This article is mentioned in:

1. Introduction

The gastric epithelium is continually renewed over a lifetime, and is maintained through the proliferation and differentiation of pluripotent stem cells from the isthmus of the gastric gland (1). Stem cells generate precursors that migrate to the gastric lumen and, in turn, generate parietal, gastric zymogenic and foveolar cells. Parietal cells produce hydrochloric acid, while gastric zymogenic cells have a half-life of ~6 months and synthesize trefoil factor 2 and mucin 6 (1-3). Foveolar cells or surface mucous cells (SMCs), whose half-life is 2-3 days, produce mucous granules, mucin 5AC, gastrokine 1 (GKN1) and trefoil factor 1 (1-3) and play an important role in the restitution of the gastric mucosa in the event of Helicobacter pylori infection (4). The integrity and continuity of the gastric epithelium are rapidly restored after damage, prior to cell proliferation (5). Epithelial restitution is achieved through the migration of epithelial cells from the adjacent area or the cell stratum below the surface cells in the injured area. Epithelial cell restitution in the stomach of mammals takes place in minutes (5).

GKN1 is a protein secreted by SMCs of the gastric antrum and fundus (6), which contributes to maintaining gastric homeostasis, inhibits inflammation and acts as a tumor suppressor (7-16). The expression of GKN1 decreases due to H. pylori infection, inflammation or atrophy, and is absent in gastric cancer (17-25).

Although methylation of the GKN1 promoter (20), modification of histones (26) and proteasomal degradation of GKN1 in some cases (27) have been reported, the mechanisms that cause a decrease in GKN1 levels or its absence entirely have not been completely described. A total of ~10% of gastric tumors contain the Epstein-Barr virus (EBV), while the Epstein-Barr nuclear antigen 1 (EBNA1) binds to the promoter region of the GKN1 gene and induces the reduction of its transcription (28,29).

Epigenetic modifications are as important to the regulation of gene expression and the initial stages of disease as genetic modifications. Differential changes have been documented in the expression profile of microRNAs (miRNAs) in gastritis or cancer patients infected with H. pylori (17,30-33), gastric cancer cell lines (34-36), CD4 T lymphocytes, macrophages, monocytes and dendritic cells (37-39). It has been proposed that some components of H. pylori induce the activation of signals that modify the expression of miRNAs in the host cells, and that changes in the global expression profile of miRNAs are related to the genotype of the bacteria (31).

The reduction of GKN1 cannot be explained by mutations in its gene, the methylation of its promoter or the protea-somal degradation of the protein (20,26,27). It is probable that some miRNAs modulate the decreased translation of GKN1 mRNA and, consequently, the reduction of the level of protein in the gastric mucosa. The role of miRNAs in the regulation of GKN1 expression in the normal gastric mucosa, or mucosa infected with H. pylori, affected by preneoplasic lesions or with gastric cancer, has not been explored. The present review comprises an analysis of the information published on the regulation of GKN1 expression, proposing a model that integrates the probable regulatory mechanisms at the transcriptional, post-transcriptional and translational levels.

2. GKN1

GKN1 (also known as CA11, AMP-18, foveolin or TFIZ2) is a small protein of 181-184 amino acids, specifically expressed in the stomach. The GKN1 gene is located on chromosome 2p13.3 and is composed of six exons separated by relatively short introns (6). GKN1 is composed of: i) A hydrophobic signal peptide in the extreme NH2-terminal, whose processing generates a protein of 160 amino acids with a molecular mass of 18 kDa; ii) a BRICHOS domain with three conserved amino acid residues, one aspartic acid residue and two cysteine acid residues; and iii) a COOH-terminal domain (6,19,40-43). GKN1 is a member of the BRICHOS superfamily of proteins, which includes proteins associated with the development of cancer. It is a protein with both an autocrine and paracrine function, which promotes the healing of the mucosa and facilitates cellular restitution and proliferation (43). GKN1 modulates the progression of the cell cycle, cellular proliferation and viability, and apoptosis.

Additionally, GKN1 regulates the production of reactive oxygen species (ROS) and the PI3K/Akt signaling pathway, thus influencing epithelial mesenchymal transition (EMT) and the migration of cancerous cells. GKN1 significantly inhibits the expression of the mRNA of DNA (cytosine-5)-methyltransferase 1 (DNMT1) and histone-lysine N-methyltransferase EZH2 (EZH2) and the activity of DNMT1, functions that link this protein to the inhibition and progression of cancer (43,44).

In the normal gastric mucosa, GKN1 is expressed by epithelial cells on the surface, but not at the depth of the glands of the gastric mucosa (21,45,46). GKN1 reduces the expression of the gastrin receptor, gastrin/cholecystokinin type B receptor, thus inhibiting the cell proliferation induced by this hormone (13). GKN1 activates the p16/Rb and p21 signaling pathways, inhibits cell growth and drives cells to senescence (46). GKN1 modulates the expression of cytokines and other inflammatory mediators associated with gastric carcinogenesis, inducing the increased expression of interleukin (IL)-8 and IL-17 and the decreased expression of nuclear factor (NF)-κB, IL-6 and IL-10. Thus, it regulates the immune response and inhibits the progression of epithelial gastric cells to cancerous cells. GKN1 suppresses the activation of NF-κB, and thus inhibits the onco-genic signaling regulated by this transcription factor (9).

3. GKN1, H. pylori infection and gastric cancer

GKN1 and H. pylori infection. Infection with H. pylori cagA+ strains increases the risk of gastric cancer and is related to the reduced expression of GKN1 in the mucosa (47). In mice infected with H. pylori-cagA+, the increased expression of the antiapoptotic proteins Bcl-2, Bcl-XL and induced myeloid leukemia cell differentiation protein Mcl-1, as well as NF-κB and proteins related to EMT, is found, while the expression of p53, p21, p16 and stress response genes decreases (48). The ectopic expression of GKN1 suppresses the effects of H. pylori-cagA+ in the human gastric cancer cell lines AGS, MKN1 and MKN28. Based on these findings, it has been suggested that GKN1 suppresses the malignant transformation of gastric epithelial cells and the progression to gastric cancer (48).

The expression of GKN1 decreases at the mRNA and protein levels in dyspeptic patients and is not detected in the mucosa of subjects with intestinal-type gastric cancer, both with and without H. pylori infection (19,20,21,22,30,49-52), or with a diffuse-type cancer (19,23,25).

GKN1 and gastric cancer

GKN1 is absent in human gastric tumors and acts as a tumor suppressor, regulating cell proliferation, apoptosis, migration and invasion in gastric cancer cell lines (10). Stimulating the expression of Fas receptor and the activation of caspase-3, this protein modulates apoptotic signals, playing an important role in the repair of tissues during the early stages of neoplastic transformation (7).

In AGS, MKN-1 and MKN-28 gastric cancer cell lines transfected with GKN1, the re-expression of p16 and a reduction in CDK4, cyclin D1 and E2F levels was observed (8) In gastric cancer SGC7901 cells, GKN1 reduces the expression of MMP2, through the deactivation of NF-κB (15), and induces the expression of miRNA (miR)-185. The extreme 3′ untranslated region (UTR) of RhoA mRNA has sequences with affinity to miR-185 and, when this hybrid miRNA with RhoA mRNA reduces its translation, the silencing of RhoA is indirectly mediated by GKN1. c-Myc is a transcription factor that activates RhoA expression and is a target of miR-34a, a miRNA whose expression is promoted by GKN1. Thus, GKN1 also deactivates RhoA via miR-34a. These data suggest that GKN1 inhibits cell motility and invasion by means of the deactivation of RhoA (16).

4. GKN1 as a potential biomarker of gastric carcinogenesis

In ~80% of gastric cancer cases, symptoms are scarce and non-specific at the early stages of the disease, with the majority of patients diagnosed at an advanced stage with metastasis already occurring (44,53). Thus, the treatment of this malignancy is ineffective and the prognosis for patients is unfavorable. Due to the late diagnosis and consequent limited therapy options for most patients, the 5-year survival rate is <20% (54). The lack of criteria and useful markers for early diagnosis has led to studies being conducted on the expression of genes associated with gastric carcinogenesis, with the objective of identifying biomarkers characteristic of premature stages of the disease. GKN1 is one of the proteins considered to be potential biomarker of carcinogenesis.

There are few reports in the available literature on the identification of GKN1 in samples taken from patients. Nardone et al (17) identified the presence of GKN1 in human gastric tissue, finding that its expression decreases in the event of H. pylori infection, deteriorates progressively from chronic gastritis to atrophic gastritis, and is not detected in areas in which intestinal metaplasia or H. pylori-positive tumors are found (17). GKN1 is absent in cases of gastric cancer without H. pylori infection (17-25). Villano et al (55) analyzed the level of GKN1 mRNA in serum taken from patients with gastric cancer and apparently healthy volunteers, finding no statistically significant differences between patients with cancer and healthy volunteers. The aforementioned results indicate that GKN1 mRNA is not a useful biomarker for the diagnosis of gastric cancer (55). Yoon et al (56) found that the serum levels of GKN1 are significantly lower in gastric cancer patients than in either apparently healthy subjects or patients with hepatocel-lular and colorectal carcinoma (P<0.0001). These data suggest that the serum levels of GKN1 may be used for the differentiation of patients with gastric cancer from those with other malignancies of the digestive system and clinically healthy subjects. The authors concluded that the serum concentration of GKN1 may be an informative diagnostic biomarker for gastric cancer (56). Dokhaee et al (44) reported that GKN1 mRNA is significantly reduced in the gastric tissue of patients with gastric cancer, compared to normal tissue. The results led to the hypothesis that GKN1 may be a reliable biomarker for the detection of gastric cancer in its early stages.

The aforementioned data indicate that the measurement of circulating GKN1 concentration, the protein or the mRNA in gastric tissue may be of utility for the early diagnosis of cancer. However, it is necessary to strengthen these findings with more research in patients with preneoplasic lesions (atrophic gastritis, intestinal metaplasia and dysplasia) and cancer in distinct stages of evolution.

5. Regulation of GKN1 expression in mucosa infected with H. pylori or with gastric cancer

At the chromosomal level, cytogenetic aberrations, such as duplications, translocations, deletions or the loss of heterozygosity in the 2p13 chromosome (in which the GKN1 gene is found) have not been detected (57,58).

The sequence of the GKN1 gene was analyzed in 81 gastric tumors and 40 adenomas, confirming a lack of mutations (20) These data suggested that the reduction of GKN1 cannot be attributed to cytogenetic aberrations or mutations, and that other mechanisms are involved in the deregulation of this protein.

Gene expression is regulated at different levels, from transcription to translation (59). At the transcriptional level, regulation occurs via epigenetic modifications, such as the modification of histones and the methylation of DNA (60,61). At the post-transcriptional level, the role of small RNAs (miRNAs) in the modulation of translation should be taken into account (62), while at post-translational level, ubiquitination, followed by the proteasomal degradation of the marked protein, is the best-known mechanism involved in the reduction in cytoplasmic levels of proteins (61).

Transcription factors

Transcription factors are able to activate or repress the expression of a gene (63,64). Little is known about the transcriptional regulation of GKN1. Yoon et al (65), using luciferase and chromatin immunoprecipitation assays, confirmed that NKX6.3 is a transcription factor for GKN1, and located the recognition sequence corresponding to NKX6.3 in the promoter region of the GKN1 gene (Fig. 1A). NKX6.3 positively modulates the transcription of GKN1, which is reflected in the increased level of both mRNA and protein (65).

Figure 1 Regulation of GKN1 expression. (A) NKX6.3 is the only transcription factor validated as a positive regulator of GKN1 transcription. It is likely that another transcription factor or factors act as activators or repressors of GKN1 transcription during the infection of the gastric epithelium by H. pylori. Evidence indicates that H. pylori activates different signaling pathways that induce the expression of various transcription factors. The decrease in or loss of GKN1 expression in gastric cancer may be a consequence of: (B) GKN1 promoter methylation; (C) EBNA1 binding to the transcriptional complex; or (D) histone modification, such as trimethylation of lysine 9 in histone 3. Additionally, it is possible that the GKN1 mRNA is targeted by some miRNAs. By in silico analysis, miRNAs were found with sequences complementary to sites located in the 3' untranslated region of GKN1 mRNA, and are likely to contribute to its negative post-transcriptional regulation through: (E) Inhibition of translation; or (F) mRNA degradation. The expression of the proposed miRNAs may or not be induced by H. pylori. GKN1 is degraded in the cytoplasm of epithelial cells when (G) the ubiquitin ligase UBR5 marks GKN1 for its degradation in the proteasome. These and other mechanisms can act synergistically to promote the diminution or silencing of GKN1 expression, manifesting as a decreased or absent mRNA and protein expression in gastric tissue or in the circulation. Figure created using BioRender. com. TFs, transcription factors; GKN1, gastrokine 1; UBR5, E3 ubiquitin-protein ligase UBR5; EBNA1, Epstein Barr nuclear antigen 1; EBV, Epstein Barr virus; RISC, RNA-induced silencing complex; H. pylori, Helicobacter pylori; miRNA, microRNA; Ub, ubiquitin; NF-κB, nuclear factor-κB; TSS, transcriptional start site.

By means of in silico analysis, conducted using the MatInspector (66) (http://www.genomatix.de/matinspector.html), AliBaba2.1 (67) (http://gene-regulation.com/pub/programs/alibaba2/index.html) and TfsiteScan 68) (http://www.ifti.org) programs, transcription factors were identified with affinity to recognition sequences in the GKN1 promoter region (Fig. 2A and Table I). It is likely that one or more of these transcription factors, predicted bioinformatically, are involved in the transcriptional regulation of GKN1. Experimental confirmation of the effect exerted by the proposed transcription factors on the modulation of GKN1 expression will improve understanding of the mechanisms involved in the regulation of the expression of this protein.

Figure 2 Transcription factors and miRNAs predicted in silico as regulators of GKN1 expression. By in silico analysis (A) transcription factors were identified with affinity to recognition sequences in the GKN1 promotor region and (B) miRNAs were found with sequences complementary to sites located in the 3'UTR of GKN1 mRNA. It is likely that the transcription factors act as activators or repressors of the transcriptional regulation of GKN1, and the miRNAs contribute to post-transcriptional regulation, inhibiting translation or inducing mRNA degradation. Figure created using BioRender.com TSS, transcriptional start site; UTR, untranslated region; miRNA/miR, microRNA; GKN1, gastrokine 1; GATA3, T-cell-specific transcription factor GATA-3; NFAT, nuclear factor of activated T cells; CEBPα, CCAAT enhancer binding protein-α; AP-1, AP-1 transcription factor; Sp1, transcription factor Sp1; CREB, cyclic AMP-responsive element-binding protein 3-like protein 4.

Table I Transcription factors with affinity to binding sequences in the gastrokine 1 gene promoter region.

Table I

Transcription factors with affinity to binding sequences in the gastrokine 1 gene promoter region.

Transcription factor	Number of binding sites	Binding sequence	Genomic position of binding sequencea
GATA-3	7	CAGAGATAAAATG	68974044-68974056
CEBPα	7	GAAATTGAGGAAGGT	68974539-68974553
Oct-1	6	GTCATGCAATTGATC	68973972-68973986
AP-1	4	TGATGAGTCAGGT	68974444-68974456
STAT-3	3	AGGTTTCCTGGTACACTGG	68974502-68974520
Sp1	2	GCTGTGGGCGTGAGTAT	68974361-68974377
STAT-1	1	AGTGTACCAGGAAACCTTT	68974500-68974518
CREB	1	AGGGTCCTATGTAATAAGATT	68973801-68973821
NFAT	1	CTTTGGAAATCTTATTACA	68973794-68973812

a Data obtained from MatInspector. GATA-3, T-cell-specific transcription factor GATA-3; CEBPα, CCAAT enhancer binding protein-α; AP1-1, AP-1 transcription factor; Sp1, transcription factor Sp1; CREB, cyclic AMP-responsive element-binding protein 3-like protein 4 NFAT, nuclear factor of activated T cells.

In patients with gastric pathology, in murine models or in gastric epithelial cell lines, the expression of trans-acting T-cell-specific transcription factor GATA-3 (GATA-3), STAT-1, STAT-3, transcription factor Sp1 (Sp1), cyclic AMP-responsive element-binding protein 3-like protein 4 (CREB), AP-1 transcription factor (AP-1) and Oct-1 increases, while the levels of CCAAT enhancer binding protein-α (CEBPα) and NKX6.3 decrease (65,69-82). The expression of GATA-3 was found to have increased at different stages of the carcinogenesis associated with H. pylori in patient biopsies, murine models and human gastric epithelial cells (73,74).

CagA and OipA of H. pylori induce the activation of transcription factors such as AP-1, NF-κB, STAT-3, CREB and nuclear factor of activated T cells (NFAT), which favor the expression of IL-6, and cytokines, which promote inflammation (83-89). IL-6 stimulates the activation of the signaling pathway gp130/STAT3 in gastric cancer cell lines (90), while CagA stimulates the expression of the NFAT transcription factor in AGS cells (88).

The protein Tipα, produced by H. pylori, activates the IL-6/STAT3 pathway (89). H. pylori cagA+ strains induce signaling through the MAPK pathway, thus increasing proliferation and activating transcription factors such as AP-1 (70). Through toll like receptor (TLR)2 and TLR9, H. pylori activates the MAPK pathway and, downstream, the factors AP-1 and CREB, which positively regulate the transcription of cyclooxygenase 2 (COX-2) (91). CREB and STAT-3 are activated by H. pylori and positively regulate the transcription of COX-2 in gastric epithelial cells (72,83). Increased STAT-3 expression has been found in biopsies of the gastric mucosa infected with H. pylori cagA+ (80), as well as in cell lines and murine models (86). CagA promotes the phosphorylation of STAT-3 in gastric epithelial cells (92).

In vitro and in vivo experiments have shown that the protein OipA of H. pylori stimulates the phosphorylation of STAT-1 (93) and that H. pylori alters the STAT-1 signaling induced by IFN-γ in gastric epithelial cells. This event may represent an adaptation of the bacteria in order to modulate the immune response of the host mucosa, allowing the bacteria to survive in the stomach (94).

The expression level of the Sp1 transcription factor increases in gastric adenocarcinoma and is related to the cancer stage, the depth of infiltration and an unfavorable prognosis for patients (82). The expression of Sp1 differs between intestinal-type and diffuse-type cancer, while low-level expression of Sp1 is related to the progression and metastasis of intestinal-type cancer, in contrast to diffuse-type cancer (95). Sp1 is essential in the regulation of genes that determine the characteristics of cancer (96). In AGS cells, the ERK1/2 signaling pathway, activated in response to H. pylori infection, in turn activates Sp1, which modulates the transcription of vascular endothelial growth factor-A (69). It is probable that the factors AP-1, Oct-1, STAT-1, STAT-3, GATA-3, Sp1, CREB and NFAT, with recognition sequences in the GKN1 promotor and being activated by H. pylori, repress the transcription of GKN1 in infected mucosa or mucosa with gastric cancer.

In normal gastric mucosa, CEBPα is expressed in the foveolar epithelium and is reduced in the tumor tissue of patients with gastric cancer (79), and in the cell lines MKN45 and MKN74 (97). The ectopic expression of CEBPα in gastric cancer cell lines reduces cell viability (97). The level of CEBPα expression gradually decreases in line with the advancing carcinogenesis associated with H. pylori infection (73). Given the function of CEBPα in the regulation of the viability of cancerous cells and the fact that GKN1 and CEBPα levels gradually decrease in line with the progress of the lesion, it is probable that this factor is an activator of GKN1 transcription. The reduced expression of CEBPα and NKX6.3 in gastric cancer may be due to the negative regulation mediated by microRNAs.

DNA methylation

Changes in the methylation of DNA lead to changes in gene expression. The hypermethylation of CpG islands located in the promoter region of a gene results in the decrease or silencing of the expression of the gene.

The methylation of the GKN1 promoter was previously studied, finding hypermethylation in the CpG islands of the promoter region in only two of 25 gastric tumors. This evidence indicates that the low or null GKN1 expression in the inflamed tissue, either tumoral or infected by H. pylori, is not due to the methylation of its promoter in all cases (Fig. 1B) (20).

The protein EBNA1 of EBV is able to bind to the promoter region of various genes of the host (28). It has been found to have an affinity with the sequences contained in the GKN1 promoter and, binding at these sites, contributes to the deregulation of GKN1 in gastric cancer associated with Epstein-Barr infection (Fig. 1C) (29). Only a small proportion of gastric tumors contain EBV.

Histone modification

The modification of histones is an epigenetic mechanism influencing gene expression. Altieri et al (26) analyzed six gastric tumors in order to determine whether histone modification contributes to GKN1 regulation. Chromatin immunoprecipitation assays were conducted on a fragment of 600 pb of the GKN1 gene promoter, including the 5′UTR, finding trimethylation in lysine 9 of histone 3 (H3K9triMe), among bases -148 and -310 of the GKN1 gene promoter in the six gastric tumors. H3K9triMe is a gene repression marker that generates binding sites for histone deacetylase I (HDAC1) (98) (Fig. 1D). The inhibition of HDAC1 activity with trichostatin A, a hypomethylating agent, is related to increased GKN1 mRNA levels but not to the protein itself. These findings suggest that the regulation of GKN1 may occur at the post-transcriptional level via miRNAs (26).

miRNAs

In the gastric mucosa, miRNAs can be expressed by epithelial cells, infiltrating inflammatory cells, transformed cells or cancerous cells (31). In the regulation of gene expression, miRNAs inhibit the translation or induce the degradation of target transcripts. It is likely that some miRNAs impede the translation of GKN1 mRNA and, consequently, are responsible for the reduction in the protein level, although there are no reports indicating whether a miRNA is involved in the regulation of GKN1 expression to the best of our knowledge.

In order to explore whether GKN1 mRNA has binding sites for one or more miRNAs, an in silico analysis was conducted using programs for predicting miRNA targets: TargetScan (99) (2015, http://www.targetscan.org), miRanda (100) (http://www.microrna.org), miRDB (101) (http://mirdb.org), miRSystem (102) (http://mirsystem.cgm.ntu.edu.tw/index.php) and DianaTools (103) (http://www.microrna.gr/microT-CDS), based on thermodynamic and base complementarity analysis. miRNAs were found with sequences complementary to sites located in the 3′UTR region of GKN1 mRNA (Fig. 2B), four of which are able to hybridize with canonical sites of GKN1 mRNA and possess two or three guanine or cytosine residues in the seed region of the miRNA, conferring them greater binding stability. An adenine in position 1 of the 3′UTR region of GKN1 mRNA ensures the recognition of the transcript by the RNA-induced silencing complex. These characteristics increase the probability that a miRNA will interact with the 3′UTR of GKN1 mRNA (Table II).

Table II miRNAs proposed as a candidate to regulate GKN1 expression.

Table II

miRNAs proposed as a candidate to regulate GKN1 expression.

miRNAa	3'UTR GKN1b	miRNA recognition site																						Site type
hsa	46-53	GKN1 5′	u	c	u	g	a	a	u	a	u	g	c	u	g	U	G	C	A	G	A	A	A	8mer
miR-544a		miRNA 3′	u	u	g	a	a	c	g	a	u	u	u	u	u	A	C	G	U	C	U	U	A
hsa	70-77	GKN1 5′	u	a	u	g	g	g	c	u	c	c	a	g	u	G	G	U	U	U	U	U	A	8mer
miR-548d-3p		miRNA 3′	g	u	u	u	u	c	a	u	u	g	a	u	a	C	C	A	A	A	A	A	C
hsa	30-37	GKN1 5′	a	c	u	a	u	g	g	a	u	u	u	a	g	U	C	A	U	C	U	G	A	8mer
miR-1245b-3p		miRNA 3′	u	a	u	c	c	g	g	a	a	a	u	c	u	A	G	U	A	G	A	C	U
hsa	33-40	GKN1 5′	a	u	g	g	a	u	u	u	a	g	u	c	a	U	C	U	G	A	A	U	A	8mer
miR-892c-5p		miRNA 3′	a	c	u	g	a	c	c	g	u	g	g	a	a	A	G	A	C	U	U	A	U

a Programs used for predicting miRNA targets: TargetScan7.1, miRanda, miRDB, miRSystem and DianaTools. Capital letters indicate the seed region of each miRNA. The complementary sequences to the canonical sites in GKN1 mRNA are in bold.

b Position in which the complementary sequences to the miRNA are found. miRNA/miR, microRNA; GKN1, gastrokine 1.

Multiple prediction programs may be used to locate binding sites for miRNAs in gene transcripts. The results of the analysis facilitated the selection of miRNAs with a higher probability of binding to their target, miR-544a was predicted by five programs, according to the aforementioned criteria. It is highly probable that miR-544a is a regulator of GKN1 (104,105). This proposal is strengthened by experimental data on the expression of miR-544a, which is found at increased levels in gastric cancer cell lines (106). To the best of our knowledge, research has not been conducted on the expression of hsa-miR-1245b-3p, hsa-miR-892c-5p and hsa-miR-548d-3p in the gastric mucosa, be that infected, inflamed, atrophic or with gastric cancer. However, the results of the in silico analysis suggested a high probability that these miRNAs regulate the expression of GKN1, either inhibiting the translation of the transcript or promoting its degradation (Fig. 1E and F).

Currently, >5,000 miRNAs are registered on miRBase, while in silico predictions estimate that more than one-third of the human transcriptome can be regulated by miRNAs. In gastric cancer, inflammatory processes and H. pylori infection, miRNAs fulfil an important function in the deregulation of gene expression (31,33). GKN1 is absent in cancer, both with and without H. pylori, and is reduced in patients with gastritis, in gastric mucosa infected by H. pylori and in atrophic gastritis (30). The reduction in or absence of GKN1 transcripts or protein is not completely explained by the studied mechanisms of transcriptional and post-translational regulation. It is likely that some miRNAs regulate GKN1 expression directly or indirectly at the post-transcriptional level.

It has been reported that ROS deregulate the expression of miRNAs in tissue infected with H. pylori or gastric cancer tissue (107,108). It is also known that ROS induce a decrease in the number of copies of GKN1 mRNA in tissue infected by H. pylori (48). These data support the hypothesis that, in H. pylori infection, ROS alter the expression of miRNAs, among which are those with the GKN1 transcript as a target. The cytotoxins VacA and CagA, lipopolysaccharide and peptidoglycan, among other components of H. pylori, are able to induce the increased expression of miRNAs that inhibit translation or induce the degradation of the GKN1 transcript, thus modulating the decrease in the levels of this protein.

From the first stages of H. pylori infection, the inflammation associated with it causes changes in the expression of proteins and miRNAs, alterations in cell signaling, and unbalanced cell proliferation and apoptosis in gastric epithelial cells, promoting the progression of gastritis to pre-neoplastic and neoplastic lesions (109). The abnormal expression of miRNAs is common in different types of cancer (110), with the evidence indicating changes in the expression profiles of miRNAs in gastric cancer and in mucosa infected by H. pylori.

Alterations in the expression of miRNAs can manifest either as increases or decreases (111). In the gastric mucosa, both with and without H. pylori infection, it has been found that miRNAs with changes in their expression levels in response to H. pylori can be similar to or different from those observed in gastric cancer with a negative result for bacteria (31) (Tables III and IV). Chang et al (33) found that hsa-miR-99b-3p, hsa-miR-564 and hsa-miR-658 expression increased in cancerous tissue infected with H. pylori, while hsa-miR-204-5p, hsa-miR-338-5p, hsa-miR-375 and hsa-miR-548c-3p were found to be overexpressed in cancer tissue without H. pylori (33).

Table III miRNA expression in patients and in vitro models with H. pylori infection.

Table III

miRNA expression in patients and in vitro models with H. pylori infection.

Author, year	Model		H. pylori strain	Method used to determine miRNA expression	Upregulated miRNAs	Downregulated miRNAs	Refs.
Cho et al, 2016	Murine	C57BL/6 mice	SS1	Mouse whole genome miRNA array (Agilent Technologies, Inc.) release 15	-	mmu-miR-1 mmu-miR-133a mmu-miR-133b mmu-miR-203 mmu-miR-205 mmu-miR-490-3p	(116)
Belair et al, 2011	Intestinal type gastric cancer cell lines	AGS	26695	Reverse transcription-quantitative PCR	hsa-miR-21	hsa-miR-371-3p hsa-miR-372 hsa-miR-373 hsa-miR-19b hsa-miR-160b hsa-miR-320	(117)
Santos et al, 2017		AGS	26695 y P12	Cancer Pathway Finder miRNA PCR Array (MIHS-102Z; Qiagen, Inc.)	hsa-miR-150-5p hsa-miR-155-5p hsa-miR-3163		(35)
Chang et al, 2015	Patients diagnosed with gastric cancer	Eight intestinal type gastric cancer patients with H. pylori infection	No data	Human miRNA microarray (Agilent Technologies, Inc.), release 16.0	hsa-miR-32-3p hsa-miR-514a-3p hsa-miR-181c-3p hsa-miR-146a-5p hsa-miR-4319 hsa-miR-99b-3p hsa-miR-543 hsa-miR-564 hsa-miR-645 hsa-miR-431-3p hsa-miR-650 hsa-miR-638 hsa-miR-139-3p hsa-miR-508-3p hsa-miR-2355-3p hsa-miR-934 hsa-miR-548f hsa-miR-1304-5p	-	(33)

[i] H. pylori, Helicobacter pylori; miR/miRNA, microRNA.

Table IV miRNAs expression in cell lines and patients with gastric Cancer, grouped based on Lauren's Classification (118).

Table IV

miRNAs expression in cell lines and patients with gastric Cancer, grouped based on Lauren's Classification (118).

Author, year	Model		Mefhod used to determine the miRNAs expression	Upregulated miRNAs		Downregulated miRNAs	Refs.
Yu e tal, 2012	Intestinal type gastric Cancer cell lines	NCI-N87 AGS MKN28 BGC-823 SGC-7901	Human microRNA Microarray v.2 (Agilent Technologies), containing probes for 723 human microRNAs	hsa-miR-196a hsa-miR-615 hsa-miR-196b hsa-miR-92b hsa-miR-149		hsa-miR-376a hsa-miR-145 hsa-miR-143 hsa-miR-451 hsa-miR-142-5p	(119)
	Diffuse type gastric Cancer cell lines	SNU-1 SNU-16 KATO III MKN45		hsa-miR-550 hsa-miR-183 hsa-miR-301 hsa-miR-18a hsa-miR-106a hsa-miR-17-5p hsa-miR-18b hsa-miR-19a hsa-miR-221 hsa-miR-93 hsa-miR-20a		hsa-miR-1 hsa-miR-377 hsa-miR-495 hsa-miR-409-3p hsa-miR-368 hsa-miR-142-3p hsa-miR-150 hsa-miR-497 hsa-miR-214 hsa-miR-199a hsa-miR-146b hsa-miR-133b hsa-miR-127 hsa-miR-381 hsa-miR-195 hsa-miR-648 hsa-miR-223 hsa-miR-135a hsa-miR146a hsa-miR-136 hsa-miR 126 hsa-miR-29c hsa-miR-572
Guo et al, 2009	Patients diagnosed with gastric Cancer	Intestinal type	μParaflo™ microfiuidic chip (LC Sciences)	hsa-miR-31 hsa-miR-133b hsa-miR-139-5p hsa-miR-195 hsa-miR-378 hsa-miR-497 hsa-miR-768-3p		hsa-miR-17 hsa-miR-18a hsa-miR-18b hsa-miR-19a hsa-miR-20a hsa-miR-20b hsa-miR-21 hsa-miR-106a hsa-miR-106b hsa-miR-340 hsa-miR-421 hsa-miR-658	(120)
Udea et al, 2010			ArrayExpress, v3.0 (European Bioinformatics Institute), contains 1,100 microRNA probes, 326 human and 249 mouse	hsa-miR-373 hsa-miR-498 hsa-miR-202 hsa-miR-494	-		(121)
Tsukamoto et al, 2010		Diffuse type	G4470A Human MiRNA Microarray (Agilent Technologies, Inc.), of 470 human and 64 virus mature miRNAs based on Sanger miRBase release 9.1	hsa-miR-18a hsa-miR-106a hsa-miR-17-5p hsa-miR-146a hsa-miR-93 hsa-miR-19a hsa-miR-20a hsa-miR-20b hsa-miR-25 hsa-miR-15b hsa-miR-425-5p hsa-miR-92 hsa-miR-194 hsa-miR-10a hsa-miR-222 hsa-miR-7 hsa-miR-106b hsa-miR-320 hsa-miR-21 hsa-miR-34a hsa-miR-19b hsa-miR-103 hsa-miR-215 hsa-miR-192 hsa-miR-429 hsa-miR-279 hsa-miR-223 hsa-miR-23a hsa-miR-107 hsa-miR-200b hsa-miR-24 hsa-miR-15a hsa-miR-16	hsa-miR-375 hsa-miR-29c hsa-miR-148a hsa-miR-30a-5p hsa-miR-30e-5p hsa-miR-638		(122)
Su et al, 2012			AFFX miRNA expression chips (Affymetrix; Thermo Fisher Scientific, Inc.)	hsa-miR-455-3p hsa-miR-34a	hsa-let-7g hsa-miR-200b hsa-miR-768-3p hsa-let-7d hsa-miR-104-3p hsa-miR-27b hsa-miR-1207-5p hsa-miR-663 hsa-miR-486-5p hsa-miR-222 hsa-miR-574-3p hsa-miR-768-5p hsa-miR-378 hsa-miR-31		(123)
Juzenas et cd, 2015			TaqMan Array Human MiRNA Card A v2.1 (Applied Biosystems; Thermo Fisher Scientific, Inc.), include 377 human miRNAs of miRBase v20	hsa-miR-146b-5p hsa-miR-155-5p hsa-miR-214-3p hsa-miR-223-3p hsa-miR-224-5p hsa-miR-331-3p hsa-miR-484	hsa-let-7a-5p hsa-let-7g-5p hsa-miR- 135a-5p hsa-miR-148a-3p hsa-miR-204-5p hsa-miR-26b-5p hsa-miR-30b-5p hsa-miR-375		(124)
Katada et cd, 2009			TaqMan miRNA assays	hsa-miR-34b hsa-miR-34c hsa-miR 128a	hsa-miR128b hsa-miR-129 hsa-miR-148a		(125)
Ueda et cd, 2010			ArrayExpress, Version 3.0 (European Bioinformatics Institute), A-MEXP-620, contains 1,100 microRNA probes, 326 human and 249 mouse	hsa-miR-105 hsa-miR-100 hsa-miR-125b hsa-miR-199a hsa-miR-99a hsa-miR-143 hsa-miR-145 hsa-miR133a			(121)

[i] miRNA/miR, microRNA.

In infected mucosa, hsa-miR-223 expression was found to be increased, while in mucosa without H. pylori, hsa-miR-203, hsa-miR-204, hsa-miR-455, hsa-miR-141 and hsa-let-7f were found to be overexpressed (31). The levels of let-7, miR-125a and miR-500 were found to be significantly reduced in cells infected with cagA+ strains, although not in those infected with cagA− strains. These results indicate that miRNAs participate in gastric pathogenesis, whether associated and not associated with H. pylori, and suggest that the CagA oncoprotein of H. pylori regulates the differential expression of miRNAs in epithelial gastric cells (31). Increased hsa-miR-127-5p, hsa-miR195, hsa-miR-196a, hsa-miR-206, hsa-miR-216 and miR-488 expression has been found, while decreased hsa-miR-103, hsa-miR-141, hsa-miR-17-3p, hsa-miR34a and let-7i expression has been found in gastric epithelial cells infected with different H. pylori-cagA+ strains (36).

H. pylori is able to modify the expression of miRNAs by means of inflammatory effectors (112). In gastric epithelial cells, the pro-inflammatory cytokines IL-8, tumor necrosis factor-α and IL-1β induce the expression of miR-146a (113), while the oncoprotein CagA positively regulates c-myc, which is related to the decreased expression of miR-26a and miR-101. The decrease in the expression of these miRNAs contributes to increased levels of the histone methyltransferase EZH2 and methyltransferase DNMT3B, which promote the methylation of the let-7 promoter (114).

Ubiquitination

E3 ubiquitin-protein ligase UBR5 (UBR5) is an E3 ubiquitin ligase that participates in the ubiquitin-proteasome system, regulating protein concentration via ubiquitination and degradation, and is deregulated in different types of cancer (115). UBR5 increases in the cancerous tissues of gastric cancer patients, while an interaction between UBR5 and GKN1 has been observed through immunoprecipitation assays. These results suggest that UBR5 participates in the ubiquitination of GKN1, and that at least part of this protein is sent to be degraded by the proteasome (27) (Fig. 1G). Thus, UBR5 contributes to the regulation of gastric carcinogenesis, inducing the degradation of tumor suppressing proteins, such as GKN1 (27).

Therefore, promoter methylation, trimethylation of histones and ubiquitination are mechanisms that contribute to the regulation of the GKN1 expression in gastric cancer; however, they do not explain the absence of the protein in cell lines and cancerous human tissue.

6. Conclusion

GKN1 plays an important role in the maintenance of gastric homeostasis. In inflamed mucosa, both with and without H. pylori infection, GKN1 levels decrease, while this protein is absent in gastric cancer. The measurement of circulating GKN1 concentration, the protein itself or its mRNA in gastric tissue could be useful for the early diagnosis of cancer. However, little is known about the mechanisms that explain the reduction or silencing of GKN1 expression in gastric carcinogenesis. No mutations or polymorphisms have been found in the GKN1 promoter region, which explains the reduction in the levels of this protein. While the modification of histones seems to be involved in the transcriptional regulation of GKN1, further research is required to confirm its level of participation in the regulation of GKN1 in the population. The information available suggests that the methylation of the GKN1 promotor is an epigenetic mechanism that reduces the transcription rate of the gene. However, this mechanism only occurs in some cases of gastric cancer and, moreover, it is probable that it is determined by the genetic characteristics of the individual or the presence of EBV in the tumor. While only factor NKX6.3 has been confirmed as a positive regulator of GKN1 transcription, in silico analysis suggests the existence of other transcription factors with affinity for sequences in the GKN1 promotor region, among which are GATA-3, CEBP-α, Oct-1, AP-1, STAT-3, SP1, STAT-1, CREB and NFAT. It is unknown whether miRNAs regulate GKN1 expression at the post-transcriptional level. In silico analysis revealed that hsa-miR-544a, hsa-miR1245b-3p, hsa-miR-892c-5p and hsa-miR-548d-3p have sequences complementary to sites located in the 3′UTR of GKN1 mRNA. It is likely that, together, they regulate the expression of GKN1 in vivo, in mucosa infected by H. pylori or in gastric cancer (Fig. 1). Functional studies are required to show whether miRNAs play a role in the regulation of GKN1 expression. At the post-translational level, UBR5 mediates the ubiquitination of GKN1, marking it for degradation in the proteasome; however, this mechanism does not explain the absence or minimal level of GKN1 expression in gastric cancer. Clarifying the mechanisms that regulate GKN1 expression will contribute useful information for evaluating the possible clinical applications for the detection of this protein in mucosa, or in the circulation of patients with gastric diseases both associated and not associated with H. pylori.

Funding

This work was supported by a doctoral fellowship from CONACYT to JAM (grant no. 296364).

Availability of data and materials

Not applicable.

Authors' contributions

JAM, DNMC, OPZ and GFT contributed the idea, wrote the text, and generated the tables and the figure.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declares that they have no competing interests.

Acknowledgments

Not applicable.

References