTGGAAATCTTATTACA 68973794-68973812

a Data obtained from MatInspector. GATA-3, T-cell-specific transcription factor GATA-3; CEBPα, CCAAT enhancer binding protein-α; AP1-1, AP-1 transcription factor; Sp1, transcription factor Sp1; CREB, cyclic AMP-responsive element-binding protein 3-like protein 4 NFAT, nuclear factor of activated T cells.

In patients with gastric pathology, in murine models or in gastric epithelial cell lines, the expression of trans-acting T-cell-specific transcription factor GATA-3 (GATA-3), STAT-1, STAT-3, transcription factor Sp1 (Sp1), cyclic AMP-responsive element-binding protein 3-like protein 4 (CREB), AP-1 transcription factor (AP-1) and Oct-1 increases, while the levels of CCAAT enhancer binding protein-α (CEBPα) and NKX6.3 decrease (65,69-82). The expression of GATA-3 was found to have increased at different stages of the carcinogenesis associated with H. pylori in patient biopsies, murine models and human gastric epithelial cells (73,74).

CagA and OipA of H. pylori induce the activation of transcription factors such as AP-1, NF-κB, STAT-3, CREB and nuclear factor of activated T cells (NFAT), which favor the expression of IL-6, and cytokines, which promote inflammation (83-89). IL-6 stimulates the activation of the signaling pathway gp130/STAT3 in gastric cancer cell lines (90), while CagA stimulates the expression of the NFAT transcription factor in AGS cells (88).

The protein Tipα, produced by H. pylori, activates the IL-6/STAT3 pathway (89). H. pylori cagA+ strains induce signaling through the MAPK pathway, thus increasing proliferation and activating transcription factors such as AP-1 (70). Through toll like receptor (TLR)2 and TLR9, H. pylori activates the MAPK pathway and, downstream, the factors AP-1 and CREB, which positively regulate the transcription of cyclooxygenase 2 (COX-2) (91). CREB and STAT-3 are activated by H. pylori and positively regulate the transcription of COX-2 in gastric epithelial cells (72,83). Increased STAT-3 expression has been found in biopsies of the gastric mucosa infected with H. pylori cagA+ (80), as well as in cell lines and murine models (86). CagA promotes the phosphorylation of STAT-3 in gastric epithelial cells (92).

In vitro and in vivo experiments have shown that the protein OipA of H. pylori stimulates the phosphorylation of STAT-1 (93) and that H. pylori alters the STAT-1 signaling induced by IFN-γ in gastric epithelial cells. This event may represent an adaptation of the bacteria in order to modulate the immune response of the host mucosa, allowing the bacteria to survive in the stomach (94).

The expression level of the Sp1 transcription factor increases in gastric adenocarcinoma and is related to the cancer stage, the depth of infiltration and an unfavorable prognosis for patients (82). The expression of Sp1 differs between intestinal-type and diffuse-type cancer, while low-level expression of Sp1 is related to the progression and metastasis of intestinal-type cancer, in contrast to diffuse-type cancer (95). Sp1 is essential in the regulation of genes that determine the characteristics of cancer (96). In AGS cells, the ERK1/2 signaling pathway, activated in response to H. pylori infection, in turn activates Sp1, which modulates the transcription of vascular endothelial growth factor-A (69). It is probable that the factors AP-1, Oct-1, STAT-1, STAT-3, GATA-3, Sp1, CREB and NFAT, with recognition sequences in the GKN1 promotor and being activated by H. pylori, repress the transcription of GKN1 in infected mucosa or mucosa with gastric cancer.

In normal gastric mucosa, CEBPα is expressed in the foveolar epithelium and is reduced in the tumor tissue of patients with gastric cancer (79), and in the cell lines MKN45 and MKN74 (97). The ectopic expression of CEBPα in gastric cancer cell lines reduces cell viability (97). The level of CEBPα expression gradually decreases in line with the advancing carcinogenesis associated with H. pylori infection (73). Given the function of CEBPα in the regulation of the viability of cancerous cells and the fact that GKN1 and CEBPα levels gradually decrease in line with the progress of the lesion, it is probable that this factor is an activator of GKN1 transcription. The reduced expression of CEBPα and NKX6.3 in gastric cancer may be due to the negative regulation mediated by microRNAs.

DNA methylation

Changes in the methylation of DNA lead to changes in gene expression. The hypermethylation of CpG islands located in the promoter region of a gene results in the decrease or silencing of the expression of the gene.

The methylation of the GKN1 promoter was previously studied, finding hypermethylation in the CpG islands of the promoter region in only two of 25 gastric tumors. This evidence indicates that the low or null GKN1 expression in the inflamed tissue, either tumoral or infected by H. pylori, is not due to the methylation of its promoter in all cases (Fig. 1B) (20).

The protein EBNA1 of EBV is able to bind to the promoter region of various genes of the host (28). It has been found to have an affinity with the sequences contained in the GKN1 promoter and, binding at these sites, contributes to the deregulation of GKN1 in gastric cancer associated with Epstein-Barr infection (Fig. 1C) (29). Only a small proportion of gastric tumors contain EBV.

Histone modification

The modification of histones is an epigenetic mechanism influencing gene expression. Altieri et al (26) analyzed six gastric tumors in order to determine whether histone modification contributes to GKN1 regulation. Chromatin immunoprecipitation assays were conducted on a fragment of 600 pb of the GKN1 gene promoter, including the 5′UTR, finding trimethylation in lysine 9 of histone 3 (H3K9triMe), among bases -148 and -310 of the GKN1 gene promoter in the six gastric tumors. H3K9triMe is a gene repression marker that generates binding sites for histone deacetylase I (HDAC1) (98) (Fig. 1D). The inhibition of HDAC1 activity with trichostatin A, a hypomethylating agent, is related to increased GKN1 mRNA levels but not to the protein itself. These findings suggest that the regulation of GKN1 may occur at the post-transcriptional level via miRNAs (26).

miRNAs

In the gastric mucosa, miRNAs can be expressed by epithelial cells, infiltrating inflammatory cells, transformed cells or cancerous cells (31). In the regulation of gene expression, miRNAs inhibit the translation or induce the degradation of target transcripts. It is likely that some miRNAs impede the translation of GKN1 mRNA and, consequently, are responsible for the reduction in the protein level, although there are no reports indicating whether a miRNA is involved in the regulation of GKN1 expression to the best of our knowledge.

In order to explore whether GKN1 mRNA has binding sites for one or more miRNAs, an in silico analysis was conducted using programs for predicting miRNA targets: TargetScan (99) (2015, http://www.targetscan.org), miRanda (100) (http://www.microrna.org), miRDB (101) (http://mirdb.org), miRSystem (102) (http://mirsystem.cgm.ntu.edu.tw/index.php) and DianaTools (103) (http://www.microrna.gr/microT-CDS), based on thermodynamic and base complementarity analysis. miRNAs were found with sequences complementary to sites located in the 3′UTR region of GKN1 mRNA (Fig. 2B), four of which are able to hybridize with canonical sites of GKN1 mRNA and possess two or three guanine or cytosine residues in the seed region of the miRNA, conferring them greater binding stability. An adenine in position 1 of the 3′UTR region of GKN1 mRNA ensures the recognition of the transcript by the RNA-induced silencing complex. These characteristics increase the probability that a miRNA will interact with the 3′UTR of GKN1 mRNA (Table II).

Table II

miRNAs proposed as a candidate to regulate GKN1 expression.

Table II

miRNAs proposed as a candidate to regulate GKN1 expression.

miRNAa3'UTR GKN1bmiRNA recognition siteSite type
hsa46-53GKN1 5′ucugaauaugcugUGCAGAAA8mer
miR-544amiRNA 3′uugaacgauuuuuACGUCUUA
hsa70-77GKN1 5′uaugggcuccaguGGUUUUUA8mer
miR-548d-3pmiRNA 3′guuuucauugauaCCAAAAAC
hsa30-37GKN1 5′acuauggauuuagUCAUCUGA8mer
miR-1245b-3pmiRNA 3′uauccggaaaucuAGUAGACU
hsa33-40GKN1 5′auggauuuagucaUCUGAAUA8mer
miR-892c-5pmiRNA 3′acugaccguggaaAGACUUAU

a Programs used for predicting miRNA targets: TargetScan7.1, miRanda, miRDB, miRSystem and DianaTools. Capital letters indicate the seed region of each miRNA. The complementary sequences to the canonical sites in GKN1 mRNA are in bold.

b Position in which the complementary sequences to the miRNA are found. miRNA/miR, microRNA; GKN1, gastrokine 1.

Multiple prediction programs may be used to locate binding sites for miRNAs in gene transcripts. The results of the analysis facilitated the selection of miRNAs with a higher probability of binding to their target, miR-544a was predicted by five programs, according to the aforementioned criteria. It is highly probable that miR-544a is a regulator of GKN1 (104,105). This proposal is strengthened by experimental data on the expression of miR-544a, which is found at increased levels in gastric cancer cell lines (106). To the best of our knowledge, research has not been conducted on the expression of hsa-miR-1245b-3p, hsa-miR-892c-5p and hsa-miR-548d-3p in the gastric mucosa, be that infected, inflamed, atrophic or with gastric cancer. However, the results of the in silico analysis suggested a high probability that these miRNAs regulate the expression of GKN1, either inhibiting the translation of the transcript or promoting its degradation (Fig. 1E and F).

Currently, >5,000 miRNAs are registered on miRBase, while in silico predictions estimate that more than one-third of the human transcriptome can be regulated by miRNAs. In gastric cancer, inflammatory processes and H. pylori infection, miRNAs fulfil an important function in the deregulation of gene expression (31,33). GKN1 is absent in cancer, both with and without H. pylori, and is reduced in patients with gastritis, in gastric mucosa infected by H. pylori and in atrophic gastritis (30). The reduction in or absence of GKN1 transcripts or protein is not completely explained by the studied mechanisms of transcriptional and post-translational regulation. It is likely that some miRNAs regulate GKN1 expression directly or indirectly at the post-transcriptional level.

It has been reported that ROS deregulate the expression of miRNAs in tissue infected with H. pylori or gastric cancer tissue (107,108). It is also known that ROS induce a decrease in the number of copies of GKN1 mRNA in tissue infected by H. pylori (48). These data support the hypothesis that, in H. pylori infection, ROS alter the expression of miRNAs, among which are those with the GKN1 transcript as a target. The cytotoxins VacA and CagA, lipopolysaccharide and peptidoglycan, among other components of H. pylori, are able to induce the increased expression of miRNAs that inhibit translation or induce the degradation of the GKN1 transcript, thus modulating the decrease in the levels of this protein.

From the first stages of H. pylori infection, the inflammation associated with it causes changes in the expression of proteins and miRNAs, alterations in cell signaling, and unbalanced cell proliferation and apoptosis in gastric epithelial cells, promoting the progression of gastritis to pre-neoplastic and neoplastic lesions (109). The abnormal expression of miRNAs is common in different types of cancer (110), with the evidence indicating changes in the expression profiles of miRNAs in gastric cancer and in mucosa infected by H. pylori.

Alterations in the expression of miRNAs can manifest either as increases or decreases (111). In the gastric mucosa, both with and without H. pylori infection, it has been found that miRNAs with changes in their expression levels in response to H. pylori can be similar to or different from those observed in gastric cancer with a negative result for bacteria (31) (Tables III and IV). Chang et al (33) found that hsa-miR-99b-3p, hsa-miR-564 and hsa-miR-658 expression increased in cancerous tissue infected with H. pylori, while hsa-miR-204-5p, hsa-miR-338-5p, hsa-miR-375 and hsa-miR-548c-3p were found to be overexpressed in cancer tissue without H. pylori (33).

Table III

miRNA expression in patients and in vitro models with H. pylori infection.

Table III

miRNA expression in patients and in vitro models with H. pylori infection.

Author, yearModelH. pylori strainMethod used to determine miRNA expressionUpregulated miRNAsDownregulated miRNAsRefs.
Cho et al, 2016MurineC57BL/6 miceSS1Mouse whole genome miRNA array (Agilent Technologies, Inc.) release 15-mmu-miR-1
mmu-miR-133a
mmu-miR-133b
mmu-miR-203
mmu-miR-205
mmu-miR-490-3p
(116)
Belair et al, 2011Intestinal type gastric cancer cell linesAGS26695Reverse transcription-quantitative PCRhsa-miR-21 hsa-miR-371-3p
hsa-miR-372
hsa-miR-373
hsa-miR-19b
hsa-miR-160b
hsa-miR-320
(117)
Santos et al, 2017AGS26695 y P12Cancer Pathway Finder miRNA PCR Array (MIHS-102Z; Qiagen, Inc.) hsa-miR-150-5p
hsa-miR-155-5p
hsa-miR-3163
(35)
Chang et al, 2015Patients diagnosed with gastric cancerEight intestinal type gastric cancer patients with H. pylori infectionNo dataHuman miRNA microarray (Agilent Technologies, Inc.), release 16.0 hsa-miR-32-3p
hsa-miR-514a-3p
hsa-miR-181c-3p
hsa-miR-146a-5p
hsa-miR-4319
hsa-miR-99b-3p
hsa-miR-543
hsa-miR-564
hsa-miR-645
hsa-miR-431-3p
hsa-miR-650
hsa-miR-638
hsa-miR-139-3p
hsa-miR-508-3p
hsa-miR-2355-3p
hsa-miR-934
hsa-miR-548f
hsa-miR-1304-5p
-(33)

[i] H. pylori, Helicobacter pylori; miR/miRNA, microRNA.

Table IV

miRNAs expression in cell lines and patients with gastric Cancer, grouped based on Lauren's Classification (118).

Table IV

miRNAs expression in cell lines and patients with gastric Cancer, grouped based on Lauren's Classification (118).

Author, yearModelMefhod used to determine the miRNAs expressionUpregulated miRNAsDownregulated miRNAsRefs.
Yu e tal, 2012Intestinal type gastric Cancer cell linesNCI-N87
AGS
MKN28
BGC-823
SGC-7901
Human microRNA Microarray v.2 (Agilent Technologies), containing probes for 723 human microRNAs hsa-miR-196a
hsa-miR-615
hsa-miR-196b
hsa-miR-92b
hsa-miR-149
hsa-miR-376a
hsa-miR-145
hsa-miR-143
hsa-miR-451
hsa-miR-142-5p
(119)
Diffuse type gastric Cancer cell linesSNU-1
SNU-16
KATO III
MKN45
hsa-miR-550
hsa-miR-183
hsa-miR-301
hsa-miR-18a
hsa-miR-106a
hsa-miR-17-5p
hsa-miR-18b
hsa-miR-19a
hsa-miR-221
hsa-miR-93
hsa-miR-20a
hsa-miR-1
hsa-miR-377
hsa-miR-495
hsa-miR-409-3p
hsa-miR-368
hsa-miR-142-3p
hsa-miR-150
hsa-miR-497
hsa-miR-214
hsa-miR-199a
hsa-miR-146b
hsa-miR-133b
hsa-miR-127
hsa-miR-381
hsa-miR-195
hsa-miR-648
hsa-miR-223
hsa-miR-135a
hsa-miR146a
hsa-miR-136
hsa-miR 126
hsa-miR-29c
hsa-miR-572
Guo et al, 2009Patients diagnosed with gastric CancerIntestinal typeμParaflo™ microfiuidic chip (LC Sciences) hsa-miR-31
hsa-miR-133b
hsa-miR-139-5p
hsa-miR-195
hsa-miR-378
hsa-miR-497
hsa-miR-768-3p
hsa-miR-17
hsa-miR-18a
hsa-miR-18b
hsa-miR-19a
hsa-miR-20a
hsa-miR-20b
hsa-miR-21
hsa-miR-106a
hsa-miR-106b
hsa-miR-340
hsa-miR-421
hsa-miR-658
(120)
Udea et al, 2010ArrayExpress, v3.0 (European Bioinformatics Institute), contains 1,100 microRNA probes, 326 human and 249 mouse hsa-miR-373
hsa-miR-498
hsa-miR-202
hsa-miR-494
-(121)
Tsukamoto et al, 2010Diffuse typeG4470A Human MiRNA Microarray (Agilent Technologies, Inc.), of 470 human and 64 virus mature miRNAs based on Sanger miRBase release 9.1 hsa-miR-18a
hsa-miR-106a
hsa-miR-17-5p
hsa-miR-146a
hsa-miR-93
hsa-miR-19a
hsa-miR-20a
hsa-miR-20b
hsa-miR-25
hsa-miR-15b
hsa-miR-425-5p
hsa-miR-92
hsa-miR-194
hsa-miR-10a
hsa-miR-222
hsa-miR-7
hsa-miR-106b
hsa-miR-320
hsa-miR-21
hsa-miR-34a
hsa-miR-19b
hsa-miR-103
hsa-miR-215
hsa-miR-192
hsa-miR-429
hsa-miR-279
hsa-miR-223
hsa-miR-23a
hsa-miR-107
hsa-miR-200b
hsa-miR-24
hsa-miR-15a
hsa-miR-16
hsa-miR-375
hsa-miR-29c
hsa-miR-148a
hsa-miR-30a-5p
hsa-miR-30e-5p
hsa-miR-638
(122)
Su et al, 2012AFFX miRNA expression chips (Affymetrix; Thermo Fisher Scientific, Inc.) hsa-miR-455-3p
hsa-miR-34a
hsa-let-7g
hsa-miR-200b
hsa-miR-768-3p
hsa-let-7d
hsa-miR-104-3p
hsa-miR-27b
hsa-miR-1207-5p
hsa-miR-663
hsa-miR-486-5p
hsa-miR-222
hsa-miR-574-3p
hsa-miR-768-5p
hsa-miR-378
hsa-miR-31
(123)
Juzenas et cd, 2015TaqMan Array Human MiRNA Card A v2.1 (Applied Biosystems; Thermo Fisher Scientific, Inc.), include 377 human miRNAs of miRBase v20 hsa-miR-146b-5p
hsa-miR-155-5p
hsa-miR-214-3p
hsa-miR-223-3p
hsa-miR-224-5p
hsa-miR-331-3p
hsa-miR-484
hsa-let-7a-5p
hsa-let-7g-5p
hsa-miR- 135a-5p
hsa-miR-148a-3p
hsa-miR-204-5p
hsa-miR-26b-5p
hsa-miR-30b-5p
hsa-miR-375
(124)
Katada et cd, 2009TaqMan miRNA assays hsa-miR-34b
hsa-miR-34c
hsa-miR 128a
hsa-miR128b
hsa-miR-129
hsa-miR-148a
(125)
Ueda et cd, 2010ArrayExpress, Version 3.0 (European Bioinformatics Institute), A-MEXP-620, contains 1,100 microRNA probes, 326 human and 249 mouse hsa-miR-105
hsa-miR-100
hsa-miR-125b
hsa-miR-199a
hsa-miR-99a
hsa-miR-143
hsa-miR-145
hsa-miR133a
(121)

[i] miRNA/miR, microRNA.

In infected mucosa, hsa-miR-223 expression was found to be increased, while in mucosa without H. pylori, hsa-miR-203, hsa-miR-204, hsa-miR-455, hsa-miR-141 and hsa-let-7f were found to be overexpressed (31). The levels of let-7, miR-125a and miR-500 were found to be significantly reduced in cells infected with cagA+ strains, although not in those infected with cagA− strains. These results indicate that miRNAs participate in gastric pathogenesis, whether associated and not associated with H. pylori, and suggest that the CagA oncoprotein of H. pylori regulates the differential expression of miRNAs in epithelial gastric cells (31). Increased hsa-miR-127-5p, hsa-miR195, hsa-miR-196a, hsa-miR-206, hsa-miR-216 and miR-488 expression has been found, while decreased hsa-miR-103, hsa-miR-141, hsa-miR-17-3p, hsa-miR34a and let-7i expression has been found in gastric epithelial cells infected with different H. pylori-cagA+ strains (36).

H. pylori is able to modify the expression of miRNAs by means of inflammatory effectors (112). In gastric epithelial cells, the pro-inflammatory cytokines IL-8, tumor necrosis factor-α and IL-1β induce the expression of miR-146a (113), while the oncoprotein CagA positively regulates c-myc, which is related to the decreased expression of miR-26a and miR-101. The decrease in the expression of these miRNAs contributes to increased levels of the histone methyltransferase EZH2 and methyltransferase DNMT3B, which promote the methylation of the let-7 promoter (114).

Ubiquitination

E3 ubiquitin-protein ligase UBR5 (UBR5) is an E3 ubiquitin ligase that participates in the ubiquitin-proteasome system, regulating protein concentration via ubiquitination and degradation, and is deregulated in different types of cancer (115). UBR5 increases in the cancerous tissues of gastric cancer patients, while an interaction between UBR5 and GKN1 has been observed through immunoprecipitation assays. These results suggest that UBR5 participates in the ubiquitination of GKN1, and that at least part of this protein is sent to be degraded by the proteasome (27) (Fig. 1G). Thus, UBR5 contributes to the regulation of gastric carcinogenesis, inducing the degradation of tumor suppressing proteins, such as GKN1 (27).

Therefore, promoter methylation, trimethylation of histones and ubiquitination are mechanisms that contribute to the regulation of the GKN1 expression in gastric cancer; however, they do not explain the absence of the protein in cell lines and cancerous human tissue.

6. Conclusion

GKN1 plays an important role in the maintenance of gastric homeostasis. In inflamed mucosa, both with and without H. pylori infection, GKN1 levels decrease, while this protein is absent in gastric cancer. The measurement of circulating GKN1 concentration, the protein itself or its mRNA in gastric tissue could be useful for the early diagnosis of cancer. However, little is known about the mechanisms that explain the reduction or silencing of GKN1 expression in gastric carcinogenesis. No mutations or polymorphisms have been found in the GKN1 promoter region, which explains the reduction in the levels of this protein. While the modification of histones seems to be involved in the transcriptional regulation of GKN1, further research is required to confirm its level of participation in the regulation of GKN1 in the population. The information available suggests that the methylation of the GKN1 promotor is an epigenetic mechanism that reduces the transcription rate of the gene. However, this mechanism only occurs in some cases of gastric cancer and, moreover, it is probable that it is determined by the genetic characteristics of the individual or the presence of EBV in the tumor. While only factor NKX6.3 has been confirmed as a positive regulator of GKN1 transcription, in silico analysis suggests the existence of other transcription factors with affinity for sequences in the GKN1 promotor region, among which are GATA-3, CEBP-α, Oct-1, AP-1, STAT-3, SP1, STAT-1, CREB and NFAT. It is unknown whether miRNAs regulate GKN1 expression at the post-transcriptional level. In silico analysis revealed that hsa-miR-544a, hsa-miR1245b-3p, hsa-miR-892c-5p and hsa-miR-548d-3p have sequences complementary to sites located in the 3′UTR of GKN1 mRNA. It is likely that, together, they regulate the expression of GKN1 in vivo, in mucosa infected by H. pylori or in gastric cancer (Fig. 1). Functional studies are required to show whether miRNAs play a role in the regulation of GKN1 expression. At the post-translational level, UBR5 mediates the ubiquitination of GKN1, marking it for degradation in the proteasome; however, this mechanism does not explain the absence or minimal level of GKN1 expression in gastric cancer. Clarifying the mechanisms that regulate GKN1 expression will contribute useful information for evaluating the possible clinical applications for the detection of this protein in mucosa, or in the circulation of patients with gastric diseases both associated and not associated with H. pylori.

Funding

This work was supported by a doctoral fellowship from CONACYT to JAM (grant no. 296364).

Availability of data and materials

Not applicable.

Authors' contributions

JAM, DNMC, OPZ and GFT contributed the idea, wrote the text, and generated the tables and the figure.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declares that they have no competing interests.

Acknowledgments

Not applicable.

References

1 

Khurana S and Mills JC: The gastric mucosa development and differentiation. Prog Mol Biol Transl Sci. 96:93–115. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Dimaline R and Varro A: Attack and defence in the gastric epithelium - a delicate balance. Exp Physiol. 92:591–601. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Hoffmann W: Self-renewal of the gastric ephitelium from stem and progenitor cells. Front Biosci. S5:720–731. 2013. View Article : Google Scholar

4 

Mueller A, Merrell DS, Grimm J and Falkow S: Profiling of microdissected gastric epithelial cells reveals a cell type-specific response to Helicobacter pylori infection. Gastroenterology. 127:1446–1462. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Silen W and Ito S: Mechanisms for rapid re-epithelialization of the gastric mucosal surface. Annu Rev Physiol. 47:217–229. 1985. View Article : Google Scholar : PubMed/NCBI

6 

Menheniott TR, Kurklu B and Giraud AS: Gastrokines: Stomach-specific proteins with putative homeostatic and tumor suppressor roles. Am J Physiol Gastrointest Liver Physiol. 304:G109–G121. 2013. View Article : Google Scholar

7 

Rippa E, La Monica G, Allocca R, Romano MF, De Palma M and Arcari P: Overexpression of gastrokine 1 in gastric cancer cells induces Fas-mediated apoptosis. J Cell Physiol. 226:2571–2578. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Yoon JH, Choi YJ, Choi WS, Ashktorab H, Smoot DT, Nam SW, Lee JY and Park WS: GKN1-miR-185-DNMT1 axis suppresses gastric carcinogenesis through regulation of epigenetic alteration and cell cycle. Clin Cancer Res. 19:4599–4610. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Yoon JH, Cho ML, Choi YJ, Back JY, Park MK, Lee SW, Choi BJ, Ashktorab H, Smoot DT, Nam SW, et al: Gastrokine 1 regulates NF-κB signaling pathway and cytokine expression in gastric cancers. J Cell Biochem. 114:1800–1809. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Kim O, Yoon JH, Choi WS, Ashktorab H, Smoot DT, Nam SW, Lee JY and Park WS: GKN2 contributes to the homeostasis of gastric mucosa by inhibiting GKN1 activity. J Cell Physiol. 229:762–771. 2014. View Article : Google Scholar

11 

Yoon JH, Seo HS, Choi WS, Kim O, Nam SW, Lee JY and Park WS: Gastrokine 1 induces senescence and apoptosis through regulating telomere length in gastric cancer. Oncotarget. 5:11695–11708. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Chen P, Li YC and Toback FG: AMP-18 targets p21 to maintain epithelial homeostasis. PLoS One. 10:e01254902015. View Article : Google Scholar : PubMed/NCBI

13 

Kim O, Yoon JH, Choi WS, Ashktorab H, Smoot DT, Nam SW, Lee JY and Park WS: Gastrokine 1 inhibits gastrin-induced cell proliferation. Gastric Cancer. 19:381–391. 2016. View Article : Google Scholar

14 

Rippa E, Altieri F, Di Stadio CS, Miselli G, Lamberti A, Federico A, Quagliariello V, Papale F, Guerra G and Arcari P: Ectopic expression of gastrokine 1 in gastric cancer cells up-regulates tight and adherens junction proteins network. Pathol Res Pract. 211:577–583. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Xing R, Cui JT, Xia N and Lu YY: GKN1 inhibits cell invasion in gastric cancer by inactivating the NF-kappaB pathway. Discov Med. 19:65–71. 2015.PubMed/NCBI

16 

Yoon JH, Choi WS, Kim O, Choi BJ, Nam SW, Lee JY and Park WS: Gastrokine 1 inhibits gastric cancer cell migration and invasion by downregulating RhoA expression. Gastric Cancer. 20:274–285. 2017. View Article : Google Scholar

17 

Nardone G, Martin G, Rocco A, Rippa E, La Monica G, Caruso F and Arcari P: Molecular expression of Gastrokine 1 in normal mucosa and in Helicobacter pylori-related preneoplastic and neoplastic gastric lesions. Cancer Biol Ther. 7:1890–1895. 2008. View Article : Google Scholar : PubMed/NCBI

18 

He QY, Cheung YH, Leung SY, Yuen ST, Chu KM and Chiu JF: Diverse proteomic alterations in gastric adenocarcinoma. Proteomics. 4:3276–3287. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Moss SF, Lee JW, Sabo E, Rubin AK, Rommel J, Westley BR, May FE, Gao J, Meitner PA, Tavares R, et al: Decreased expression of gastrokine 1 and the trefoil factor interacting protein TFIZ1/GKN2 in gastric cancer: Influence of tumor histology and relationship to prognosis. Clin Cancer Res. 14:4161–4167. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Yoon JH, Song JH, Zhang C, Jin M, Kang YH, Nam SW, Lee JY and Park WS: Inactivation of the Gastrokine 1 gene in gastric adenomas and carcinomas. J Pathol. 223:618–625. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Mao W, Chen J, Peng TL, Yin XF, Chen LZ and Chen MH: Downregulation of gastrokine-1 in gastric cancer tissues and restoration of its expression induced gastric cancer cells to apoptosis. J Exp Clin Cancer Res. 31:49–58. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Xiao JW, Chen JH, Ren MY, Tian XB and Wang CS: Relationship between expression of gastrokine 1 and clinicopathological characteristics in gastric cancer patients. Asian Pac J Cancer Prev. 13:5897–5901. 2012. View Article : Google Scholar

23 

Choi WS, Seo HS, Song KY, Yoon JH, Kim O, Nam SW, Lee JY and Park WS: Gastrokine 1 expression in the human gastric mucosa is closely associated with the degree of gastritis and DNA methylation. J Gastric Cancer. 13:232–241. 2013. View Article : Google Scholar

24 

Guo XY, Dong L, Qin B, Jiang J and Shi AM: Decreased expression of gastrokine 1 in gastric mucosa of gastric cancer patients. World J Gastroenterol. 20:16702–16706. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Hasan AA, Igci M, Borazan E, Khailany RA, Bayraktar E and Arslan A: Down-regulated gene expression of GKN1 and GKN2 as diagnostic markers for gastric cancer. WASET9. 532–535. 2015.

26 

Altieri F, Di Stadio CS, Federico A, Miselli G, De Palma M, Rippa E and Arcari P: Epigenetic alterations of gastrokine 1 gene expression in gastric cancer. Oncotarget. 8:16899–16911. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Yang M, Jiang N, Cao QW, Ma MQ and Sun Q: The E3 ligase UBR5 regulates gastric cancer cell growth by destabilizing the tumor suppressor GKN1. Biochem Biophys Res Commun. 478:1624–1629. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Lu F, Wikramasinghe P, Norseen J, Tsai K, Wang P, Showe L, Davuluri RV and Lieberman PM: Genome-wide analysis of host-chromosome binding sites for Epstein-Barr virus nuclear antigen 1 (EBNA1). Virol J. 7:2622010. View Article : Google Scholar : PubMed/NCBI

29 

Lu F, Tempera I, Lee HT, Dewispelaere K and Lieberman PM: EBNA1 binding and epigenetic regulation of gastrokine tumor suppressor genes in gastric carcinoma cells. Virol J. 11:122014. View Article : Google Scholar : PubMed/NCBI

30 

Nardone G, Rippa E, Martin G, Rocco A, Siciliano RA, Fiengo A, Cacace G, Malorni A, Budillon G and Arcari P: Gastrokine 1 expression in patients with and without Helicobacter pylori infection. Dig Liver Dis. 39:122–129. 2007. View Article : Google Scholar

31 

Matsushima K, Isomoto H, Inoue N, Nakayama T, Hayashi T, Nakayama M, Nakao K, Hirayama T and Kohno S: MicroRNA signatures in Helicobacter pylori-infected gastric mucosa. Int J Cancer. 128:361–370. 2011. View Article : Google Scholar

32 

Lario S, Ramírez-Lázaro MJ, Aransay AM, Lozano JJ, Montserrat A, Casalots Á, Junquera F, Álvarez J, Segura F, Campo R, et al: microRNA profiling in duodenal ulcer disease caused by Helicobacter pylori infection in a Western population. Clin Microbiol Infect. 18:E273–E282. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Chang H, Kim N, Park JH, Nam RH, Choi YJ, Lee HS, Yoon H, Shin CM, Park YS, Kim JM, et al: Different microRNA expression levels in gastric cancer depending on Helicobacter pylori infection. Gut Liver. 9:188–196. 2015. View Article : Google Scholar :

34 

Zhu Y, Jiang Q, Lou X, Ji X, Wen Z, Wu J, Tao H, Jiang T, He W, Wang C, et al: MicroRNAs up-regulated by CagA of Helicobacter pylori induce intestinal metaplasia of gastric epithelial cells. PLoS One. 7:e351472012. View Article : Google Scholar : PubMed/NCBI

35 

Santos JC, Brianti MT, Almeida VR, Ortega MM, Fischer W, Haas R, Matheu A and Ribeiro ML: Helicobacter pylori infection modulates the expression of miRNAs associated with DNA mismatch repair pathway. Mol Carcinog. 56:1372–1379. 2017. View Article : Google Scholar

36 

Chung JW, Jeong SH, Lee SM, Pak JH, Lee GH, Jeong JY and Kim JH: Expression of microRNA in host cells infected with Helicobacter pylori. Gut Liver. 11:392–400. 2017. View Article : Google Scholar : PubMed/NCBI

37 

Sugihara H, Ishimoto T, Watanabe M, Sawayama H, Iwatsuki M, Baba Y, Komohara Y, Takeya M and Baba H: Identification of miR-30e* regulation of Bmi1 expression mediated by tumor-associated macrophages in gastrointestinal cancer. PLoS One. 8:e818392013. View Article : Google Scholar

38 

Stumpfova Z, Hezova R, Meli AC, Slaby O and Michalek J: MicroRNA profiling of activated and tolerogenic human dendritic cells. Mediators Inflamm. 2014:259689–259699. 2014. View Article : Google Scholar : PubMed/NCBI

39 

Teteloshvili N, Smigielska-Czepiel K, Kroesen BJ, Brouwer E, Kluiver J, Boots AM and van den Berg A: T-cell activation induces dynamic changes in miRNA expression patterns in CD4 and CD8 T-cell subsets. MicroRNA. 4:117–122. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Sánchez-Pulido L, Devos D and Valencia A: BRICHOS: A conserved domain in proteins associated with dementia, respiratory distress and cancer. Trends Biochem Sci. 27:329–332. 2002. View Article : Google Scholar : PubMed/NCBI

41 

Hedlund J, Johansson J and Persson B: BRICHOS - a super-family of multidomain proteins with diverse functions. BMC Res Notes. 2:180–189. 2009. View Article : Google Scholar

42 

Pavone LM, Del Vecchio P, Mallardo P, Altieri F, De Pasquale V, Rea S, Martucci NM, Di Stadio CS, Pucci P, Flagiello A, et al: Structural characterization and biological properties of human gastrokine 1. Mol Biosyst. 9:412–421. 2013. View Article : Google Scholar : PubMed/NCBI

43 

Yoon JH, Choi YJ, Choi WS, Nam SW, Lee JY and Park WS: Functional analysis of the NH2-terminal hydrophobic region and BRICHOS domain of GKN1. Biochem Biophys Res Commun. 440:689–695. 2013. View Article : Google Scholar : PubMed/NCBI

44 

Dokhaee F, Mazhari S, Galehdari M, Bahadori Monfared A and Baghaei K: Evaluation of GKN1 and GKN2 gene expression as a biomarker of gastric cancer. Gastroenterol Hepatol Bed Bench. 11(Suppl 1): S140–S145. 2018.

45 

Toback FG, Walsh-Reitz MM, Musch MW, Chang EB, Del Valle J, Ren H, Huang E and Martin TE: Peptide fragments of AMP-18, a novel secreted gastric antrum mucosal protein, are mitogenic and motogenic. Am J Physiol Gastrointest Liver Physiol. 285:G344–G353. 2003. View Article : Google Scholar : PubMed/NCBI

46 

Xing R, Li W, Cui J, Zhang J, Kang B, Wang Y, Wang Z, Liu S and Lu Y: Gastrokine 1 induces senescence through p16/Rb pathway activation in gastric cancer cells. Gut. 61:43–52. 2012. View Article : Google Scholar

47 

Conteduca V, Sansonno D, Lauletta G, Russi S, Ingravallo G and Dammacco F: H. pylori infection and gastric cancer: State of the art (review). Int J Oncol. 42:5–18. 2013. View Article : Google Scholar

48 

Yoon JH, Seo HS, Choi SS, Chae HS, Choi WS, Kim O, Ashktorab H, Smoot DT, Nam SW, Lee JY, et al: Gastrokine 1 inhibits the carcinogenic potentials of Helicobacter pylori CagA. Carcinogenesis. 35:2619–2629. 2014. View Article : Google Scholar : PubMed/NCBI

49 

Yoshikawa Y, Mukai H, Hino F, Asada K and Kato I: Isolation of two novel genes, down-regulated in gastric cancer. Jpn J Cancer Res. 91:459–463. 2000. View Article : Google Scholar : PubMed/NCBI

50 

Shiozaki K, Nakamori S, Tsujie M, Okami J, Yamamoto H, Nagano H, Dono K, Umeshita K, Sakon M, Furukawa H, et al: Human stomach-specific gene, CA11, is down-regulated in gastric cancer. Int J Oncol. 19:701–707. 2001.PubMed/NCBI

51 

Oien KA, Vass JK, Downie I, Fullarton G and Keith WN: Profiling, comparison and validation of gene expression in gastric carcinoma and normal stomach. Oncogene. 22:4287–4300. 2003. View Article : Google Scholar : PubMed/NCBI

52 

Oien KA, McGregor F, Butler S, Ferrier RK, Downie I, Bryce S, Burns S and Keith WN: Gastrokine 1 is abundantly and specifically expressed in superficial gastric epithelium, down-regulated in gastric carcinoma, and shows high evolutionary conservation. J Pathol. 203:789–797. 2004. View Article : Google Scholar : PubMed/NCBI

53 

Koper-Lenkiewicz OM, Kamińska J, Gawrońska B and Matowicka-Karna J: The role and diagnostic potential of gastrokine 1 in gastric cancer. Cancer Manag Res. 11:1921–1931. 2019. View Article : Google Scholar : PubMed/NCBI

54 

Zamanian-Azodi M, Rezaei-Tavirani M, Hasanzadeh H, Rahmati Rad S and Dalilan S: Introducing biomarker panel in esophageal, gastric, and colon cancers; a proteomic approach. Gastroenterol Hepatol Bed Bench. 8:6–18. 2015.PubMed/NCBI

55 

Villano V, Di Stadio CS, Federico A, Altieri F, Miselli G, De Palma M, Rippa E and Arcari P: Gastrokine 1 mRNA in human sera is not informative biomarker for gastric cancer. J Negat Results Biomed. 15:142016. View Article : Google Scholar : PubMed/NCBI

56 

Yoon JH, Ham IH, Kim O, Ashktorab H, Smoot DT, Nam SW, Lee JY, Hur H and Park WS: Gastrokine 1 protein is a potential theragnostic target for gastric cancer. Gastric Cancer. 21:956–967. 2018. View Article : Google Scholar : PubMed/NCBI

57 

Noguchi T, Wirtz HC, Michaelis S, Gabbert HE and Mueller W: Chromosomal imbalances in gastric cancer. Correlation with histologic subtypes and tumor progression. Am J Clin Pathol. 115:828–834. 2001. View Article : Google Scholar : PubMed/NCBI

58 

Panani AD: Cytogenetic and molecular aspects of gastric cancer: Clinical implications. Cancer Lett. 266:99–115. 2008. View Article : Google Scholar : PubMed/NCBI

59 

Orphanides G and Reinberg D: A unified theory of gene expression. Cell. 108:439–451. 2002. View Article : Google Scholar : PubMed/NCBI

60 

Jaenisch R and Bird A: Epigenetic regulation of gene expression: How the genome integrates intrinsic and environmental signals. Nat Genet. 33(Suppl): 245–254. 2003. View Article : Google Scholar : PubMed/NCBI

61 

Shilatifard A: Chromatin modifications by methylation and ubiquitination: Implications in the regulation of gene expression. Annu Rev Biochem. 75:243–269. 2006. View Article : Google Scholar : PubMed/NCBI

62 

Catalanotto C, Cogoni C and Zardo G: MicroRNA in control of gene expression: An overview of nuclear functions. Int J Mol Sci. 17:17122016. View Article : Google Scholar :

63 

Levine M and Tjian R: Transcription regulation and animal diversity. Nature. 424:147–151. 2003. View Article : Google Scholar : PubMed/NCBI

64 

Lambert SA, Jolma A, Campitelli LF, Das PK, Yin Y, Albu M, Chen X, Taipale J, Hughes TR and Weirauch MT: The human transcription factors. Cell. 175:598–599. 2018. View Article : Google Scholar : PubMed/NCBI

65 

Yoon JH, Choi WS, Kim O, Choi SS, Lee EK, Nam SW, Lee JY and Park WS: NKX6.3 controls gastric differentiation and tumorigenesis. Oncotarget. 6:28425–28439. 2015. View Article : Google Scholar : PubMed/NCBI

66 

Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, Frisch M, Bayerlein M and Werner T: MatInspector and beyond: Promoter analysis based on transcription factor binding sites. Bioinformatics. 21:2933–2942. 2005. View Article : Google Scholar : PubMed/NCBI

67 

Grabe N: AliBaba2: Context specific identification of transcription factor binding sites. In Silico Biol. 2:S1–S15. 2002.PubMed/NCBI

68 

Ghosh D: Object-oriented transcription factors database (ooTFD). Nucleic Acids Res. 28:308–310. 2000. View Article : Google Scholar

69 

Strowski MZ, Cramer T, Schäfer G, Jüttner S, Walduck A, Schipani E, Kemmner W, Wessler S, Wunder C, Weber M, et al: Helicobacter pylori stimulates host vascular endothelial growth factor-A (vegf-A) gene expression via MEK/ERK-dependent activation of Sp1 and Sp3. FASEB J. 18:218–220. 2004. View Article : Google Scholar

70 

Mitsuno Y, Yoshida H, Maeda S, Ogura K, Hirata Y, Kawabe T, Shiratori Y and Omata M: Helicobacter pylori induced transactivation of SRE and AP-1 through the ERK signalling pathway in gastric cancer cells. Gut. 49:18–22. 2001. View Article : Google Scholar : PubMed/NCBI

71 

Han JC, Zhang KL, Chen XY, Jiang HF, Kong QY, Sun Y, Wu ML, Huang L, Li H and Liu J: Expression of seven gastric cancer-associated genes and its relevance for Wnt, NF-kappaB and Stat3 signaling. APMIS. 115:1331–1343. 2007. View Article : Google Scholar

72 

Xiong H, Du W, Sun TT, Lin YW, Wang JL, Hong J and Fang JY: A positive feedback loop between STAT3 and cyclooxygenase-2 gene may contribute to Helicobacter pylori-associated human gastric tumorigenesis. Int J Cancer. 134:2030–2040. 2014. View Article : Google Scholar

73 

Hu TZ, Huang LH, Xu CX, Liu XM, Wang Y, Xiao J, Zhou L, Luo L and Jiang XX: Expressional profiles of transcription factors in the progression of Helicobacter pylori-associated gastric carcinoma based on protein/DNA array analysis. Med Oncol. 32:2652015. View Article : Google Scholar : PubMed/NCBI

74 

Liu X, Cao K, Xu C, Hu T, Zhou L, Cao D, Xiao J, Luo L, Guo Y and Qi Y: GATA-3 augmentation down-regulates Connexin43 in Helicobacter pylori associated gastric carcinogenesis. Cancer Biol Ther. 16:987–996. 2015. View Article : Google Scholar : PubMed/NCBI

75 

Qian J, Kong X, Deng N, Tan P, Chen H, Wang J, Li Z, Hu Y, Zou W, Xu J, et al: OCT1 is a determinant of synbindin-related ERK signalling with independent prognostic significance in gastric cancer. Gut. 64:37–48. 2015. View Article : Google Scholar :

76 

Xu G, Li K, Zhang N, Zhu B and Feng G: Screening driving transcription factors in the processing of gastric cancer. Gastroenterol Res Pract. 2016:84314802016. View Article : Google Scholar : PubMed/NCBI

77 

Shakya A, Cooksey R, Cox JE, Wang V, McClain DA and Tantin D: Oct1 loss of function induces a coordinate metabolic shift that opposes tumorigenicity. Nat Cell Biol. 11:320–327. 2009. View Article : Google Scholar : PubMed/NCBI

78 

Kong Y, Ma LQ, Bai PS, Da R, Sun H, Qi XG, Ma JQ, Zhao RM, Chen NZ and Nan KJ: Helicobacter pylori promotes invasion and metastasis of gastric cancer cells through activation of AP-1 and up-regulation of CACUL1. Int J Biochem Cell Biol. 45:2666–2678. 2013. View Article : Google Scholar : PubMed/NCBI

79 

Regalo G, Resende C, Wen X, Gomes B, Durães C, Seruca R, Carneiro F and Machado JC: C/EBP α expression is associated with homeostasis of the gastric epithelium and with gastric carcinogenesis. Lab Invest. 90:1132–1139. 2010. View Article : Google Scholar : PubMed/NCBI

80 

Jackson CB, Judd LM, Menheniott TR, Kronborg I, Dow C, Yeomans ND, Boussioutas A, Robb L and Giraud AS: Augmented gp130-mediated cytokine signalling accompanies human gastric cancer progression. J Pathol. 213:140–151. 2007. View Article : Google Scholar : PubMed/NCBI

81 

O'Reilly LA, Putoczki TL, Mielke LA, Low JT, Lin A, Preaudet A, Herold MJ, Yaprianto K, Tai L, Kueh A, et al: Loss of NF-κB1 causes gastric cancer with aberrant inflammation and expression of immune checkpoint regulators in a STAT-1 dependent manner. Immunity. 48:570–583.e8. 2018. View Article : Google Scholar

82 

Zhang J, Zhu ZG, Ji J, Yuan F, Yu YY, Liu BY and Lin YZ: Transcription factor Sp1 expression in gastric cancer and its relationship to long-term prognosis. World J Gastroenterol. 11:2213–2217. 2005. View Article : Google Scholar : PubMed/NCBI

83 

Jüttner S, Cramer T, Wessler S, Walduck A, Gao F, Schmitz F, Wunder C, Weber M, Fischer SM, Schmidt WE, et al: Helicobacter pylori stimulates host cyclooxygenase-2 gene transcription: Critical importance of MEK/ERK-dependent activation of USF1/-2 and CREB transcription factors. Cell Microbiol. 5:821–834. 2003. View Article : Google Scholar : PubMed/NCBI

84 

Lu H, Wu JY, Kudo T, Ohno T, Graham DY and Yamaoka Y: Regulation of interleukin-6 promoter activation in gastric epithelial cells infected with Helicobacter pylori. Mol Biol Cell. 16:4954–4966. 2005. View Article : Google Scholar : PubMed/NCBI

85 

Bronte-Tinkew DM, Terebiznik M, Franco A, Ang M, Ahn D, Mimuro H, Sasakawa C, Ropeleski MJ, Peek RM Jr and Jones NL: Helicobacter pylori cytotoxin-associated gene A activates the signal transducer and activator of transcription 3 pathway in vitro and in vivo. Cancer Res. 69:632–639. 2009. View Article : Google Scholar : PubMed/NCBI

86 

Zhao J, Dong Y, Kang W, Go MY, Tong JH, Ng EK, Chiu PW, Cheng AS, To KF, Sung JJ, et al: Helicobacter pylori-induced STAT3 activation and signalling network in gastric cancer. Oncoscience. 1:468–475. 2014. View Article : Google Scholar

87 

Piao JY, Lee HG, Kim SJ, Kim DH, Han HJ, Ngo HK, Park SA, Woo JH, Lee JS, Na HK, et al: Helicobacter pylori activates IL-6-STAT3 signaling in human gastric cancer cells: Potential roles for reactive oxygen species. Helicobacter. 21:405–416. 2016. View Article : Google Scholar : PubMed/NCBI

88 

Yokoyama K, Higashi H, Ishikawa S, Fujii Y, Kondo S, Kato H, Azuma T, Wada A, Hirayama T, Aburatani H, et al: Functional antagonism between Helicobacter pylori CagA and vacuolating toxin VacA in control of the NFAT signaling pathway in gastric epithelial cells. Proc Natl Acad Sci USA. 102:9661–9666. 2005. View Article : Google Scholar : PubMed/NCBI

89 

Chen G, Tang N, Wang C, Xiao L, Yu M, Zhao L, Cai H, Han L, Xie C and Zhang Y: TNF-α-inducing protein of Helicobacter pylori induces epithelial-mesenchymal transition (EMT) in gastric cancer cells through activation of IL-6/STAT3 signaling pathway. Biochem Biophys Res Commun. 484:311–317. 2017. View Article : Google Scholar : PubMed/NCBI

90 

Mejías-Luque R, Peiró S, Vincent A, Van Seuningen I and de Bolós C: IL-6 induces MUC4 expression through gp130/STAT3 p athway in gastric cancer cell lines. Biochim Biophys Acta. 1783:1728–1736. 2008. View Article : Google Scholar

91 

Chang YJ, Wu MS, Lin JT and Chen CC: Helicobacter pylori-Induced invasion and angiogenesis of gastric cells is mediated by cyclooxy-genase-2 induction through TLR2/TLR9 and promoter regulation. J Immunol. 175:8242–8252. 2005. View Article : Google Scholar : PubMed/NCBI

92 

Lee KS, Kalantzis A, Jackson CB, O'Connor L, Murata-Kamiya N, Hatakeyama M, Judd LM, Giraud AS and Menheniott TR: Helicobacter pylori CagA triggers expression of the bactericidal lectin REG3γ via gastric STAT3 activation. PLoS One. 7:e307862012. View Article : Google Scholar

93 

Yamaoka Y, Kudo T, Lu H, Casola A, Brasier AR and Graham DY: Role of interferon-stimulated responsive element-like element in interleukin-8p romoter in Helicobacter pylori infection. Gastroenterology. 126:1030–1043. 2004. View Article : Google Scholar : PubMed/NCBI

94 

Mitchell DJ, Huynh HQ, Ceponis PJM, Jones NL and Sherman PM: Helicobacter pylori disrupts STAT1-mediated gamma interferon-induced signal transduction in epithelial cells. Infect Immun. 72:537–545. 2004. View Article : Google Scholar :

95 

Lee HS, Park CK, Oh E, Erkin ÖC, Jung HS, Cho MH, Kwon MJ, Chae SW, Kim SH, Wang LH, et al: Low SP1 expression differentially affects intestinal-type compared with diffuse-type gastric adenocarcinoma. PLoS One. 8:e555222013. View Article : Google Scholar : PubMed/NCBI

96 

Beishline K and Azizkhan-Clifford J: Sp1 and the 'hallmarks of cancer'. FEBS J. 282:224–258. 2015. View Article : Google Scholar

97 

Tomizawa M, Shinozaki F, Motoyoshi Y, Sugiyama T, Yamamoto S and Ishige N: CCAAT/enhancer-binding protein α decreases the viability of gastric cancer cells. Oncol Lett. 13:4322–4326. 2017. View Article : Google Scholar : PubMed/NCBI

98 

Peterson CL and Laniel MA: Histones and histone modifications. Curr Biol. 14:R546–R551. 2004. View Article : Google Scholar : PubMed/NCBI

99 

Agarwal V, Bell GW, Nam JW and Bartel DP: Predicting effective microRNA target sites in mammalian mRNAs. eLife. 4:e050052015. View Article : Google Scholar :

100 

John B, Enright AJ, Aravin A, Tuschl T, Sander C and Marks DS: Human microRNA targets. PLoS Biol. 3:e2642005. View Article : Google Scholar

101 

Wong N and Wang X: miRDB: An online resource for microRNA target prediction and functional annotations. Nucleic Acids Res. 43D:D146–D152. 2015. View Article : Google Scholar

102 

Lu TP, Lee CY, Tsai MH, Chiu YC, Hsiao CK, Lai LC and Chuang EY: miRSystem: An integrated system for characterizing enriched functions and pathways of microRNA targets. PLoS One. 7:e423902012. View Article : Google Scholar : PubMed/NCBI

103 

Maragkakis M, Reczko M, Simossis VA, Alexiou P, Papadopoulos GL, Dalamagas T, Giannopoulos G, Goumas G, Koukis E, Kourtis K, et al: DIANA-microT web server: Elucidating microRNA functions through target prediction. Nucleic Acids Res. 37(Web Server): W273–6. 2009. View Article : Google Scholar : PubMed/NCBI

104 

Sethupathy P, Megraw M and Hatzigeorgiou AG: A guide through present computational approaches for the identification of mammalian microRNA targets. Nat Methods. 3:881–886. 2006. View Article : Google Scholar : PubMed/NCBI

105 

Leitão AL, Costa MC and Enguita FJ: A guide for miRNA target prediction and analysis using web-based applications. Methods Mol Biol. 1182:265–277. 2014. View Article : Google Scholar : PubMed/NCBI

106 

Zhi Q, Guo X, Guo L, Zhang R, Jiang J, Ji J, Zhang J, Zhang J, Chen X, Cai Q, et al: Oncogenic miR-544 is an important molecular target in gastric cancer. Anticancer Agents Med Chem. 13:270–275. 2013. View Article : Google Scholar

107 

Chaturvedi R, de Sablet T, Asim M, Piazuelo MB, Barry DP, Verriere TG, Sierra JC, Hardbower DM, Delgado AG, Schneider BG, et al: Increased Helicobacter pylori-associated gastric cancer risk in the Andean region of Colombia is mediated by spermine oxidase. Oncogene. 34:3429–3440. 2015. View Article : Google Scholar :

108 

Ishimoto T, Sugihara H, Watanabe M, Sawayama H, Iwatsuki M, Baba Y, Okabe H, Hidaka K, Yokoyama N, Miyake K, et al: Macrophage-derived reactive oxygen species suppress miR-328 targeting CD44 in cancer cells and promote redox adaptation. Carcinogenesis. 35:1003–1011. 2014. View Article : Google Scholar

109 

Libânio D, Dinis-Ribeiro M and Pimentel-Nunes P: Helicobacter pylori and microRNAs: Relation with innate immunity and progression of preneoplastic conditions. World J Clin Oncol. 6:111–132. 2015. View Article : Google Scholar : PubMed/NCBI

110 

Zhang X, Peng Y, Jin Z, Huang W, Cheng Y, Liu Y, Feng X, Yang M, Huang Y, Zhao Z, et al: Integrated miRNA profiling and bioinformatics analyses reveal potential causative miRNAs in gastric adenocarcinoma. Oncotarget. 6:32878–32889. 2015. View Article : Google Scholar : PubMed/NCBI

111 

Zhang W, Dahlberg JE and Tam W: MicroRNAs in tumori-genesis: A primer. Am J Pathol. 171:728–738. 2007. View Article : Google Scholar : PubMed/NCBI

112 

Noto JM and Peek RM: The role of microRNAs in Helicobacter pylori pathogenesis and gastric carcinogenesis. Front Cell Infect Microbiol. 1:212012. View Article : Google Scholar :

113 

Li N, Xu X, Xiao B, Zhu ED, Li BS, Liu Z, Tang B, Zou QM, Liang HP and Mao XH: H. pylori related proinflammatory cytokines contribute to the induction of miR-146a in human gastric epithelial cells. Mol Biol Rep. 39:4655–4661. 2012. View Article : Google Scholar

114 

Hayashi Y, Tsujii M, Wang J, Kondo J, Akasaka T, Jin Y, Li W, Nakamura T, Nishida T, Iijima H, et al: CagA mediates epigenetic regulation to attenuate let-7 expression in Helicobacter pylori-related carcinogenesis. Gut. 62:1536–1546. 2013. View Article : Google Scholar

115 

Qi J and Ronai ZA: Dysregulation of ubiquitin ligases in cancer. Drug Resist Updat. 23:1–11. 2015. View Article : Google Scholar : PubMed/NCBI

116 

Cho CH, Yu J and Wu WKK: Identification of pathogenic microRNAs in Helicobacter pylori-associated gastric cancer using a combined approach of animal study and clinical sample analysis. Hong Kong Med J. 22(Suppl 6): 13–18. 2016.PubMed/NCBI

117 

Belair C, Baud J, Chabas S, Sharma CM, Vogel J, Staedel C and Darfeuille F: Helicobacter pylori interferes with an embryonic stem cell micro RNA cluster to block cell cycle progression. Silence. 2:72011. View Article : Google Scholar : PubMed/NCBI

118 

Lauren P: The two histological main types of gastric carcinoma: Diffuse and so-called intestinal-type carcinoma. An attempt at a histo-clinical classification. Acta Pathol Microbiol Scand. 64:31–49. 1965. View Article : Google Scholar : PubMed/NCBI

119 

Yu BQ, Su LP, Li JF, Cai Q, Yan M, Chen XH, Yu YY, Gu QL, Zhu ZG and Liu BY: microrna expression signature of gastric cancer cells relative to normal gastric mucosa. Mol Med Rep. 6:821–826. 2012. View Article : Google Scholar : PubMed/NCBI

120 

Guo J, Miao Y, Xiao B, Huan R, Jiang Z, Meng D and Wang Y: Differential expression of microRNA species in human gastric cancer versus non-tumorous tissues. J Gastroenterol Hepatol. 24:652–657. 2009. View Article : Google Scholar : PubMed/NCBI

121 

Ueda T, Volinia S, Okumura H, Shimizu M, Taccioli C, Rossi S, Alder H, Liu CG, Oue N, Yasui W, et al: Relation between microRNA expression and progression and prognosis of gastric cancer: A microRNA expression analysis. Lancet Oncol. 11:136–146. 2010. View Article : Google Scholar

122 

Tsukamoto Y, Nakada C, Noguchi T, Tanigawa M, Nguyen LT, Uchida T, Hijiya N, Matsuura K, Fujioka T, Seto M, et al: MicroRNA-375 is downregulated in gastric carcinomas and regulates cell survival by targeting PDK1 and 14-3-3zeta. Cancer Res. 70:2339–2349. 2010. View Article : Google Scholar : PubMed/NCBI

123 

Su Y, Ni Z, Wang G, Cui J, Wei C, Wang J, Yang Q, Xu Y and Li F: Aberrant expression of microRNAs in gastric cancer and biological significance of miR-574-3p. Int Immunopharmacol. 13:468–475. 2012. View Article : Google Scholar : PubMed/NCBI

124 

Juzėnas S, Saltenienė V, Kupcinskas J, Link A, Kiudelis G, Jonaitis L, Jarmalaite S, Kupcinskas L, Malfertheiner P and Skieceviciene J: Correction: Analysis of deregulated microRNAs and their target genes in gastric cancer. PLoS One. 10:e01357622015. View Article : Google Scholar

125 

Katada T, Ishiguro H, Kuwabara Y, Kimura M, Mitui A, Mori Y, Ogawa R, Harata K and Fujii Y: MicroRNA expression profile in undifferentiated gastric cancer. Int J Oncol. 34:537–542. 2009.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Alarcón‑Millán J, Martínez‑Carrillo DN, Peralta‑Zaragoza O and Fernández‑Tilapa G: Regulation of GKN1 expression in gastric carcinogenesis: A problem to resolve (Review). Int J Oncol 55: 555-569, 2019.
APA
Alarcón‑Millán, J., Martínez‑Carrillo, D.N., Peralta‑Zaragoza, O., & Fernández‑Tilapa, G. (2019). Regulation of GKN1 expression in gastric carcinogenesis: A problem to resolve (Review). International Journal of Oncology, 55, 555-569. https://doi.org/10.3892/ijo.2019.4843
MLA
Alarcón‑Millán, J., Martínez‑Carrillo, D. N., Peralta‑Zaragoza, O., Fernández‑Tilapa, G."Regulation of GKN1 expression in gastric carcinogenesis: A problem to resolve (Review)". International Journal of Oncology 55.3 (2019): 555-569.
Chicago
Alarcón‑Millán, J., Martínez‑Carrillo, D. N., Peralta‑Zaragoza, O., Fernández‑Tilapa, G."Regulation of GKN1 expression in gastric carcinogenesis: A problem to resolve (Review)". International Journal of Oncology 55, no. 3 (2019): 555-569. https://doi.org/10.3892/ijo.2019.4843
Copy and paste a formatted citation
x
Spandidos Publications style
Alarcón‑Millán J, Martínez‑Carrillo DN, Peralta‑Zaragoza O and Fernández‑Tilapa G: Regulation of GKN1 expression in gastric carcinogenesis: A problem to resolve (Review). Int J Oncol 55: 555-569, 2019.
APA
Alarcón‑Millán, J., Martínez‑Carrillo, D.N., Peralta‑Zaragoza, O., & Fernández‑Tilapa, G. (2019). Regulation of GKN1 expression in gastric carcinogenesis: A problem to resolve (Review). International Journal of Oncology, 55, 555-569. https://doi.org/10.3892/ijo.2019.4843
MLA
Alarcón‑Millán, J., Martínez‑Carrillo, D. N., Peralta‑Zaragoza, O., Fernández‑Tilapa, G."Regulation of GKN1 expression in gastric carcinogenesis: A problem to resolve (Review)". International Journal of Oncology 55.3 (2019): 555-569.
Chicago
Alarcón‑Millán, J., Martínez‑Carrillo, D. N., Peralta‑Zaragoza, O., Fernández‑Tilapa, G."Regulation of GKN1 expression in gastric carcinogenesis: A problem to resolve (Review)". International Journal of Oncology 55, no. 3 (2019): 555-569. https://doi.org/10.3892/ijo.2019.4843
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team