Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular and Clinical Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9450 Online ISSN: 2049-9469
Journal Cover
September-2016 Volume 5 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2016 Volume 5 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Detection of exostosin glycosyltransferase gene mutations in patients with non‑hereditary osteochondromas of the mandibular condyle

  • Authors:
    • Qin Zhou
    • Chi Yang
    • Min‑Jie Chen
    • Ling‑Zhi Li
  • View Affiliations / Copyright

    Affiliations: Department of Oral and Maxillofacial Surgery, Ninth People's Hospital, Shanghai Key Laboratory of Stomatology, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, P.R. China, Department of Stomatology, Huashan Hospital, Fudan University, Shanghai 200438, P.R. China
  • Pages: 295-299
    |
    Published online on: July 8, 2016
       https://doi.org/10.3892/mco.2016.955
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Exostosin glycosyltransferase (EXT) 1 and EXT2 have been identified as causative genes in osteochondroma; however, it is not known whether these genes are also involved in condylar osteochondromas. The aim of this study was to identify EXT1 and EXT2 mutations in patients with non‑hereditary osteochondromas of the mandibular condyle. DNA was obtained from resected tissues (cartilage cap) of 12 patients with solitary condylar osteochondromas. The exons, 3',5'‑untranslated regions and intron‑exon boundaries of EXT1 and EXT2 were amplified by polymerase chain reaction and the products were sequenced directly. Through direct sequencing, four genetic variations of EXT1 in 4 cases and three variations of EXT2 in 5 cases were identified. The intronic alteration of the EXT2 gene, occurring in 2 cases, was novel, whereas the other alterations had been previously reported. Nonsense somatic mutations were detected in tumor DNA. Our study extended the mutational spectrum in EXT1 and EXT2 and may facilitate a better understanding of the pathophysiology of condylar osteochondromas.

Introduction

Osteochondroma is a cartilage-capped bony projection arising from the external surface of bone, containing a marrow cavity that is continuous with that of the underlying bone (1). Osteochondroma is the most common benign bone tumour, mainly arising in the juxta-epiphyseal region of long bones (1). Approximately 15% of osteochondromas occur in the context of multiple osteochondromas (MO), previously referred to as hereditary multiple exostoses, which is an autosomal dominantly inherited disorder (2,3), while the majority of osteochondromas present as solitary (non-hereditary) lesions. Solitary and multiple osteochondromas are histologically indistinguishable (4). Osteochondromas have been associated with defects in the exostosin glycosyltransferase (EXT) 1 gene on chromosome 8q24.11-q24.13 (MIM 608177) and EXT2 on chromosome 11p12-p11 (MIM 608210) (5–7).

Osteochondroma may be an incidental finding, or diagnosed due to secondary events, such as esthetic or mechanical problems. Osteochondromas of the mandibular condyle have been associated with facial asymmetry, preauricular pain or edema, occlusal disorders, limitation of mouth opening, even condylar neck fracture. The most severe complication is malignant transformation into chondrosarcoma. According to Roychoudhury et al (8), by 2011 at least 108 cases had been reported in the English-language literature; those studies were mainly focused on clinical reports, such as clinical manifestations, radiological findings, treatment and prognosis, whereas the study on pathogenesis and molecular biology remains at the initial stage. However, it is not known whether the EXT genes are also involved in condylar osteochondromas. We performed a mutation analysis of the EXT1 and EXT2 genes in 12 cases of solitary osteochondroma of the condyle, to estimate the distribution of mutations that lead to the development of condylar osteochondromas.

Patients and methods

Patients

A total of 12 sporadic patients diagnosed with condylar osteochondroma were included in this study. Patients with a solitary osteochondroma were selected based on a review of their pathological, clinical and radiological data. After obtaining written informed consent, cartilage from the cap of the resected specimens was collected from each participant. The patients comprised 5 women and 7 men, with a mean age of 45.08 years (range, 23–76 years). The clinical characteristics of all the patients are summarised in Table I.

Table I.

Characteristics of 12 condylar osteochondroma patients.

Table I.

Characteristics of 12 condylar osteochondroma patients.

CaseGenderAge (years)SideDuration of symptomsSymptoms
1M44Right>3 yearsFacial asymmetry, LMO, occlusal disorder
2F76Right3 yearsFacial asymmetry, LMO, occlusal disorder, pain
3M49Left1 monthsFacial asymmetry, pain, clicking, occlusal disorder
4M65Right6 monthsNumbness of right tongue base, pain, occlusal disorder
5M50Right8 monthsFacial asymmetry, clicking, occlusal disorder
6F24Left4 monthsFacial asymmetry, occlusal disorder
7M23Left2 yearsFacial asymmetry, occlusal disorder
8M32Right>5 yearsFacial asymmetry, LMO, pain
9F39Left7 yearsFacial asymmetry, pain, occlusal disorder
10F61Left2 yearsFacial asymmetry, clicking, LMO, occlusal disorder
11M39Left>2 yearsLMO, pain
12F39Right2 monthsFacial asymmetry

[i] M, male; F, female; LMO, limitation of mouth opening.

Mutation analysis of EXT genes

DNA was extracted from the cartilage cap of resected specimens using the DNeasy Tissue kit (cat. no. 69581; Qiagen). DNA was polymerase chain reaction (PCR)-amplified with 13 pairs of PCR primers for 11 exons, 3′,5′-untranslated regions (UTR) and intron-exon boundaries of the EXT1 gene, and 16 pairs for 15 exons, 3′,5′-UTRs and intron-exon boundaries of the EXT2 gene (Table II). PCR cycling was performed on the 2720 Thermal Cycler (Applied Biosystems) using the Taq PCR Mastermix kit (Takara Biotechnology). All PCR programs included an initial denaturation of 5 min at 94°C, followed by 32 cycles of 15 sec at 94°C, 35 sec at 55–60°C, and 60 sec at 72°C; and a final extension step of 5 min at 72°C. The products were purified with QIAquick PCR Purification kit (cat. no. 28106; Qiagen) and the purified PCR products were sequenced using the forward and reverse primers. Automated sequencing was performed on an ABI PRISM® 3730XL Genetic Analyzer (Applied Biosystems).

Table II.

Sequencing regions and primers of exostosin glycosyltransferase (EXT) 1 and EXT2 genes.

Table II.

Sequencing regions and primers of exostosin glycosyltransferase (EXT) 1 and EXT2 genes.

GeneExonSense (5′-3′)Antisense (3′-5′)Fragment size (bp)
EXT1  1 CGAGCGCAGGAGTAAACAC ATTGATCCCAAGGAACGAA824
  1 GAAAGGCATCCAGAGAAGG GACTCAGGACAAAGAGGCAC614
  1 AAAACGGCTTCAAAGTCTACG TTGCTCAGTTCCAGGCTCA768
  2 GGGGTGGGGAACAAGAA GGAACTGAGAGACAATGAAG906
  3 GAAATGGGGTTTTAGCA GTTATTGAAAGGGGTGG626
  4 GAAGTGCTTGGGAGATAA CGAAGGATGCCATTGAG834
  5 AGTCTATTTTGGAATGAGC GAGATATTGGGATTGTGA804
  6 GCTCTTCCTTTCACCTTT TCTCTGTAACCCATCCCT794
  7 CGGACACAGTTGGTTTT CCACTTTGTAGATGAGGAA624
  8 GATTTATCTTTGTACCCTCTTTGAC ATGCAGAACACGCACCC675
  9 AGATGTGTTTGTGTCTCACG CCAACTGAAAATGTTACTCTAC744
10 GGGAGTAATAATAGAACCTG CAAATGGACTAAGACAAACT711
11 TCAGTTGCTAAGTCGTG AACAAAGAACTCTGGTTT817
EXT2  1 CGCCTGCCTGGGAAAAC GGCTAGGAGAACAGGTGGGTA548
  2 CTGCTGGGTCGGGACAA GTTCCCACCGAATGTAACAAA794
  3 TGGTCACAGTTACTTGGG GGCAGACTACTCTTCACG997
  4 TAACCAGGCTTCTCTAATG CGCTACCTTCTCTCAGTAA751
  5 GGGAAGTAAGGAAAGGGTAT CTAAGGGCAATGTGAAGC815
  6 AACTGTTCCCAAATAAGATG GGGGGTAAAAGCAAGATA763
  7 AAGGTAGGCTGAGGTAAG GTAAAGGAAGGGACACG776
  8 GTAGGGAGTGGGAGGTAAA AATGGGGTGTCAGAAGGT818
  9 ACATGGCTATTCTCATCAT TGCCTCCTTACTTATCTCT668
10 GGGTTTGGGGAGAGAAT GAGCAGAGATAAGAAAGGAGA826
11 TTGAAGCCAATTTGTTC CTTTGTTTGTCAGTGTCG877
12 TAATACAAATCAGGGCAGTT GGCTCACAATACAATCCA883
13 TAATGCCTCCTTTTACC GCCTTTATTCTGATACTGA533
14 GAAAGAGGAGAAAGAGCG CCCTGAAAAATAATCCAGTA827
15 CATCTCCTGTTCACGTTCT GCTGGTGCTCTTCCTGT949
15 TGGAGAAGAGAAGCGTGTT GCAAAGCAGTTGTATAGCAG736

Results

Genetic variations of EXT1

Through direct sequencing of all exons, intron-exon boundaries and 3′,5′-UTRs, four genetic variations of EXT1 were identified, of which one was a synonymous coding variation (chr8_118819578_G/A in case 8), and three were in intronic regions (chr8_118830894_G/A and chr8_118834952_G/A in case 1, and chr8_118830820_A/G in case 2), which have been previously reported (Table III).

Table III.

Characters of EXT genetic variations in condylar osteochondroma.

Table III.

Characters of EXT genetic variations in condylar osteochondroma.

GeneCaseGenetic variationIdentity in dbSNPRegionAllele freq
EXT1  1 chr8_118830894_G/Ars4876757Intron0.2688
  2 chr8_118830820_A/Grs10955837Intron0.4446
  1 chr8_118834952_G/Ars4355803Intron0.2848
  8 chr8_118819578_G/Ars7837891Exon 90.3681
EXT2  3 chr11_44117372_C/Grs128004045′UTR0.0403
  7 chr11_44117899_G/TNovelIntron–
12 chr11_44117899_G/TNovelIntron–
  1 chr11_44129290_C/Ars4755228Exon 30.0893
  2 chr11_44129290_C/Ars4755228Exon 30.0893

[i] EXT, exostosin glycosyltransferase; dbSNP, single-nucleotide polymorphism database; UTR, untranslated region.

Genetic variations of EXT2

Five variations of EXT2 were detected, two of which were synonymous coding variations (chr11_44129290_C/A in cases 1 and 2), two were in intronic regions (chr11_44117899_G/T in cases 7 and 12) and one was in the 5′-UTR (chr11_44117372_C/G in case 3). The genetic variations (chr11_44117899_G/T in cases 7 and 12) in EXT2 were novel (Fig. 1, Table III). All the mutations were confirmed by repeat PCR and sequencing.

Figure 1.

Novel polymorphic loci of exostosin glycosyltransferase 2 in samples 7 and 12.

Discussion

Osteochondroma was previously considered as a perversion in the direction of normal bone growth, resulting from aberrant epiphyseal development (9). However, later studies demonstrated that loss or mutation of EXT1 or EXT2 are crucial in the pathogenesis of solitary as well as hereditary osteochondromas (10,11). Germline mutations of either the EXT1 or EXT2 gene may be identified in >85% of the analyzed MO cases and MO families (12–16). Approximately 77–80% of intragenic EXT1 and EXT2 mutations are inactivating mutations (44–66% associated with EXT1 and 27% with EXT2) (16,17). These alterations result in truncated (non-functional) EXT proteins (18,19). The protein products of EXT1 and EXT2 are type II transmembrane glycoproteins and comprise a Golgi-localized hetero-oligomeric complex involved in heparan sulphate proteoglycan (HSPG) biosynthesis. Hameetman et al (20) found that EXT1 or EXT2 mRNA expression in osteochondromas was decreased; however, in non-hereditary tumors, only decreased EXT1 mRNA expression was detected. Decreased EXT1 or EXT2 mRNA expression in osteochondromas was associated with intracellular accumulation of HSPGs in the Golgi apparatus. It has been shown that a lack of HSPGs on the cell surface affects growth signaling pathways in the growth plate [e.g., Indian hedgehog (IHH) signaling] and, possibly, those in osteochondromas (21–23). In the growth plate, IHH requires interaction with HSPGs to diffuse through the extracellular matrix to its receptor (21).

Somatic mutations in the EXT genes are extremely rare in non-hereditary osteochondromas and have been described in only 3 cases (24–26). However, the observation that loss of heterozygosity (LOH) and clonal rearrangement at 8q24 (EXT1 locus) are as frequent in non-hereditary osteochondromas as are EXT1 gene mutations in patients with hereditary osteochondromas, suggests that EXT1 may be involved in the development of non-hereditary osteochondromas (10,11,27). By contrast, LOH at the EXT2 locus has been reported in only 1 case of non-hereditary osteochondroma (28).

Structural changes in the EXT1 locus have been reported in 10/30 non-hereditary and in 1/13 hereditary osteochondromas (10,11). LOH detected by microsatellite analysis using DNA isolated from the cartilaginous cap was found almost exclusively at the EXT1 locus (27). Fluorescence in situ hybridization revealed loss of the 8q24.1 locus in 27/34 (79%) osteochondromas (29). Finally, in 7/8 solitary osteochondromas, homozygous deletion of EXT1 was detected (30). Of note, EXT2 was found to be affected only in MO and not in solitary lesions. In our study, we analyzed 12 patients with solitary osteochondroma for the presence of mutations in the EXT1 and EXT2 genes. A novel nonsense mutation (chr11_44117899_G/T in the intronic region in cases 7 and 12) was identified. The other 7 variations were already in the databases. Apart from known polymorphisms, no sense somatic or germline mutations were detected in tumor DNA. The results were consistent with the rarity of EXT gene mutations in non-hereditary osteochondromas. As the LOH and clonal rearrangement in EXT genes are common, we should analyse the incidence of deletions and rearrangement in condylar osteochondromas.

In conclusion, we screened EXT1 and EXT2 mutations in 12 patients with non-hereditary osteochondromas of the mandibular condyle. To the best of our knowledge, this is the first study to identify mutations of EXT1 and EXT2 in condylar osteochondromas. Our study extended the mutational spectrum in EXT1 and EXT2 and may facilitate a better understanding of the pathophysiology of condylar osteochondromas.

References

1 

Khurana J, Abdul-Karim F and Bovée JVMG: Osteochondroma. In: World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of Soft Tissue and Bone. Fletcher CDM, Unni KK and Mertens F: IARC Press. (Lyon). 234–236. 2002.

2 

Wicklund CL, Pauli RM, Johnston D and Hecht JT: Natural history study of hereditary multiple exostoses. Am J Med Genet. 55:43–46. 1995. View Article : Google Scholar : PubMed/NCBI

3 

Bovée JVMG and Hogendoorn PCW: Multiple osteochondromas. In: World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of Soft Tissue and Bone. Fletcher CDM, Unni KK and Mertens F: IARC Press. (Lyon). 360–362. 2002.

4 

Hameetman L, Bovée JV, Taminiau AH, Kroon HM and Hogendoorn PC: Multiple osteochondromas: Clinicopathological and genetic spectrum and suggestions for clinical management. Hered Cancer Clin Pract. 2:161–173. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Wu YQ, Heutink P, de Vries BB, Sandkuijl LA, van den Ouweland AM, Niermeijer MF, Galjaard H, Reyniers E, Willems PJ and Halley DJ: Assignment of a second locus for multiple exostoses to the pericentromeric region of chromosome 11. Hum Mol Genet. 3:167–171. 1994. View Article : Google Scholar : PubMed/NCBI

6 

Wuyts W, Ramlakhan S, Van Hul W, Hecht JT, van den Ouweland AM, Raskind WH, Hofstede FC, Reyniers E, Wells DE and de Vries B: Refinement of the multiple exostoses locus (EXT2) to a 3-cM interval on chromosome 11. Am J Hum Genet. 57:382–387. 1995.PubMed/NCBI

7 

Lüdecke HJ, Ahn J, Lin X, Hill A, Wagner MJ, Schomburg L, Horsthemke B and Wells DE: Genomic organization and promoter structure of the human EXT1 gene. Genomics. 40:351–354. 1997. View Article : Google Scholar : PubMed/NCBI

8 

Roychoudhury A, Bhatt K, Yadav R, Bhutia O and Roychoudhury S: Review of osteochondroma of mandibular condyle and report of a case series. J Oral Maxillofac Surg. 69:2815–2823. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Huvos AG: Bone Tumors. Diagnosis, Treatment and Prognosis (2nd). WB Saunders. (Philadelphia). 1991.

10 

Mertens F, Rydholm A, Kreicbergs A, Willén H, Jonsson K, Heim S, Mitelman F and Mandahl N: Loss of chromosome band 8q24 in sporadic osteocartilaginous exostoses. Genes Chromosomes Cancer. 9:8–12. 1994. View Article : Google Scholar : PubMed/NCBI

11 

Bridge JA, Nelson M, Orndal C, Bhatia P and Neff JR: Clonal karyotypic abnormalities of the hereditary multiple exostoses chromosomal loci 8q24.1 (EXT1) and 11p11-12 (EXT2) in patients with sporadic and hereditary osteochondromas. Cancer. 82:1657–1663. 1998. View Article : Google Scholar : PubMed/NCBI

12 

Wuyts W, Van Hul W, De Boulle K, Hendrickx J, Bakker E, Vanhoenacker F, Mollica F, Lüdecke HJ, Sayli BS, Pazzaglia UE, et al: Mutations in the EXT1 and EXT2 genes in hereditary multiple exostoses. Am J Hum Genet. 62:346–354. 1998. View Article : Google Scholar : PubMed/NCBI

13 

Wuyts W, Radersma R, Storm K and Vits L: An optimized DHPLC protocol for molecular testing of the EXT1 and EXT2 genes in hereditary multiple osteochondromas. Clin Genet. 68:542–547. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Lonie L, Porter DE, Fraser M, Cole T, Wise C, Yates L, Wakeling E, Blair E, Morava E, Monaco AP and Ragoussis J: Determination of the mutation spectrum of the EXT1/EXT2 genes in British Caucasian patients with multiple osteochondromas and exclusion of six candidate genes in EXT negative cases. Hum Mutat. 27:11602006. View Article : Google Scholar : PubMed/NCBI

15 

Pedrini E, De Luca A, Valente EM, Maini V, Capponcelli S, Mordenti M, Mingarelli R, Sangiorgi L and Dallapiccola B: Novel EXT1 and EXT2 mutations identified by DHPLC in Italian patients with multiple osteochondromas. Hum Mutat. 26:2802005. View Article : Google Scholar : PubMed/NCBI

16 

Jennes I, Pedrini E, Zuntini M, Mordenti M, Balkassmi S, Asteggiano CG, Casey B, Bakker B, Sangiorgi L and Wuyts W: Multiple osteochondromas: Mutation update and description of the multiple osteochondromas mutation database (MOdb). Hum Mutat. 30:1620–1627. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Wuyts W and Van Hul W: Molecular basis of multiple exostoses: Mutations in the EXT1 and EXT2 genes. Hum Mutat. 15:220–227. 2000. View Article : Google Scholar : PubMed/NCBI

18 

McCormick C, Duncan G, Goutsos KT and Tufaro F: The putative tumor suppressors EXT1 and EXT2 form a stable complex that accumulates in the Golgi apparatus and catalyzes the synthesis of heparan sulfate. Proc Natl Acad Sci USA. 97:668–673. 2000. View Article : Google Scholar : PubMed/NCBI

19 

Cheung PK, McCormick C, Crawford BE, Esko JD, Tufaro F and Duncan G: Etiological point mutations in the hereditary multiple exostoses gene EXT1: A functional analysis of heparan sulfate polymerase activity. Am J Hum Genet. 69:55–66. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Hameetman L, David G, Yavas A, White SJ, Taminiau AH, Cleton-Jansen AM, Hogendoorn PC and Bovée JV: Decreased EXT expression and intracellular accumulation of HSPG in osteochondromas and peripheral chondrosarcomas. J Pathol. 211:399–409. 2007. View Article : Google Scholar : PubMed/NCBI

21 

Koziel L, Kunath M, Kelly OG and Vortkamp A: Ext1-dependent heparan sulfate regulates the range of Ihh signaling during endochondral ossification. Dev Cell. 6:801–813. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Hameetman L, Rozeman LB, Lombaerts M, Oosting J, Taminiau AH, Cleton-Jansen AM, Bovée JV and Hogendoorn PC: Peripheral chondrosarcoma progression is accompanied by decreased Indian Hedgehog (IHH) signalling. J Pathol. 209:501–511. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Benoist-Lasselin C, de Margerie E, Gibbs L, Cormier S, Silve C, Nicolas G, LeMerrer M, Mallet JF, Munnich A, Bonaventure J, et al: Defective chondrocyte proliferation and differentiation in osteochondromas of MHE patients. Bone. 39:17–26. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Hecht JT, Hall CR, Snuggs M, Hayes E, Haynes R and Cole WG: Heparan sulfate abnormalities in exostosis growth plates. Bone. 31:199–204. 2002. View Article : Google Scholar : PubMed/NCBI

25 

Bernard MA, Hall CE, Hogue DA, Cole WG, Scott A, Snuggs MB, Clines GA, Lüdecke HJ, Lovett M, Van Winkle WB and Hecht JT: Diminished levels of the putative tumor suppressor proteins EXT1 and EXT2 in exostosis chondrocytes. Cell Motil Cytoskeleton. 48:149–162. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Hecht JT, Hogue D, Wang Y, Blanton SH, Wagner M, Strong LC, Raskind W, Hansen MF and Wells D: Hereditary multiple exostoses (EXT): Mutational studies of familial EXT1 cases and EXT-associated malignancies. Am J Hum Genet. 60:80–86. 1997.PubMed/NCBI

27 

Bovée JV, Cleton-Jansen AM, Wuyts W, Caethoven G, Taminiau AH, Bakker E, Van Hul W, Cornelisse CJ and Hogendoorn PC: EXT-mutation analysis and loss of heterozygosity in sporadic and hereditary osteochondromas and secondary chondrosarcomas. Am J Hum Genet. 65:689–698. 1999. View Article : Google Scholar : PubMed/NCBI

28 

Esko JD and Selleck SB: Order out of chaos: Assembly of ligand binding sites in heparan sulfate. Annu Rev Biochem. 71:435–471. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Feely MG, Boehm AK, Bridge RS, Krallman PA, Neff JR, Nelson M and Bridge JA: Cytogenetic and molecular cytogenetic evidence of recurrent 8q24.1 loss in osteochondroma. Cancer Genet Cytogenet. 137:102–107. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Hameetman L, Szuhai K, Yavas A, Knijnenburg J, van Duin M, van Dekken H, Taminiau AH, Cleton-Jansen AM, Bovée JV and Hogendoorn PC: The role of EXT1 in nonhereditary osteochondroma: Identification of homozygous deletions. J Natl Cancer Inst. 99:396–406. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhou Q, Yang C, Chen MJ and Li LZ: Detection of exostosin glycosyltransferase gene mutations in patients with non‑hereditary osteochondromas of the mandibular condyle. Mol Clin Oncol 5: 295-299, 2016.
APA
Zhou, Q., Yang, C., Chen, M., & Li, L. (2016). Detection of exostosin glycosyltransferase gene mutations in patients with non‑hereditary osteochondromas of the mandibular condyle. Molecular and Clinical Oncology, 5, 295-299. https://doi.org/10.3892/mco.2016.955
MLA
Zhou, Q., Yang, C., Chen, M., Li, L."Detection of exostosin glycosyltransferase gene mutations in patients with non‑hereditary osteochondromas of the mandibular condyle". Molecular and Clinical Oncology 5.3 (2016): 295-299.
Chicago
Zhou, Q., Yang, C., Chen, M., Li, L."Detection of exostosin glycosyltransferase gene mutations in patients with non‑hereditary osteochondromas of the mandibular condyle". Molecular and Clinical Oncology 5, no. 3 (2016): 295-299. https://doi.org/10.3892/mco.2016.955
Copy and paste a formatted citation
x
Spandidos Publications style
Zhou Q, Yang C, Chen MJ and Li LZ: Detection of exostosin glycosyltransferase gene mutations in patients with non‑hereditary osteochondromas of the mandibular condyle. Mol Clin Oncol 5: 295-299, 2016.
APA
Zhou, Q., Yang, C., Chen, M., & Li, L. (2016). Detection of exostosin glycosyltransferase gene mutations in patients with non‑hereditary osteochondromas of the mandibular condyle. Molecular and Clinical Oncology, 5, 295-299. https://doi.org/10.3892/mco.2016.955
MLA
Zhou, Q., Yang, C., Chen, M., Li, L."Detection of exostosin glycosyltransferase gene mutations in patients with non‑hereditary osteochondromas of the mandibular condyle". Molecular and Clinical Oncology 5.3 (2016): 295-299.
Chicago
Zhou, Q., Yang, C., Chen, M., Li, L."Detection of exostosin glycosyltransferase gene mutations in patients with non‑hereditary osteochondromas of the mandibular condyle". Molecular and Clinical Oncology 5, no. 3 (2016): 295-299. https://doi.org/10.3892/mco.2016.955
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team