Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November 2012 Volume 6 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November 2012 Volume 6 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effect of Etiasa on the expression of matrix metalloproteinase-2 and tumor necrosis factor-α in a rat model of ulcerative colitis

Retraction in: /10.3892/mmr.2025.13513
  • Authors:
    • Jing-Wei Mao
    • Hai-Ying Tang
    • Xiao-Yan Tan
    • Ying-De Wang
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, The First Affiliated Hospital of Dalian Medical University, Dalian, Liaoning 116011, P.R. China, Department of Respiratory, The First Affiliated Hospital of Dalian Medical University, Dalian, Liaoning 116011, P.R. China
  • Pages: 996-1000
    |
    Published online on: August 7, 2012
       https://doi.org/10.3892/mmr.2012.1021
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of this study was to determine the disease activity index (DAI) and the colonic mucosa damage index (CMDI), and to detect the colonic mucosal expression levels of matrix metalloproteinase-2 (MMP-2) and tumor necrosis factor-α (TNF-α) in rats with ulcerative colitis (UC). We also aimed to investigate the protective role of Etiasa in UC. Sprague Dawley (SD) rats were randomly divided into three groups: the control, an Etiasa-treated group and a UC model group. Rats were sacrificed on days 14, 21, 35 or 56 following the administration of treatment by enema and the DAI, CMDI and colonic expression levels of MMP-2 and TNF-α were assessed. In the UC model group, the DAI and CDMI scores and the colonic expression levels of MMP-2 and TNF-α increased significantly compared with the control at all timepoints, and were also significantly higher than those in the Etiasa-treated group. In conclusion, the expression levels of MMP-2 and TNF-α increased significantly in rats with UC. Etiasa reduces colonic mucosal damage by downregulating the expression of MMP-2 and TNF-α.

Introduction

Ulcerative colitis (UC) is a type of nonspecific inflammatory bowel disease for which the etiology and disease mechanism are not completely clear. It has become evident that the main pathological change of UC is the excessive degradation of the colonic extracellular matrix (ECM) and the formation of colonic mucosal ulcers (1). Matrix metalloproteinases (MMPs) and several cytokines are important in the colonic ECM degradation process and the generation of mucosal inflammation and ulcers (2,3). Etiasa, which belongs to the aminosalicylic acid class of drugs, is one of the main treatment options for UC. In the current study, Etiasa was administered by gastric lavage to rats with UC. We determined the disease activity index (DAI), colonic mucosa damage index (CMDI) and colonic mucosal expression levels of matrix metalloproteinase-2 (MMP-2) and tumor necrosis factor-α (TNF-α) and then considered the mechanism by which Etiasa alleviates UC to provide the theoretical basis for a novel treatment for UC.

Materials and methods

Materials

Healthy male Sprague Dawley (SD) rats weighing 180–220 g and aged 4–8 weeks were supplied by the SPF Laboratory Animal Center of Dalian Medical University. 2,4,6-Trinitrobenzenesulfonic acid solution (TNBS) was purchased from Sigma (St. Louis, MO, USA). Etiasa (mesalazine sustained release granules) was supplied by Ipsen (Tianjin, China). MMP-2 and TNF-α polyclonal antibodies were supplied by Bioworld Technology (Nanjing, China). The MaxVision™ plus Poly-HRP (mouse/rabbit) IHC kit was supplied by Beijing Zhongshan Goldenbridge Biotechnology Co., Ltd. (Beijing, China). Primers, DNA markers (DL 2000), and Takara RNA polymerase chain reaction (PCR) kit (AMV) Ver.3.0 were purchased from Takara Co., Ltd. (Dalian, China).

Rats were maintained in a room with constant temperature (22±1°C) and a dark-light cycle (12 h/12 h), and housed in cages, with a maximum of 5 rats per cage. They were fed with standard laboratory food and water for one week prior to the experiments. All experimental procedures were conducted according to the institutional guidelines for the care and use of laboratory animals of Dalian Medical University, Dalian, China, and conformed to the National Institutes of Health Guide for Care and Use of Laboratory Animals (Publication no. 85–23, revised 1996). All protocols were approved by the Institutional Animal Care and Use Committee of Dalian Medical University.

Animal treatment

A total of 72 SD rats were randomly divided into three groups: the control, an Etiasa-treated group and a UC model group, each comprising 24 rats. The SD rat model of UC was established by administering a mixed solution of TNBS (100 mg/kg) and 50% ethanol (0.25 ml) by enema. The control group was subjected to enema and gastric lavage with normal saline. For the Etiasa-treated group, TNBS was administered by enema and Etiasa was administered by gastric lavage (80 mg/kg twice a day) (4). The UC model group was subjected to TNBS enema and gastric lavage with saline. Rats from all groups were sacrificed on days 14, 21, 35 and 56; 6 rats/group were sacrificed on each of these days following the enema, and colonic tissue 2.0–10.0 cm from the anus was collected for reverse transcription polymerase chain reaction (RT-PCR) and immunohistochemical analysis.

DAI and CMDI scoring

The rats were weighed and checked for behavior, stool consistency and the presence of gross blood in the stool every day. The scores were assigned as follows: percentage of body weight reduction (0, no change; 1, 1–5%; 2, 6–10%; 3, 11–15%; 4, >15%); stool consistency (0, normal; 2, loose; 4, diarrhea); and the presence of fecal blood (0, normal; 2, positive occult blood test; 4, visible bleeding) (5). The DAI was calculated as the sum of these scores.

The rats were sacrificed at the timepoints indicated and the entire colon was excised from the cecum to the anus and opened longitudinally. Macroscopic damage was evaluated using CMDI, a validated scoring system with slight modifications (6). The numerical rating score was as follows: 0, no inflammation; 1, local hyperemia without ulcers and/or stool consistency; 2, ulceration without hyperemia; 3, ulceration and adhesions at 1 site; 4, ≥2 sites of inflammation and ulceration extending >1 cm; 5, ulceration extending >2 cm.

MMP-2 and TNF-α mRNA expression

mRNA was extracted from the colonic tissue samples using TRIzol according to the manufacturer’s instructions (Invitrogen Life Technologies, Carlsbad, CA, USA) and RT-PCR was performed according to the instructions of the PCR kit. An equal amount of cDNA from each sample was amplified using primers specific to each gene (Table I). DNA amplification was carried out using a thermocycler under the following conditions: for MMP-2, 35 cycles of denaturation at 94°C for 30 sec annealing at 54°C for 30 sec and extension at 72°C for 60 sec; for TNF-α, 35 cycles of denaturation at 94°C for 45 sec, annealing at 54°C for 30 sec and extension at 72°C for 60 sec; and for β-actin, 35 cycles of denaturation at 94°C for 30 sec, annealing at 54°C for 30 sec and extension at 72°C for 60 sec. RT-PCR products were measured by photodensitometry using a gel image analysis system following agarose gel electrophoresis and ethidium bromide staining.

Table I

Oligonucleotide sequences of target gene primers.

Table I

Oligonucleotide sequences of target gene primers.

mRNA genesPrimers (5′-3′)PCR product (bp)
MMP-2Sense: GTGCTGAAGGACACCCTCAAGAAGA
Antisense: TTGCCGTCCTTCTCAAAGTTGTACG
632
TNF-αSense: CAGCAGATGGGCTGTATCTT
Antisense: AAGTAGACCTCCCGGACTCG
140
β-actinSense: CTGTCCCTGTATGCCTCTG
Antisense: ATGTCACGCACGATTTCCG
218

[i] MMP-2, matrix metalloproteinase-2; TNF-α, tumor necrosis factor-α.

Measurement of MMP-2 and TNF-α protein expression

Immunohistochemistry was conducted according to the instructions of the MaxVision™ kit. Image analysis software (Image-pro plus 6.0) was used to measure the light density of the positive control cells in which the cytoplasm was tan-yellow or brown following 3,3′-diaminobenzidine (DAB) staining. For each section, the positive integrated optical density (IOD) and total area of five representative visual fields without overlap were observed under a high-powered microscope (x400). The ratio of IOD and total area represents the mean value of the optical density, with a higher ratio indicating a higher level of protein expression.

Statistical analysis

The data revealed a normal distribution and are expressed as the mean ± standard deviation (SD). The responses of different experimental groups were analyzed using one-way ANOVA. Spearman correlation analysis was used to study the correlation between MMP-2 and TNF-α expression levels. P<0.05 was considered to indicate a statistically significant result. All statistical analyses were performed using SPSS 11.5 for Windows.

Results

DAI and CMDI scores

The DAI and CMDI scores of the UC model group were significantly higher than those of the control (P<0.05) at all timepoints. The DAI and CMDI scores of the Etiasa-treated group were reduced significantly on days 14, 21, 35 and 56 compared with those of the UC model group (P<0.05; Table II).

Table II

DAI and CMDI of three groups at different times (mean ± SD).

Table II

DAI and CMDI of three groups at different times (mean ± SD).

Control groupModel groupEtiasa-treated group



TimeDAICMDIDAICMDIDAICMDI
Day 140.06±0.140.02±0.013.39±0.25a3.83±0.75a2.17±0.35b3.00±0.63b
Day 210.00±0.000.00±0.002.94±0.25a2.5±0.55a1.06±0.25b2.00±0.63b
Day 350.00±0.000.02±0.022.22±0.46a2.33±0.52a0.39±0.28b1.5±0.56b
Day 560.00±0.000.00±0.001.89±0.27a1.67±0.52a0.17±0.18b0.83±0.75b

a P<0.05 vs. control group,

b P<0.05 vs. model group.

{ label (or @symbol) needed for fn[@id='tfn4-mmr-06-05-0996'] } DAI, disease activity index; CMDI, colonic mucosa damage index.

Results of RT-PCR

The expression levels of MMP-2 and TNF-α mRNA in the colonic mucosa were significantly higher in the UC model group than in the control group (P<0.05). On days 14, 21, 35 and 56, the two index values for the Etiasa-treated group were significantly lower than those of the model group (P<0.05; Table III; Figs. 1 and 2).

Figure 1

Colonic mucosal mRNA expression of matrix metalloproteinase-2 (MMP-2) and tumor necrosis factor-α (TNF-α) in the ulcerative colitis (UC) model, Etiasa-treated and control groups on days 14 and 21. Expression levels of MMP-2 and TNF-α in the colonic mucosa were significantly higher in the UC model group than in the control group (P<0.05). On days 14 and 21, the two index values for the Etiasa-treated group were significantly lower than those of the UC model group (P<0.05). M, Marker; UC, UC model group; E, Etiasa-treated group; C, control group.

Figure 2

Colonic mucosal mRNA expression of matrix metalloproteinase-2 (MMP-2) and tumor necrosis factor-α (TNF-α) in the ulcerative colitis (UC) model, Etiasa-treated and control groups on days 35 and 56. Expression levels of MMP-2 and TNF-α in the colonic mucosa were significantly higher in the UC model group than in the control group (P<0.05). On days 35 and 56, the two index values in the Etiasa-treated group was significantly lower than those of the UC model group (P<0.05). M, Marker; UC, UC model group; E, Etiasa-treated group; C, control group.

Table III

Colonic mucosal mRNA expression of MMP-2 and TNF-α (mean ± SD).

Table III

Colonic mucosal mRNA expression of MMP-2 and TNF-α (mean ± SD).

Control groupModel groupEtiasa-treated group



TimeMMP-2TNF-αMMP-2TNF-αMMP-2TNF-α
Day 140.12±0.010.29±0.030.67±0.07a1.17±0.11a0.53±0.05b0.79±0.09b
Day 210.11±0.010.30±0.030.60±0.06a0.75±0.09a0.41±0.05b0.53±0.06b
Day 350.13±0.010.27±0.030.52±0.05a0.56±0.08a0.33±0.03b0.44±0.05b
Day 560.12±0.010.29±0.030.44±0.05a0.45±0.06a0.23±0.03b0.33±0.04b

a P<0.05 vs. control group,

b P<0.05 vs. model group.

{ label (or @symbol) needed for fn[@id='tfn7-mmr-06-05-0996'] } MMP-2, matrix metalloproteinase-2; TNF-α, tumor necrosis factor-α.

Results of immunohistochemical analysis

The expression levels of the MMP-2 and TNF-α proteins in the colonic mucosa of the UC model group were significantly higher than in those of the control group (P<0.05). Compared with the model group, the expression levels of the MMP-2 and TNF-α proteins in the Etiasa-treated group were reduced significantly on days 14, 21, 35 and 56 (P<0.05; Table IV; Figs. 3 and 4).

Figure 3

Colonic mucosal matrix metalloproteinase-2 (MMP-2) protein expression in the ulcerative colitis (UC) model, Etiasa-treated and control groups at different timepoints. Colonic expression of MMP-2 increased significantly in the UC model group compared with the control group (P<0.05) and was also significantly higher than in the Etiasa-treated group on days 14, 21, 35 and 56 (P<0.05).

Figure 4

Colonic mucosal tumor necrosis factor-α (TNF-α) protein expression in the ulcerative colitis (UC) model, Etiasa-treated and control groups at different timepoints. Colonic expression of TNF-α increased significantly in the UC model group compared with the control group (P<0.05) and was also significantly higher than in the Etiasa-treated group on days 14, 21, 35 and 56 (P<0.05).

Table IV

Colonic mucosal protein expression levels of MMP-2 and TNF-α (mean ± SD).

Table IV

Colonic mucosal protein expression levels of MMP-2 and TNF-α (mean ± SD).

Control groupModel groupEtiasa-treated group



TimeMMP-2TNF-αMMP-2TNF-αMMP-2TNF-α
Day 140.01±0.010.00±0.000.07±0.01a0.07±0.01a0.06±0.01b0.05±0.01b
Day 210.00±0.000.00±0.000.06±0.01a0.06±0.01a0.04±0.01b0.04±0.01b
Day 350.01±0.020.00±0.000.05±0.01a0.05±0.01a0.04±0.00b0.03±0.00b
Day 560.00±0.000.00±0.000.04±0.00a0.03±0.00a0.02±0.01b0.02±0.01b

a P<0.05 vs. control group,

b P<0.05 vs. model group.

{ label (or @symbol) needed for fn[@id='tfn10-mmr-06-05-0996'] } MMP-2, matrix metalloproteinase-2; TNF-α, tumor necrosis factor-α.

Correlation of MMP-2 and TNF-α protein expression levels

Correlation studies revealed that the expression levels of the MMP-2 protein were significantly correlated with those of the TNF-α protein. The correlation factor was 0.963 (P<0.05).

Discussion

UC is a type of nonspecific inflammatory bowel disease for which the etiology and disease mechanism are not completely clear. In physiological conditions, the degradation and synthesis of ECM are in a state of dynamic balance. Excessive degradation and insufficient synthesis of ECM are the principal pathophysiological changes occurring in the process of UC. MMPs are the predominant hydrolytic enzymes that degrade the ECM, so the increased activity of MMPs is responsible for the tissue damage of the colon in UC. It is well accepted that inflammatory cytokines participate in the pathogenesis of UC. The relationship between MMPs and inflammatory cytokines in the pathogenesis of UC remains to be studied.

MMP-2 is the matrix metalloproteinase whose main function is to degrade collagen subtypes, including types IV and V, in the matrix. The synthesis and secretion of MMP-2 are regulated by several factors, including TNF-α, IL-1β, AP-1 and NF-κB (7). With regard to the relationships between MMPs and the pathogenesis of UC, studies have shown that the expression levels of MMP-2 and MMP-9 in the parts of the colonic mucosa affected by UC inflammation are significantly higher than those in the unaffected parts (1). Matsuno et al assessed the expression of MMPs in the inflamed colonic mucosa of 52 patients with UC and the results demonstrated that MMP-2 was expressed in the ECM cells and that the expression of MMP-2 in the diseased mucosa was significantly higher than that in the unaffected areas (8). In our study, we tested the MMP-2 expression levels in colonic mucosa using RT-PCR and immunohistochemistry. Our results revealed that DAI, CMDI and the expression levels of MMP-2 were significantly higher in the UC model animals than in the control group, and that decreased MMP-2 expression was associated with improvements in the DAI and CMDI. These data show that overexpression of MMP-2 is related to mucosal injury and is particularly significant for inflammation.

Disorders in the regulation of the cytokine network in the colonic mucosa lead to the onset of UC (9). TNF-α is a significant proinflammatory cytokine which is important in the pathogenesis of UC (10). Yeckes et al (11) observed that there was extensive lymphocyte infiltration and TNF-α expression in the inflamed colonic areas of UC patients. Plasma levels of TNF-α were also increased, which identified TNF-α as a participant in the colonic mucosal and systemic inflammation in patients with UC. Our results demonstrated that at the transcriptional and protein levels, the expression levels of TNF-α in the diseased areas of the UC model animals were significantly higher than in those of the controls. Immunohistochemistry revealed that the TNF-α positively stained cells were predominantly mono-macrophages.

In the present study, MMP-2 was found to be closely correlated with TNF-α, indicating there is a relationship between MMPs and cytokines. A previous study has shown that several cytokines affect the expression of MMPs during the inflammatory response (12). It is believed that MMPs not only appear in downstream inflammatory responses, but also exert a feedback effect on cytokines. Black et al (13) reported that MMPs were able to activate TNF-α on cell membranes via hydrolysis.

Since the beginning of the 1940s, salazosulfapyridine (SASP) has been used in the treatment of inflammatory bowel disease. Almost 40 years later, 5-aminosalicylic acid (5-ASA), which is generated by the action of azo-reducing enzymes in the colon, was identified as the therapeutically active moiety of SASP. Mesalazine is a 5-aminosalicylic acid compound that is the first-line treatment for patients with mild-to-moderate UC. There are multiple formulations of mesalamine available, which are primarily differentiated by their means of delivering active mesalamine to the colon. Mesalazine may treat UC by inhibiting prostaglandin synthesis, preventing leukotriene formation and eliminating oxygen radicals (14). Mesalazine slow-release granules (trade name: Etiasa) and controlled-release tablets release 5-ASA in the alkaline environment of the lower gastrointestinal tract following oral adminstration.

In this study, Etiasa was administered by gastric lavage to rats with UC. We determined the DAI, CMDI and colonic mucosal expression levels of MMP-2 and TNF-α and then considered the mechanism by which Etiasa alleviates UC to provide the theoretical basis for a novel treatment for UC.

Our study revealed that in the UC model group, the DAI and CDMI scores were significantly higher than those of the control group at all timepoints, and were also significantly higher on days 14, 21, 35 and 56 than those of the Etiasa-treated group. From the DAI and CMDI scores, we demonstrate that Etiasa may remit the symptoms of UC, including diarrhea and hematochezia, reduce pathological damage of the colonic mucosa and promote colonic ulcer healing.

The results also demonstrated that at the transcriptional and protein levels, the expression levels of MMP-2 and TNF-α were significantly higher in the model group on days 14, 21, 35 and 56 than those in the Etiasa-treated group. Our study identified that Etiasa was able to inhibit the expression of TNF-α at the transcriptional level and subsequently lead to the decreased expression of the TNF-α protein by the colonic mucosa, and may also suppress the expression of MMP-2. We conclude that Etiasa is capable of treating UC by the mechanism of downregulating the colonic expression levels of TNF-α and MMP-2, in addition to the known mechanisms we have previously mentioned.

We also observed that the DAI and CMDI scores and colonic mucosal expression levels of MMP-2 and TNF-α in the Etiasa-treated group on day 3 and 7 were not significantly different from those of the model group at the same timepoints. A possible reason for this is that rats suffering the worst reaction to the TNBS enema at day 7 of the evaluation were included in the UC model group. However, Etiasa did not achieve its response at the shorter (7-day) treatment time.

In conclusion, our study confirmed that the colonic mucosa in UC expressed MMP-2 and TNF-α excessively. Etiasa may treat UC by the mechanism of downregulating the colonic expression levels of TNF-α and MMP-2.

Acknowledgements

The authors would like to thank Wang Gong Jun for his excellent technical assistance with immunohistochemistry and the SPF Laboratory Animal Center of Dalian Medical University. This study was supported by a grant from the Ipsen Diarrhea Fund (IDF-2008-03).

References

1 

Baugh MD, Perry MJ, Hollander AP, Davies DR, Cross SS, Lobo AJ, Taylor CJ and Evans GS: Matrix metalloproteinase levels are elevated in inflammatory bowel disease. Gastroenterology. 117:814–822. 1999. View Article : Google Scholar : PubMed/NCBI

2 

Wang YD and Yan PY: Expression of matrix metalloproteinase-1 and tissue inhibitor of metalloproteinase-1 in ulcerative colitis. World J Gastroenterol. 12:6050–6053. 2006.PubMed/NCBI

3 

Wang YD and Mao JW: Expression of matrix metalloproteinase-1 and tumor necrosis factor-alpha in ulcerative colitis. World J Gastroenterol. 13:5926–5932. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Okayasu I, Hatakeyama S, Yamada M, Ohkusa T, Inagaki Y and Nakaya R: A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology. 98:694–702. 1990.PubMed/NCBI

5 

Porter SN, Howarth GS and Butler RN: An orally administered growth factor extract derived from bovine whey suppresses breath ethane in colitic rats. Scand J Gastroenterol. 33:967–974. 1998. View Article : Google Scholar : PubMed/NCBI

6 

Dieleman LA, Palmen MJ, Akol H, Bloemena E, Peña AS, Meuwissen SG and Van Rees EP: Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clin Exp Immunol. 114:385–391. 1998. View Article : Google Scholar : PubMed/NCBI

7 

Rosenberg GA, Navratil M, Barone F and Feuerstein G: Proteolytic cascade enzymes increase in focal cerebral ischemia in rat. J Cereb Blood Flow Metab. 16:360–366. 1996. View Article : Google Scholar : PubMed/NCBI

8 

Matsuno K, Adachi Y, Yamamoto H, Goto A, Arimura Y, Endo T, Itoh F and Imai K: The expression of matrix metalloproteinase matrilysin indicates the degree of inflammation in ulcerative colitis. J Gastroenterol. 38:348–354. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Hibi T, Inoue N, Ogata H and Naganuma M: Introduction and overview: recent advances in the immunotherapy of inflammatory bowel disease. J Gastroenterol. 38(Suppl 15): 36–42. 2003.

10 

Brynskov J, Nielsen OH, Ahnfelt-Rønne I and Bendtzen K: Cytokines in inflammatory bowel disease. Scand J Gastroenterol. 27:897–906. 1992. View Article : Google Scholar : PubMed/NCBI

11 

Yeckes AR and Hoffenberg EJ: Rapid infliximab infusions in pediatric inflammatory bowel disease. J Pediatr Gastroenterol Nutr. 49:151–154. 2009. View Article : Google Scholar : PubMed/NCBI

12 

MacDonald TT, Monteleone G and Pender SL: Recent developments in the immunology of inflammatory bowel disease. Scand J Immunol. 51:2–9. 2000. View Article : Google Scholar : PubMed/NCBI

13 

Black RA, Rauch CT, Kozlosky CJ, et al: A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature. 385:729–733. 1997. View Article : Google Scholar : PubMed/NCBI

14 

Christensen LA: 5-Aminosalicylic acid containing drugs. Delivery, fate, and possible clinical implications in man. Dan Med Bull. 47:20–41. 2000.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Mao J, Tang H, Tan X and Wang Y: Effect of Etiasa on the expression of matrix metalloproteinase-2 and tumor necrosis factor-α in a rat model of ulcerative colitis Retraction in /10.3892/mmr.2025.13513. Mol Med Rep 6: 996-1000, 2012.
APA
Mao, J., Tang, H., Tan, X., & Wang, Y. (2012). Effect of Etiasa on the expression of matrix metalloproteinase-2 and tumor necrosis factor-α in a rat model of ulcerative colitis Retraction in /10.3892/mmr.2025.13513. Molecular Medicine Reports, 6, 996-1000. https://doi.org/10.3892/mmr.2012.1021
MLA
Mao, J., Tang, H., Tan, X., Wang, Y."Effect of Etiasa on the expression of matrix metalloproteinase-2 and tumor necrosis factor-α in a rat model of ulcerative colitis Retraction in /10.3892/mmr.2025.13513". Molecular Medicine Reports 6.5 (2012): 996-1000.
Chicago
Mao, J., Tang, H., Tan, X., Wang, Y."Effect of Etiasa on the expression of matrix metalloproteinase-2 and tumor necrosis factor-α in a rat model of ulcerative colitis Retraction in /10.3892/mmr.2025.13513". Molecular Medicine Reports 6, no. 5 (2012): 996-1000. https://doi.org/10.3892/mmr.2012.1021
Copy and paste a formatted citation
x
Spandidos Publications style
Mao J, Tang H, Tan X and Wang Y: Effect of Etiasa on the expression of matrix metalloproteinase-2 and tumor necrosis factor-α in a rat model of ulcerative colitis Retraction in /10.3892/mmr.2025.13513. Mol Med Rep 6: 996-1000, 2012.
APA
Mao, J., Tang, H., Tan, X., & Wang, Y. (2012). Effect of Etiasa on the expression of matrix metalloproteinase-2 and tumor necrosis factor-α in a rat model of ulcerative colitis Retraction in /10.3892/mmr.2025.13513. Molecular Medicine Reports, 6, 996-1000. https://doi.org/10.3892/mmr.2012.1021
MLA
Mao, J., Tang, H., Tan, X., Wang, Y."Effect of Etiasa on the expression of matrix metalloproteinase-2 and tumor necrosis factor-α in a rat model of ulcerative colitis Retraction in /10.3892/mmr.2025.13513". Molecular Medicine Reports 6.5 (2012): 996-1000.
Chicago
Mao, J., Tang, H., Tan, X., Wang, Y."Effect of Etiasa on the expression of matrix metalloproteinase-2 and tumor necrosis factor-α in a rat model of ulcerative colitis Retraction in /10.3892/mmr.2025.13513". Molecular Medicine Reports 6, no. 5 (2012): 996-1000. https://doi.org/10.3892/mmr.2012.1021
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team