Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular and Clinical Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9450 Online ISSN: 2049-9469
Journal Cover
April-2025 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2025 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

STAT1 and STAT4 expression as prognostic biomarkers in patients with bladder cancer

  • Authors:
    • Hajar El Ahanidi
    • Meryem El Azzouzi
    • Boutaina Addoum
    • Mohammed  Tetou
    • Ilyass Hassan
    • Abderrahmane Al Bouzidi
    • Mohammed Oukabli
    • Chaimae Hafidi Alaoui
    • Imane Chaoui
    • Laila Benbacer
    • Mohammed El Mzibri
    • Ahmed Ameur
    • Camilla Jandus
    • Mohammed Attaleb
  • View Affiliations / Copyright

    Affiliations: Department of Pathology and Immunology, Faculty of Medicine, University of Geneva, CH‑1211 Geneva 4, Switzerland, Biology and Medical Research Unit, National Center for Energy, Nuclear Sciences and Techniques, 10010 Rabat, Morocco, Urology Department, Military Hospital of Rabat, 10000 Rabat, Morocco, Pathology Department, Military Hospital of Rabat, 10000 Rabat, Morocco
    Copyright: © El Ahanidi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 33
    |
    Published online on: February 6, 2025
       https://doi.org/10.3892/mco.2025.2828
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Signal transducer and activator of transcription (STAT) proteins are cytoplasmic transcription factors known to play key roles in numerous physiological and pathological processes, from pathogen response to cancer modulation. However, the roles of some STAT family members, particularly STAT1 and STAT4, in the initiation and progression of bladder cancer (BC) have not been comprehensively studied. The present study investigated the expression pattern of STAT1 and STAT4 in the prognosis and survival of BC taking advantage of patients' specimens and cell lines. In our cohort, high mRNA expression of STAT1 was significantly associated with tumor invasiveness, recurrence and progression, and was shown to increase according to tumor stage in BC cell lines. However, it did not affect patient survival. By contrast, STAT4 exhibited its highest expression in early‑stage tumors, without a significant link to the tumor stage. Moreover, it was found that increased STAT4 mRNA expression was associated with improved disease‑free survival and overall survival in our cohort. Collectively, these findings suggest that STAT1 and STAT4 could be promising prognostic markers to enhance BC management.

Introduction

The molecular characterization of bladder cancer (BC) has transformed understanding of BC pathogenesis and paved the way for new biomarker discoveries. However, translating these insights into clinical practice remains a challenge due to the complexity of the disease and the multitude of altered molecular and pathological pathways (1,2).

Signal transducers and activators of transcription (STAT) proteins are key players in influencing tumor behavior and modulating the tumor microenvironment. The STAT family is composed of seven transcription factors (STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B and STAT6), which play a critical and multifaceted role in regulating vital physiological processes such as cell proliferation, differentiation, apoptosis, angiogenesis and the epigenetic organization of immune cells. Beyond these functions, STATs also contribute to pathological processes by selectively inducing and maintaining a pro-carcinogenic inflammatory microenvironment at the initiation of malignant transformation and during cancer progression (3-6). Dysregulation in this pathway is associated with poor prognosis in various cancers and has been recognized as a common driver in BC, promoting tumor cell proliferation and motility (7).

STAT1 is considered a tumor suppressor, although there is increasing evidence for its tumor-promoting functions (8). The depletion of STAT1 in cancer cells, observed in a broad spectrum of cancers, is often correlated with a poor prognosis. However, the mechanism behind the oncogenic or tumor-suppressing role of STAT1 remains unclear (9). STAT4 is involved in carcinogenesis and tumor progression (6). Although STAT4 inhibition appears to promote tumorigenesis and predict poor outcomes in hepatocellular carcinoma and gastric cancer, its expression was reported to be significantly increased in colorectal cancer specimens, and associated with tumor spread, suggesting a pro-tumorigenic role of STAT4 in this type of cancer (10-12). In ovarian cancer, activation of STAT4 is abundant in epithelial cells and its overexpression was associated with poor outcome and promoted metastasis both in vivo and in vitro, suggesting a pro-metastatic function of STAT4(13).

Previous studies reported that STAT1 and STAT4 exhibited both complementary and opposite roles. These functions appear to be regulated in a manner dependent on both cell type and cancer type (14,15). The molecular events in bladder tumorigenesis have sparked considerable interest, as they hold promise for advancing patient diagnosis, prognosis and the development of targeted therapies. While STAT1 has been extensively studied in BC due to its well-established antitumor role, the involvement of STAT4 in tumor development and progression remains largely unexplored, with only limited insights available.

Considering the significant roles of STAT1 and STAT4 in cancer, as well as the increasing need for improved tools to stratify patients and develop reliable prognostic and diagnostic biomarkers, the expression level of STAT1 and STAT4 was evaluated in primary and recurrent BC patient specimens, spanning the full range of the disease's grades and stages. Their potential associations with clinicopathological features and patient clinical outcomes were also evaluated. Additionally, STAT1/4 expression was quantified in human bladder cell lines mimicking the four stages of tumorigenesis. Overall, the present study provides insight into the expression pattern of STAT1 and STAT4 at the different stages of tumorigenesis and contributes to the identification of potential prognostic biomarkers in BC.

Materials and methods

Characteristics of the patients and tissue samples

A total of 70 fresh frozen tumor samples were obtained by transurethral resection of the bladder or cystoscopy at the Urology Department of the University Military Hospital in Rabat-Morocco between August 2019 and July 2022. The study protocol was approved (approval no. Ref 82/19) by the Ethics Committee for Biomedical Research from the Faculty of Medicine and Pharmacy of Rabat (Rabat, Morocco). Written informed consent was obtained from each recruited patient before sample collection. Staging and grading were conducted according to the World Health Organization Consensus Classification at the Anatomopathology Department of the Military Hospital Mohammed V. The data collected from patients' records is summarized in Table I. Among the 70 recruited patients, 68 men and 2 women were included. The mean age of patients was 67 years, ranging from 47-85 years. A total 28 patients (40%) have reported to be active or former smokers. Most cases were staged ≤ PT1 (74.29%) and had high tumor grade (61.43%). Among patients with non-muscle invasive BC (NMIBC) stage collected during the present study, 12 experienced tumor recurrence (23.08%) and 5 were diagnosed with progression upon the 4-year follow up.

Table I

Clinicopathological characteristics of patients.

Table I

Clinicopathological characteristics of patients.

ParameterTotal casesPercentage (%)
Sex  
     Male6897.14
     Female22.86
Age, years  
     <5011.43
     50-704462.86
     >702535.71
Smoking history  
     Yes2840
     No4260
Tumor stage  
     ≤PT15274.29
     >PT11825.71
Tumor grade  
     Low grade2738.57
     High grade4361.43
Tumor recurrence  
     Yes1223.08
     No4076.92
Tumor progression  
     Yes59.62
     No4790.38
Cell lines and cell culture

A total of four human bladder cell lines were used in the present study: BU68.08, mimicking a NMIBC stage [generated and kindly provided by Dr Laurent Derré, University Hospital Lausanne, Switzerland (16)] and RT4:pT2 (cat. no. HTB-2™), J82:pT3 (cat. no. HTB-1™) and TCC-SUP:pT4 (cat. no. HTB-5™) corresponding to the three stages of disease invasiveness, were purchased from the American Type Culture Collection. Cells were cultured in RPMI-1640 10% heat-inactivated FCS (Gibco; Thermo Scientific, Inc.) at 37˚C in a 5% CO2 humidified atmosphere. The medium was changed as recommended by the manufacturer and cells were used for the experiment when confluency reached 70-80%.

RNA isolation

Total RNA was extracted from 70 fresh frozen biopsies conserved in RNA Later (Invitrogen; Thermo Fisher Scientific, Inc.) and from four BC cell lines using TRI Reagent (Sigma-Aldrich; Merck KGaA), according to the manufacturer's protocol. The amount and quality of DNA and RNA were measured by NanoDrop 2000 (Thermo Fisher Scientific, Inc.). The ratio of absorbance at 260 and 280 nm was used to assess purity. A ratio of ~1.8 was accepted as ‘pure’ for DNA. RNA was considered DNA and protein free if the ratio of readings at 260/280 nm was ~2.

Gene expression study

A total of 1 µg of each of the 70 RNA samples was subjected to reverse transcription independently using the High-capacity cDNA reverse transcription kit according to manufacturer's protocol (Applied Biosystems; Thermo Fisher Scientific, Inc.). cDNAs were subsequently used to perform a SYBR green-based quantitative PCR using the KAPA SYBR FAST Kit (Roche Diagnostics). Enzyme was first activated at 95˚C for 3 min, followed by 40 cycles of denaturation at 95˚C for 3 sec, primer annealing and extension for 20 sec at 60˚C. Samples were amplified in triplicate, and a non-template control was used for each primer pair to control for contamination or primer dimerization. STAT1 and STAT4 levels were normalized to the expression of β2 microglobulin (β2M) used as an internal control gene, using the 2-ΔΔCq formula (17). Primers' sequences are shown in Table II.

Table II

Sequences of primers used in the present study.

Table II

Sequences of primers used in the present study.

Gene namePrimer sequence (5'-3')
β2MF: GAGGCTATCCAGCGTACTCCA
 R: CGGCAGGCATACTCATCTTTT
STAT1F: ATCAGGCTCAGTCGGGGAATA
 R: TGGTCTCGTGTTCTCTGTTCT
STAT4F: TGTTGGCCCAATGGATTGAAA
 R: GGAAACACGACCTAACTGTTCAT

[i] F, forward; R, reverse.

Statistical analysis

Statistical analysis of the potential association between clinicopathological features and patients' clinical outcomes was performed using Graph Pad Prism software version 10 (Dotmatics). Unpaired student's t-test was used for the comparison between two groups; for the comparison between multiple groups, two-way ANOVA or the non-parametric (Mann-Whitney or Kruskal-Wallis tests) tests were used. Survival analyses were performed using the Kaplan-Meier method and compared by a log-rank test on Graph Pad Prism software version 10, and the follow-up period was defined from the date of first transurethral resection of bladder tumor treatment to the moment of death for deceased cases, or the date of the last follow up for survivors. P<0.05 (two-tailed) was considered to indicate a statistically significant difference.

Results

Differential expression of STAT1 and STAT4 in early vs. aggressive tumors

In the present prospective study, the mRNA level of STAT1 and STAT4 genes were evaluated in both BC cases as well as in BC cell lines mimicking the four state and the four stages of cancer progression. The results are presented in Fig. 1, where the expression of STAT1 and STAT4 showed no significant association with patient age, sex, or smoking history (Fig. 1A-C).

Figure 1

Differential expression of STAT1 and STAT4 in patients with BC and BC cell lines. (A-F) The expression level of STAT1 and STAT4 according to (A-C) patients' demographic data and (D-F) pathological data. (G and H) STAT1 and STAT4 expression in bladder cancer cell lines. *P<0.05 and ***P<0.001. BC, bladder cancer; MIBC, muscle-invasive BC; NMIBC, non-MIBC; ns, not significant.

STAT1 expression was significantly upregulated in patients with muscle-invasive BC (MIBC) compared with those with NMIBC, and in progressive tumors relative to primary and recurrent cases. By contrast, STAT4 expression was slightly higher in NMIBC compared with MIBC cases (Fig. 1D), in low-grade tumors compared with higher-grade stages (Fig. 1E), and in recurrent cases compared with primary and progressive tumors (Fig. 1F), although these differences were not statistically significant.

In BC cell lines, STAT1 and STAT4 patterns are similar to those observed in human primary tissue samples. Indeed, STAT1 expression scored the highest rate in advanced tumor stages, while STAT4 was higher in the NMIBC cell lines and its expression decreased according to tumor invasion (Fig. 1G and H).

STAT1/4 expression as a survival prognostic biomarker in patients with BC

In the present study, the mean and the median of clinical follow-up periods were 44 and 45 months, respectively. Kaplan-Meier analyses were performed to examine the possible correlations between the expression of the studied and patients' clinical outcomes: Disease-free survival (DFS) and overall survival (OS). Based on the median value, patients were stratified into two groups: The low expression group, with mRNA levels below the cohort's median, and the high expression group, with mRNA levels equal to or above the median.

For STAT1, the DFS and OS rates were nearly identical (Fig. 2A and B). The survival curves showed no significant differences between the low expression and the high expression groups (DFS, P=0.450; OS, P=0.396). Interestingly, patients with high STAT4 expression had significantly longer DFS (P=0.005) and OS (P=0.003) than those with low STAT4 expression (Fig. 2C and D).

Figure 2

Survival analysis in patients with BC. (A-D) Kaplan-Meier analyses of DFS and OS in patients with BC stratified according to (A and B) STAT1 and (C and D) STAT4 gene expression in patients' samples. Low expression was identified as mRNA level below the median of the cohort, and high expression was identified as mRNA level at or above the median for the cohort. DFS, disease-free survival; OS, overall survival; BC, bladder cancer.

Correlation between STAT1 and STAT4 expression levels

To explore the potential correlation between STAT1 and STAT4 expression in BC, the expression levels of both genes were compared across patients (Fig. 3). This analysis uncovered a significant positive correlation between the mRNA levels of STAT1 and STAT4 (r=0.691; P<0.0001; 95% confidence interval, 0,5010-0,8185) (Fig. 3A). The positive correlation was sustained in both NMIBC and MIBC subtypes, although STAT1 was upregulated in MIBC and STAT4 in NMIBC. The examination revealed that most patients with high STAT1 expression had also high STAT4 expression (Fig. 3B).

Figure 3

Correlations of gene expression of STAT1 and STAT4. (A and B) Spearman correlation of STAT1 and STAT4 gene expression in patients' samples. ****P<0.0001.

Discussion

Worldwide, significant efforts have been made to uncover the molecular mechanisms and pathogenesis of cancer development and progression. However, the detailed process remains one of the most unsolved aspects of cancer biology (18). Understanding the molecular events occurring at different stages of tumorigenesis can pave the way for the discovery of new biomarkers and improve predictions of disease progression and patient prognosis factors, as demonstrated by recent studies on BC (19-22).

In the present study, STAT1 and STAT4 were investigated as potential biomarkers in BC, building on the concept that transcription factors can serve as critical prognostic indicators in various malignancies. For example, transcription factors such as EGFR (23) and STAT3 in non-small cell lung cancer (9,24) and TWIST1/Vimentin have proven also their utility in detecting urothelial carcinoma of the bladder due to their involvement in key processes such as epithelial-to-mesenchymal transition and metastasis. Similarly, E2F family members (E2F3/5/8) have shown promise as prognostic markers in BC, emphasizing the relevance of transcription factors in tumor biology and their therapeutic potential (25).

In the present study, a cohort of 70 samples of BC obtained from patients receiving the same standard of care were used for gene expression investigation and survival analyses. Through the extensive follow-up data that was collected over four years, it was possible to highlight the opposite roles played by STAT1 and STAT4 in bladder tumorigenesis. It was identified that STAT1 is significantly upregulated in advanced stages of BC, in recurrent and in progressing tumors, emphasizing its role as a biomarker of aggressiveness and progression. On the other hand, STAT4 appeared to act as a protective factor in our cohort, with slightly higher expression observed in early-stage cancer biopsies, though not reaching statistical significance.

Furthermore, STAT1 was almost 10-fold overexpressed in the high-grade group. These observations align with a previous study that has shown significantly higher STAT1 expression across a panel of 12 cancer types, with elevated STAT1 levels linked to higher tumor grades in bladder carcinoma (26).

The protective role of STAT4 is experimentally demonstrated by the high level of mRNA detected in non-invasive tumor stages and non-relapsing patients over the 4-year follow-up period. STAT4 has been suggested to induce inflammation and autoimmune diseases, inhibit tumor growth, or promote tumors via regulating numerous facets of the innate and adaptive immune responses (27). According to a previous study, STAT1 and STAT4 tend to increase simultaneously in several immune disorders, including inflammatory bowel disease (15). The present study points to contrasting roles for these two genes and, if validated in larger patient cohorts, they could be utilized as prognostic markers. STAT1 overexpression might indicate aggressive tumors, while high STAT4 expression could be associated with favorable clinical outcomes. Our survival analysis revealed that STAT1 expression was not significantly associated with OS or DFS, as shown in Fig. 2. This unexpected result may reflect several factors: The heterogeneous nature of BC, the influence of other molecular pathways compensating for STAT1 activity, or the sample size limitations of our cohort. It is also possible that STAT1's role in tumor progression depends on context-specific factors, such as interactions with the tumor microenvironment or post-transcriptional modifications affecting its activity. These findings warrant further validation in larger cohorts and functional studies to elucidate the interplay between STAT1, STAT4 and the broader immune landscape in BC.

On the other side, the survival analysis revealed a significantly superior DFS and OS in patients displaying higher STAT4 expression. This improved outcome may be attributed to the crucial role of STAT4 in IFN-γ induction, which is essential for boosting antitumor immunity. Supporting this idea, STAT4 inhibition has been demonstrated to promote tumorigenesis and predict poor outcomes in cutaneous T-cell lymphoma, hepatocellular carcinoma and gastric cancer (10,11,28-30).

The potential link between the expression profiles of the two genes studied was further investigated. Interestingly, a positive correlation was found between STAT1 and STAT4 expression, indicating that patients with higher STAT1 expression also tend to exhibit higher STAT4 levels. Although STAT1 and STAT4 may have opposing roles in BC, this association suggests a functional relationship likely due to co-regulation from a shared genetic locus. This co-regulation may enable STAT1 and STAT4 to complement each other, working synergistically to modulate antitumor immune responses and revealing an interaction that has not been previously well-defined (15). A similar expression trend was observed in bladder cell lines, where high STAT1 expression was detected in cells from advanced tumor stages, while low STAT1 expression was associated with BU68.08 (representing the NMIBC stage). By contrast, STAT4 expression exhibited an opposite pattern, with lower levels in advanced-stage cells and higher levels in non-invasive BC cells.

To the best of our knowledge, the present study is the first to report differential expression of STAT1 and STAT4 in human BC, using both primary samples and cell lines. These findings indicate that STAT gene expression could be a valuable target for developing new therapies to improve BC management. However, due to the limited sample size and the complex role of STAT signaling in cancer progression, further research is essential to confirm STAT1 and STAT4 as reliable prognostic biomarkers. Exploring the distinct roles of STAT1 and STAT4 in tumor progression and the tumor microenvironment presents a promising avenue for future research. A priority will be to perform targeted knockout and overexpression experiments for STAT1 and STAT4 in BC cell lines. Complementing these in vitro studies with in vivo experiments using animal models will provide critical insights into how these genes influence tumor growth, metastasis and interaction with the tumor microenvironment in a physiological context. These combined approaches aim to elucidate the detailed mechanisms underlying their roles in cell proliferation, migration and invasion, thereby advancing our understanding of their functional significance and therapeutic potential in BC.

In conclusion, the present study demonstrated that STAT1 expression is significantly upregulated in patients with advanced MIBC and progressing bladder tumors. By contrast, STAT4 expression was higher in NMIBC, although the difference was not statistically significant. In BC cell lines, the expression trends of STAT1 and STAT4 mirrored those observed in human primary tissues. Notably, patients with high STAT4 expression exhibited significantly improved DFS and OS compared with those with low expression, likely due to the enhanced immune response, particularly through the activation of Th1 cells that aid in controlling tumor growth and recurrence. Additionally, STAT4 influences pro-inflammatory pathways, creating an antitumor environment that limits tumor progression and ultimately improves patient prognosis. As a consequence, the current findings suggested STAT1 and STAT4 as promising biomarkers for prognostic prediction in BC.

Furthermore, it is anticipated that the present study would be a catalyst for collaborative research that could integrate the present findings into clinical trials and potentially develop STAT1 and STAT4-based diagnostic and prognostic tools.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by a Consolidation grant (grant no. COG-2023-37) from the HES-SO Leading House for the Middle East and North Africa (to EAH).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

EAH designed the study, performed the experiments, analyzed the data, wrote the manuscript, and provided final approval for publication. EAM performed the experiments and analyzed the data. AM analyzed the data and contributed to manuscript writing. HAC, HI and CI performed biostatistical analysis. TM, AA, ABA and OM provided patient samples and follow-up. AA, AM and BL provided intellectual contributions and revised the manuscript. JC and AM provided intellectual contributions, critically revised the manuscript, and provided final approval for publication. EAH and AM confirm the authenticity of the raw data.

Ethics approval and consent to participate

The study protocol was approved (approval no. Ref 82/19) by the Ethics Committee of Biomedical Research from the Faculty of Medicine and Pharmacy of Rabat (Rabat, Morocco). Written informed consent was obtained from each recruited patient prior to sample collection.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Liu Q: Current advances in N6-methyladenosine methylation modification during bladder cancer. Front Genet. 12(825109)2022.PubMed/NCBI View Article : Google Scholar

2 

Inamura K: Bladder cancer: New insights into its molecular pathology. Cancers (Basel). 10(100)2018.PubMed/NCBI View Article : Google Scholar

3 

Becerra-Díaz M, Valderrama-Carvajal H and Terrazas LI: Signal transducers and activators of transcription (STAT) family members in helminth infections. Int J Biol Sci. 7:1371–1381. 2011.PubMed/NCBI View Article : Google Scholar

4 

Verhoeven Y, Tilborghs S, Jacobs J, De Waele J, Quatannens D, Deben C, Prenen H, Pauwels P, Trinh XB, Wouters A, et al: The potential and controversy of targeting STAT family members in cancer. Semin Cancer Biol. 60:41–56. 2020.PubMed/NCBI View Article : Google Scholar

5 

Alunno A, Padjen I, Fanouriakis A and Boumpas DT: Pathogenic and therapeutic relevance of JAK/STAT signaling in systemic lupus erythematosus: Integration of distinct inflammatory pathways and the prospect of their inhibition with an oral agent. Cells. 8(898)2019.PubMed/NCBI View Article : Google Scholar

6 

Kitamura H, Ohno Y, Toyoshima Y, Ohtake J, Homma S, Kawamura H, Takahashi N and Taketomi A: Interleukin-6/STAT 3 signaling as a promising target to improve the efficacy of cancer immunotherapy. Cancer Sci. 108:1947–1952. 2017.PubMed/NCBI View Article : Google Scholar

7 

Chen CL, Cen L, Kohout J, Hutzen B, Chan C, Hsieh FC, Loy A, Huang V, Cheng G and Lin J: Signal transducer and activator of transcription 3 activation is associated with bladder cancer cell growth and survival. Mol Cancer. 7(78)2008.PubMed/NCBI View Article : Google Scholar

8 

Meissl K, Macho-Maschler S, Müller M and Strobl B: The good and the bad faces of STAT1 in solid tumours. Cytokine. 89:12–20. 2017.PubMed/NCBI View Article : Google Scholar

9 

Pensa sara, Regis G, Boselli D, Novelli F and Poli V: STAT1 and STAT3 in tumorigenesis: Two sides of the same coin? In: Madame Curie Bioscience Database. Landes Bioscience, Austin, TX, 2013.

10 

Wubetu GY, Utsunomiya T, Ishikawa D, Yamada S, Ikemoto T, Morine Y, Iwahashi S, Saito Y, Arakawa Y and Imura S: , et al: High STAT4 expression is a better prognostic indicator in patients with hepatocellular carcinoma After Hepatectomy. Ann Surg Oncol. 21 (Suppl 4):S721–S728. 2014.PubMed/NCBI View Article : Google Scholar

11 

Zhou X, Xia Y, Su J and Zhang G: Down-regulation of miR-141 induced by helicobacter pylori promotes the invasion of gastric cancer by targeting STAT4. Cell Physiol Biochem. 33:1003–1012. 2014.PubMed/NCBI View Article : Google Scholar

12 

Cheng JM, Yao MR, Zhu Q, Wu XY, Zhou J, Tan WL and Zhan SH: Silencing of stat4 gene inhibits cell proliferation and invasion of colorectal cancer cells. J Biol Regul Homeost Agents. 29:85–92. 2015.PubMed/NCBI

13 

Zhao L, Ji G, Le X, Luo Z, Wang C, Feng M, Xu L, Zhang Y, Lau WB, Lau B, et al: An integrated analysis identifies STAT4 as a key regulator of ovarian cancer metastasis. Oncogene. 36:3384–3396. 2017.PubMed/NCBI View Article : Google Scholar

14 

Anderson K, Ryan N, Volpedo G, Varikuti S, Satoskar AR and Oghumu S: Immune suppression mediated by STAT4 deficiency promotes lymphatic metastasis in HNSCC. Front Immunol. 10(3095)2020.PubMed/NCBI View Article : Google Scholar

15 

Hedl M, Sun R and Abraham C: Disease risk-associated genetic variants in STAT1 and STAT4 function in a complementary manner to increase pattern-recognition receptor-induced outcomes in human macrophages. J Immunol. 205:1406–1418. 2020.PubMed/NCBI View Article : Google Scholar

16 

Vanoni G, Ercolano G, Candiani S, Rutigliani M, Lanata M, Derré L, Marcenaro E, Schneider P, Romero P, Jandus C and Trabanelli S: Human primed ILCPs support endothelial activation through NF-κB signaling. ELife. 10(e58838)2021.PubMed/NCBI View Article : Google Scholar

17 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

18 

Hanahan D and Weinberg RA: The hallmarks of cancer. Cell. 100:57–70. 2000.PubMed/NCBI View Article : Google Scholar

19 

El Ahanidi H, El Azzouzi M, Hafidi Alaoui C, Tetou M, Bensaid M, Chaoui I, Benbacer L, Hassan I, Oukabli M, Michaud K, et al: Immune checkpoint and telomerase crosstalk is mediated by miRNA-138 in bladder cancer. Front Oncol. 11(795242)2022.PubMed/NCBI View Article : Google Scholar

20 

El Azzouzi M, El Ahanidi H, Hassan I, Tetou M, Ameur A, Bensaid M, Al Bouzidi A, Oukabli M, Alaoui CH, Addoum B, et al: Comprehensive behavioural assessment of TERT in bladder cancer. Urol Oncol. 42:451.e19–451.e29. 2024.PubMed/NCBI View Article : Google Scholar

21 

Zhang Q: STAT1 as a potential therapeutic target to treat bladder cancer. Int J Clin Exp Pathol. 17:298–307. 2024.PubMed/NCBI View Article : Google Scholar

22 

Gao B, Li X, Li S, Wang S, Wu J and Li J: Pan-cancer analysis identifies RNA helicase DDX1 as a prognostic marker. Phenomics. 2:33–49. 2022.PubMed/NCBI View Article : Google Scholar

23 

Hashmi AA, Hussain ZF, Irfan M, Khan EY, Faridi N, Naqvi H, Khan A and Edhi MM: Prognostic significance of epidermal growth factor receptor (EGFR) over expression in urothelial carcinoma of urinary bladder. BMC Urol. 18(59)2018.PubMed/NCBI View Article : Google Scholar

24 

Hu Y, Dong Z and Liu K: Unraveling the complexity of STAT3 in cancer: molecular understanding and drug discovery. J Exp Clin Cancer Res. 43(23)2024.PubMed/NCBI View Article : Google Scholar

25 

Zhang C, Xu X, Wang T, Lu Y, Lu Z, Wang T and Pan Z: Clinical performance and utility of a noninvasive urine-based methylation biomarker: TWIST1/Vimentin to detect urothelial carcinoma of the bladder. Sci Rep. 14(7941)2024.PubMed/NCBI View Article : Google Scholar

26 

Zhang J, Wang F, Liu F and Xu G: Predicting STAT1 as a prognostic marker in patients with solid cancer. Ther Adv Med Oncol. 12(1758835920917558)2020.PubMed/NCBI View Article : Google Scholar

27 

Yang C, Mai H, Peng J, Zhou B, Hou J and Jiang D: STAT4: an immunoregulator contributing to diverse human diseases. Int J Biol Sci. 16:1575–1585. 2020.PubMed/NCBI View Article : Google Scholar

28 

Litvinov IV, Cordeiro B, Fredholm S, Ødum N, Zargham H, Huang Y, Zhou Y, Pehr K, Kupper TS, Woetmann A and Sasseville D: Analysis of STAT4 expression in cutaneous T-cell lymphoma (CTCL) patients and patient-derived cell lines. Cell Cycle. 13:2975–2982. 2014.PubMed/NCBI View Article : Google Scholar

29 

Zhou M, Zhang P, Da M, Yang R, Ma Y, Zhao J, Ma T, Xia J, Shen G, Chen Y and Chen D: A pan-cancer analysis of the expression of STAT family genes in tumors and their relationship to the tumor microenvironment. Front Oncol. 12(925537)2022.PubMed/NCBI View Article : Google Scholar

30 

Li C, Zhao J, Kang B, Li S, Tang J, Dong D and Chen Y: Identification and validation of STAT4 as a prognostic biomarker in acute myeloid leukemia. Biosci Rep. 44(BSR20231720)2024.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
El Ahanidi H, El Azzouzi M, Addoum B, Tetou M, Hassan I, Al Bouzidi A, Oukabli M, Hafidi Alaoui C, Chaoui I, Benbacer L, Benbacer L, et al: STAT1 and STAT4 expression as prognostic biomarkers in patients with bladder cancer. Mol Clin Oncol 22: 33, 2025.
APA
El Ahanidi, H., El Azzouzi, M., Addoum, B., Tetou, M., Hassan, I., Al Bouzidi, A. ... Attaleb, M. (2025). STAT1 and STAT4 expression as prognostic biomarkers in patients with bladder cancer. Molecular and Clinical Oncology, 22, 33. https://doi.org/10.3892/mco.2025.2828
MLA
El Ahanidi, H., El Azzouzi, M., Addoum, B., Tetou, M., Hassan, I., Al Bouzidi, A., Oukabli, M., Hafidi Alaoui, C., Chaoui, I., Benbacer, L., El Mzibri, M., Ameur, A., Jandus, C., Attaleb, M."STAT1 and STAT4 expression as prognostic biomarkers in patients with bladder cancer". Molecular and Clinical Oncology 22.4 (2025): 33.
Chicago
El Ahanidi, H., El Azzouzi, M., Addoum, B., Tetou, M., Hassan, I., Al Bouzidi, A., Oukabli, M., Hafidi Alaoui, C., Chaoui, I., Benbacer, L., El Mzibri, M., Ameur, A., Jandus, C., Attaleb, M."STAT1 and STAT4 expression as prognostic biomarkers in patients with bladder cancer". Molecular and Clinical Oncology 22, no. 4 (2025): 33. https://doi.org/10.3892/mco.2025.2828
Copy and paste a formatted citation
x
Spandidos Publications style
El Ahanidi H, El Azzouzi M, Addoum B, Tetou M, Hassan I, Al Bouzidi A, Oukabli M, Hafidi Alaoui C, Chaoui I, Benbacer L, Benbacer L, et al: STAT1 and STAT4 expression as prognostic biomarkers in patients with bladder cancer. Mol Clin Oncol 22: 33, 2025.
APA
El Ahanidi, H., El Azzouzi, M., Addoum, B., Tetou, M., Hassan, I., Al Bouzidi, A. ... Attaleb, M. (2025). STAT1 and STAT4 expression as prognostic biomarkers in patients with bladder cancer. Molecular and Clinical Oncology, 22, 33. https://doi.org/10.3892/mco.2025.2828
MLA
El Ahanidi, H., El Azzouzi, M., Addoum, B., Tetou, M., Hassan, I., Al Bouzidi, A., Oukabli, M., Hafidi Alaoui, C., Chaoui, I., Benbacer, L., El Mzibri, M., Ameur, A., Jandus, C., Attaleb, M."STAT1 and STAT4 expression as prognostic biomarkers in patients with bladder cancer". Molecular and Clinical Oncology 22.4 (2025): 33.
Chicago
El Ahanidi, H., El Azzouzi, M., Addoum, B., Tetou, M., Hassan, I., Al Bouzidi, A., Oukabli, M., Hafidi Alaoui, C., Chaoui, I., Benbacer, L., El Mzibri, M., Ameur, A., Jandus, C., Attaleb, M."STAT1 and STAT4 expression as prognostic biomarkers in patients with bladder cancer". Molecular and Clinical Oncology 22, no. 4 (2025): 33. https://doi.org/10.3892/mco.2025.2828
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team