This article is mentioned in:

Introduction

Acupuncture is one of the major therapies that has been used in traditional Chinese medicine for at least 2,500 years, and it remains an effective, safe and convenient intervention for patients. Acupuncture practitioners insert thin, solid, metallic needles into specific acupuncture points on the skin known as acupoints, which are special nodes (or outlets) on the meridians. Acupoints are utilized to correct the imbalances of the flow of qi in the body to treat various diseases. The World Health Organization (WHO) listed 43 indications for acupuncture in 1980 (1) and classified the diseases treated by acupuncture into 4 categories, including 107 illnesses, in 2002 (2). The National Institutes of Health (NIH) recommended acupuncture as an adjunctive treatment in comprehensive management programs, such as those for addiction, stroke rehabilitation and asthma (3,4). In recent years, acupuncture has also emerged as an alternative and satisfactory treatment for symptom management in cancer (5), functional gastrointestinal disorders (6) and rheumatic conditions (7).

Acupuncture causes multiple biological alterations in humans (4). In recent years, researchers have attempted to identify changes in active substances after acupuncture and the correlation between the changes in active substances and the effect of acupuncture. It is thought that the therapeutic effect of acupuncture includes 2 parts: the psychological and physiological effects (8). The physiological effect of acupuncture is composed of point-specific, treatment-specific and non-invasive skin contact physiological effects (9). Due to the significant effect on healthy volunteers (10,11), the condition-specific physiological effect is thought to be one of the most important physiological effects of acupuncture. Although a large number of studies have been carried out to examine the effects of acupuncture under different morbid conditions, the regulatory mechanism of acupuncture remains unclear, and the evidence that has been acquired is not compelling. We will only be able to distinguish the effects of acupuncture on specific active substances under morbid conditions once we are able to accurately analyze the general effects of acupuncture under normal conditions, and clarify the regulatory mechanisms involved.

Previous studies have shown that acupuncture in healthy volunteers has given rise to biological responses that regulate important physiological processes. Using functional magnetic resonance imaging (fMRI) of the brain, a previous randomized, controlled trial showed that acupuncture improves motor and sensory functions in healthy volunteers (12). There was a statistically significant increase in the number of CD4+ and CD8+ cells, and in interleukin (IL)-4, IL-1β and interferon-γ (IFN-γ) levels in the cells after stimulation of meridian points by acupuncture (13). Acupuncture also modifies the mediation of the autonomic innervations of the heart. Acupuncture at the PC6 (wrists) and ST36 (lower legs) points has been shown to help athletes significantly decrease their maximum heart rate, oxygen consumption and blood lactic acid production 30 min after exercise (14). It has been reported that both specific and non-specific factors may play a role in acupuncture therapy for pain; however, only real acupuncture (non-placebo) has shown specific physiological effects (15). Another study demonstrated that the physiological effects of acupuncture may be influenced by anxiety (16). Additionally, acupuncture treatment regulates autonomic nervous system functions, such as blood pressure regulation, sphincter of Oddi relaxation, immune modulation (17) and electrodermal activity (18). However, gene expression profile studies on the physiological effects of acupuncture under normal conditions are still lacking.

High-throughput technologies, such as microarray and serial analyses of gene expression (SAGE), may help to reveal the background gene expression in response to acupuncture and highlight the regulatory mechanism of acupuncture under morbid conditions. SAGE, a powerful expression profiling method that is very useful in dissecting this complex system, has been applied to qualitatively and quantitatively evaluate the transcription of genes by length without the prerequisite of a hybridization probe for each transcript (19).

In this study, two SAGE tag libraries from the lung tissues of normal and acupuncture-treated rats were constructed. The aim of this study was to determine the influence of acupuncture on the gene expression profiles of lung tissue from normal rats. The results from this analysis may elucidate the regulatory mechanism of acupuncture under normal conditions and help to specify its effects under morbid conditions in the future.

Materials and methods

Animal and acupuncture treatment

Pathogen-free, male, Sprague-Dawley (SD) rats (4 weeks of age, 110–130 g; SLAC Laboratory Animal Co. Ltd., Shanghai, China) were raised in a pathogen-free, rodent facility and were provided with food and water ad libitum. The rats were randomly divided into 2 groups (each group contained 8 rats): normal rats (control) and normal rats treated with acupuncture. The rats were kept in animal facilities that had been approved by the Shanghai Committee for Accreditation of Laboratory Animals, and the animal experiments conformed to the regulations of the State Science and Technology Commission.

Three common acupoints for treating lung-related diseases were selected and manipulated at the same time in the acupuncture group, namely dazhui (GV14, located between the C7 and T1 vertebrae), bilateral fengmen (BL12, foveola, located laterally between the T2 and T3 vertebrae) and bilateral feishu (BL13, foveola, located laterally between the T3 and T4 vertebrae). Manual acupuncture was performed once every other day for 2 weeks by a well-trained acupuncturist (7 times in total). The protocol of acupuncture treatment has been described previously (20). Briefly, disposable, stainless needles (0.30×13 mm) were inserted ~5 mm deep into the skin, and the needles were twisted evenly, ~360°, at the rate of 60 times/min for 20 sec. The needles were manipulated every 5 min, and were then withdrawn after 20 min. Each rat was placed on a suspended shelf (50×45 mm, ~50 cm above the ground) in order to allow the animal to stand still without anesthesia. Rats in the control group were handled in the same manner as the animals in the acupuncture group, with the exception of acupuncture treatments. At the end of 2 weeks, all animals were sacrificed. Total RNA was extracted from the lungs of the rats and frozen immediately in liquid nitrogen.

Construction, annotation and confirmation of the SAGE libraries

The construction and annotation of the SAGE libraries have been described previously (21). The confirmation of the 2 SAGE libraries was performed by quantitative real-time PCR (qRT-PCR) on an Applied Biosystems 7300 Real-Time PCR System using the Toyobo Real-time PCR Master Mix (Toyobo, Osaka, Japan). Primer sequences are listed in Table I. The expression ratio was calculated according to the 2−ΔΔCt method (22). Transcripts with a 2-fold increase in expression were considered upregulated, and those with a 0.5-fold decrease in expression were considered downregulated.

Table I Primer sequences of the real-time PCR.

Table I

Primer sequences of the real-time PCR.

Genes	Sequences (5′-3′)
Sftpa1	Forward AGCCAGTTTCGCATTCCCT
	Reverse ATGTGAAGGCCCATGAGCA
Col6a2	Forward ATGGAAGCCAGAACCAGCAAC
	Reverse CCACGTGCGAGAAAGAATTGA
Col4a1	Forward GCAATGCTGAATCGTCCCA
	Reverse TGGAGATGCCAGATGGTTAGG
GAPDH	Forward TCCTGCACCACCAACTGCTTAG
	Reverse AGTGGCAGTGATGGCATGGACT

[i] Sftpa1, surfactant, pulmonary-associated protein A1; Col6a2, procollagen, the α2 chain of collagen VI; Col4a1, procollagen, the α1 chain of collagen IV.

Bioinformatic analysis of SAGE tags

Genes that were differentially expressed (P<0.05) between the 2 SAGE libraries were functionally annotated and classified using the Database for Annotation, Visualization and Integrated Discovery (DAVID) Functional Annotation Tool (http://david.abcc.ncifcrf.gov/), a web-based tool that provides integrated solutions for the annotation and analyses of genome-scale datasets that are derived from high-throughput technologies, such as microarray or SAGE (23).

To understand the key regulatory processes in acupuncture treatment, the Gene Ontology (GO) Tree Machine (http://www.genereg.ornl.gov/gotm/) was applied for bioinformatic analyses of the acupuncture-regulated expression data. The GO Tree Machine generates a tree-like structure that is used to navigate the GO categories for the input gene sets (24). Statistical analyses of the enrichments were performed to identify the most significant GO categories of the input gene sets and to suggest their potential biological importance in the categories.

Statistical analyses

Statistical analyses used to determine the significance of each of the 2 SAGE libraries were performed using Monte Carlo analysis. The enrichments of the GO Tree Machine were determined to be statistically significant by the hypergeometric test (24).

Results

General analysis of SAGE libraries

The 2 SAGE libraries of the rat lungs were deposited into the SAGEmap database at the National Center for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/geo), and the accession numbers given to these libraries are GSM45195 and GSM279945. The genes that were matched to the expressed sequence tags (ESTs) of the 2 libraries are listed in Table II. By comparing the SAGE data of the control and acupuncture libraries, 144 differentially expressed tags (P<0.05, Table III) were identified. Among these tags, 78 were upregulated and 66 were downregulated.

Table II Summary of serial analysis of gene expression (SAGE) analysis of the 2 libraries.

Table II

Summary of serial analysis of gene expression (SAGE) analysis of the 2 libraries.

SAGE tag	Control	Acupuncture
Total tags	28,284	29,284
Unique tags	12,857	12,412
Genes matched	54.1%	50.5%
ESTs matched	38.5%	17.0%
Not matched	7.4%	32.5%

[i] EST, expressed sequence tag.

Table III One hundred and forty-four differentially expressed tags between the libraries of control and acupuncture.

Table III

One hundred and forty-four differentially expressed tags between the libraries of control and acupuncture.

Tag sequences	Control	Acupuncture	Fold	UniGene	Annotation
Upregulated (78)
CACACTAACC	288	499	1.7	2283	Lyz, lysozyme
ATGAAATCAA	197	267	1.4	40171	Rps4x, ribosomal protein S4, X-linked
TGGGTTGTCT	193	283	1.5	36610	Tpt1, tumor protein, translationally-controlled 1
ATACGAACTG	93	134	1.4	11343	Sftpa1, surfactant, pulmonary-associated protein A1
AGGAGGCTAC	38	67	1.8	108039	Rpl14, ribosomal protein L14
GGCAAGCCCC	35	59	1.7	2262	Rpl10a, ribosomal protein L10A
AACCGCTTTT	35	58	1.7	2989	GIIg15b, global ischemia induced protein GIIG15B
AAAATGCACA	32	55	1.7	2267	Defb2, defensin β-2
CGGAAGGCGG	25	51	2.0	1439	Rpl36, ribosomal protein L36
GTGAAGGCGG	24	46	1.9	94935	Rps3a, ribosomal protein S3a
GGTAGCCACT	18	38	2.1	106034	Rps27a, ribosomal protein S27a
TTTGCACCTT	13	29	2.2	17145	Ctgf, connective tissue growth factor
GATGTGGCTG	12	28	2.3	3910	LOC363241, similar to eukaryotic translation elongation factor 1 β2
TGGACCTAGA	9	24	2.7	1997	Ctsh, cathepsin H
CTGTGTGATC	9	22	2.4	22047	Transcribed sequence with weak similarity to protein pir:T46271 (H. sapiens) T46271 hypothetical protein DKFZp564P1263.1 - human
TTGATTTTTT	8	21	2.6	59630	Transmembrane and coiled-coil domains 3
GGCTCAGCCT	8	21	2.6	84435	Gpi, glucose phosphate isomerase
TATGTCAAGC	7	23	3.3	8400	Rps12, ribosomal protein S12
CCCTGAGTCC	7	19	2.7	94978	Actb, actin, β
TGTACTCAAT	6	15	2.5	25771	Hnrpa1, heterogeneous nuclear ribonucleoprotein A1
TACATTTTCA	6	16	2.7	8527	Transcribed sequence with strong similarity to protein pir:S55054 (H. sapiens) S55054 Sm protein G - human
AAGACAGCTG	6	16	2.7	83667	RT1-Aw2, RT1 class Ib, locus Aw2
TTCAAAAAAA	4	12	3.0	19267	Pecr, perosisomal 2-enoyl-CoA reductase
TGCTGCGAAA	4	16	4.0	22087	LOC293618
TGTAATGTGT	3	14	4.7	2589	Cdo1, cytosolic cysteine dioxygenase 1
GAGGGAGAGG	3	11	3.7	105953	LOC315326 similar to Tenc1 protein
GAATATCGGA	3	13	4.3	10696	Pspla1, phosphatidylserine-specific phospholipase A1
AGAAAAAAAA	3	11	3.7	55036	Ciliary neurotrophic factor receptor
GTTCTTCCGT	2	10	5.0	29258	Atp5g2 ATP synthase, H transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2
GTCCTGAGAG	2	9	4.5	82672	Vamp8, vesicle-associated membrane protein 8
GGTGGGACAC	2	9	4.5	8509	Tmp21, integral membrane protein Tmp21-I (p23)
GCCACTTAGG	2	12	6.0	12102	LOC311545, similar to histocompatibility 13; presenilin-like protein 3
GATTGTCTTG	2	15	7.5	1464	LOC299104, similar to 25 kDa FK506-binding protein
CTGTCATTTG	2	11	5.5	9002	LOC361814, similar to splicing factor, arginine/serine-rich 3 (Pre-mRNA splicing factor SRP20) (X16 protein)
CTCTCTGAAT	2	9	4.5	5106	Hmgcs1, 3-hydroxy-3-methylglutaryl-coenzyme A synthase 1
CCCGTGTGCT	2	9	4.5	109735	Rps9, ribosomal protein S9
TTTCAGCAGT	1	7	7.0	47	Hprt, hypoxanthine guanine phosphoribosyl transferase
TTGAGCGACA	1	8	8.0	4223	Dkc1, dyskeratosis congenita 1, dyskerin
TGGTCTGAAA	1	9	9.0	2722	LOC315642, similar to 60S ribosomal protein L27A
TCCTTGTTTA	1	7	7.0	14866	Transcribed sequences
TATGAAATTT	1	8	8.0	29782	Fh1, fumarate hydratase 1
TATAGAGAAA	1	9	9.0	36797	HECT domain containing 1
GGAAAAGAAG	1	7	7.0	32080	Aif1, allograft inflammatory factor 1
GCTCTGATAT	1	8	8.0	3285	Dbi, diazepam binding inhibitor
CAACCGTCAT	1	9	9.0	108012	Laptm4a, lysosomal-associated protein transmembrane 4α
AGGACACCGC	1	9	9.0	2759	LOC315707, similar to Tyrosine-protein kinase CSK (C-SRC kinase)
TTTTAAAAGC	0	5	5.0	13322	LOC306542, similar to RNA polymerase III transcription initiation factor BRF2
TTCAATGGTG	0	5	5.0	98380	Pgpep1, pyroglutamyl-peptidase I
TTAAGCACTT	0	6	6.0	44465	Cmklr1, chemokine-like receptor 1
TGGAAGCTGA	0	15	15.0	55487	Gnb2l1, guanine nucleotide binding protein, β polypeptide 2-like 1
TGAGCTCTGG	0	10	10.0	2694	Mcam l-gicerin
TCGCTGTGTA	0	5	5.0	23906	LOC361305, similar to T-cell activation WD repeat protein
TAAGATTCTT	0	6	6.0	33807	LOC288620, similar to CCT (chaperonin containing TCP-1) ζ subunit
GGAAAAAATA	0	5	5.0	9406	LOC309259, similar to mage-g1
GCGTCTGCTC	0	5	5.0	1677	Gpr56, G protein-coupled receptor 56
GCAGGGTTTT	0	5	5.0	10293	Lrpap1, low density lipoprotein receptor-related protein associated protein 1
GATCTTTCCC	0	5	5.0	13589	LOC287710, similar to polymerase I-transcript release factor; PTRF
GACTGAACCC	0	5	5.0	25727	Transcribed sequence with moderate similarity to protein sp:P00722 (E. coli) BGAL_ECOLI β-galactosidase
CTGTCCTTTC	0	5	5.0	2776	Becn1, beclin 1
CTGCAGCCTG	0	5	5.0	5782	Stx5a, syntaxin 5a
CTGAGTAAAC	0	8	8.0	9829	Ager advanced glycosylation end product-specific receptor
CAACTACACA	0	10	10.0	2564	Transcribed sequences
ATTTGATATT	0	5	5.0	18892	Transcribed sequence with moderate similarity to protein sp:P00722 (E. coli) BGAL_ECOLI β-galactosidase
AGCCTGGAAA	0	6	6.0	6606	LOC300036, similar to MHC class I tum-transplantation antigen
GATGCCCCCC	85	126	1.5		No match
GTGACCACGG	41	83	2.0		No match
ACCCGCCGGG	7	17	2.4		No match
CTAACTAGTT	4	20	5.0		No match
CTGGCCTGAG	4	17	4.3		No match
CCGACGGGCG	3	11	3.7		No match
TACACTAACC	1	9	9.0		No match
CAGAGGTCCT	1	7	7.0		No match
GTTCAGGGTC	0	6	6.0		No match
CACCAGGGTG	0	6	6.0		No match
CTTTTATAAG	0	5	5.0		No match
CGAAGTGAAA	0	5	5.0		No match
AAAAATCATC	0	5	5.0		No match
TAAATTCGAT	0	5	5.0		No match
Downregulated (66)
ATAACACATA	544	401	1.4	3658	LOC287805, similar to retinoic acid inducible protein 3
CACGCCTCTC	276	186	1.5	107334	Hba1, hemoglobin, α1
TATGGCTTTA	46	21	2.2	3793	Similar to tensin
AGCCATCCCT	44	30	1.5	98846	Fga, fibrinogen, α polypeptide
CCAACAAGAA	37	24	1.5	13685	Tetraspanin 7
TCTTCTAGAA	33	15	2.2	1952	Sftpb, surfactant, pulmonary-associated protein B
ATTTGAAATA	30	18	1.7	3036	Gnai2, GTP-binding protein (G-α-i2)
TGCGAATGAT	18	7	2.6	93479	LOC301563, similar to RIKEN cDNA 5230400G24
GGCTTTACCC	18	6	3.0	104607	LOC287444, similar to Eukaryotic translation initiation factor 5A (eIF-5A) (eIF-4D) (Rev-binding factor)
CCCAATGGCC	17	8	2.1	11889	Procollagen, type VI, α2
TTGCATTCCC	16	5	3.2	3321	Transcribed sequence with weak similarity to protein sp
TTGAAAAAAA	14	5	2.8	11330	Uox, urate oxidase
CCTCTCAAGG	14	6	2.3	40119	Ly6c, Ly6-C antigen gene
GCTGAATGTC	13	5	2.6	102005	LOC287212, similar to hypothetical protein FLJ31951
ACAACTTCCT	12	4	3.0	98783	Gm2a, GM2 ganglioside activator protein
TATTCAAATA	11	3	3.7	9954	Tgfbr2, transforming growth factor, β receptor II
TACAATAAAC	11	3	3.7	7685	LOC361940, similar to 4631434O19Rik protein
TCTGGCTCCT	10	2	5.0	17033	LOC300996, similar to RNA binding motif protein 5
GACTCGAGCC	10	3	3.3	54541	Scn6a, sodium channel, voltage-gated, type 6, α polypeptide
GAAATAACGG	10	1	10.0	108127	Pgk1, phosphoglycerate kinase 1
GAAAATAAAA	10	3	3.3	100627	Fibronectin type III domain containing 3a
CCTTTGAATA	10	3	3.3	1838	Clic5, chloride intracellular channel 5
CCCTGATTTT	10	3	3.3	103276	Eif4g2, eukaryotic translation initiation factor 4γ, 2
TTCAGGTGGT	9	2	4.5	114499	Transcribed sequences
TTCAATATTA	9	2	4.5	6387	Transcribed sequences
TGCTGGACAT	9	2	4.5	41063	SREBP-2, sterol regulatory element binding protein 2
TCTACAAGAA	8	1	8.0	98667	Heat shock protein 90 kDa α (cytosolic), class B member 1
GTGCTACTCC	8	1	8.0	53801	Col4a1, procollagen, type IV, α 1
CCTTCTCAGA	8	1	8.0	61687	Ppap2a, phosphatidate phosphohydrolase type 2a
CAGAAAGATA	8	1	8.0	50677	LOC314336, similar to DEAD-box protein abstrakt homolog
TTTGTGGGAT	7	1	7.0	12550	Nfkbia, nuclear factor of κ light chain gene enhancer in B-cells inhibitor, α
TTTGATTAAA	7	1	7.0	25124	Rat insulin-like growth factor I mRNA, 3′ end of mRNA
TGGTCCTTCC	7	1	7.0	8180	Neuronal regeneration related protein
GTGACGTCCT	7	1	7.0	65477	Lfng, lunatic fringe gene homolog
GTCCCAAGGA	7	1	7.0	80835	Dci, dodecenoyl-coenzyme A δ isomerase
GCACCTCTTA	7	1	7.0	95170	LOC361522, similar to EIB-55 kDa associated protein 5
GAGTGATCCT	7	1	7.0	104649	LOC290923
GAAACAACCC	7	0	7.0	123755	LRRGT00170 mRNA, complete cds
ACCTTAAACC	7	1	7.0	6660	LOC361037, similar to mitochondrial ribosomal protein L52 CG1577-PA
TTTTTTTGTG	6	0	6.0	4108	Ppp2r1a, protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), α isoform
TTGAGCCAGC	6	0	6.0	92643	Marta1, MAP2 RNA trans-acting protein MARTA1
TGGGGCAGGC	6	0	6.0	11887	Transcribed sequence with strong similarity to protein ref:NP_080275.1 (M. musculus) RIKEN cDNA 2610110L04
TACTATTTAT	6	0	6.0	71377	LOC298573, similar to eukaryotic translation initiation factor 4 γ, 3
GTGAGTAGTG	6	0	6.0	98685	Tdg, thymine-DNA glycosylase
GCTCCGTGGC	6	0	6.0	15842	LOC362456, similar to GDP-dissociation inhibitor
GATCAGATGG	6	0	6.0	11540	LOC289144, similar to calcyclin binding protein
TTAATTTGTT	5	0	5.0	11763	Smc1l1, SMC-like 1 (yeast)
TGAGGAACAA	5	0	5.0	40233	LOC287063, similar to RIKEN cDNA 1110025F24
TCTAAATAAA	5	0	5.0	37427	Tceb3, transcription elongation factor B (SIII), polypeptide 3
TATTCATCAG	5	0	5.0	17321	Pank4, pantothenate kinase 4
TAAGGTTTTT	5	0	5.0	8299	Transcribed sequences
GATTAAATAA	5	0	5.0	40420	LOC292766, similar to proteasome 26S non-ATPase subunit 8
GAGTCCTTCC	5	0	5.0	33218	Stx4a, syntaxin 4
GAATCCAACT	5	0	5.0	3377	LOC299310, similar to neuronal protein 15.6
GAAACCGTTA	5	0	5.0	3510	Transcribed sequences
CTGGTAAAAT	5	0	5.0	3264	Ssr3, TRAP-complex γ subunit
CCCTTGGAAT	5	0	5.0	25717	RT1-Ba, RT1 class II, locus Ba
ACCAGCTTCC	5	0	5.0	101762	LOC292949, similar to p53 apoptosis-associated target
ATACTGACAC	252	226	1.1		No match
GACTGACCCT	23	8	2.9		No match
CTACTCGAAT	14	6	2.3		No match
GGATGCATTT	12	4	3.0		No match
GTGAATTCGG	8	0	8.0		No match
AAAGAAAAAA	5	0	5.0		No match
GGATTCGAGC	5	0	5.0		No match
TAATAAGCTT	5	0	5.0		No match

[i] The fold change was determined by dividing the number of tags between the asthma and control group. To avoid division by 0, we used a tag value of 1 for any tag that was not detectable in the samples.

Confirmation of SAGE results by qRT-PCR

To confirm the expression profiles of the 2 SAGE libraries, 3 genes of interest that were differentially expressed before and after acupuncture were chosen, and their expression levels were evaluated by qRT-PCR. The first gene encodes surfactant, pulmonary-associated protein A1 (Sftpa1), which binds to surfactant phospholipids and aids in decreasing the surface tension at the air-liquid interface in the alveoli of the mammalian lung. This process occurs in the presence of calcium ions and is essential for normal respiration. The second gene encodes procollagen, the α2 chain of collagen VI (Col6a2), which is a major constituent of microfibrils that are found in different organs and tissues and may play an important role in cell migration and differentiation. The third gene encodes procollagen, the α1 chain of collagen IV (Col4a1), which is the major structural component of basement membranes. The expression profiles of the representative genes by qRT-PCR analysis corresponded to the SAGE profiles (Fig. 1), thus validating our data and indicating that our data sets could be used for further bioinformatic analyses.

Figure 1 Quantitative real-time PCR (qRT-PCR) confirmation of differentially regulated genes of interest, as predicted by serial analysis of gene expression (SAGE). The expression levels of Sftpa1 in normal rats treated with acupuncture (Acup) were upregulated by 2-fold, when compared to the control. The expression levels of Col6a2 and Col4a1 in the Acup group were downregulated by >0.5-fold, when compared to the control. Sftpa1, surfactant, pulmonary-associated protein A1; Col6a2, procollagen, type VI, α2; Col4a1, procollagen, type IV, α1.

DAVID gene functional classification

For the functional annotation of the differentially expressed genes, 110 known genes and 12 ESTs with a UniGene ID were assigned by applying the DAVID functional annotation tool to the data sets. Of the 122 UniGenes, 105 were functionally classified into 18 groups using the default settings (medium classification stringency) and all GO terms for biological processes. Among these 18 groups, 6 had enrichment scores (ES) that were ≥1. These groups included ‘cellular biosynthetic processes’ (51 genes, ES=2.04), ‘cellular metabolic processes’ (78 genes, ES=1.78), ‘cell proliferation’ (37 genes, ES=1.58), ‘cellular lipid metabolic processes’ (10 genes, ES=1.34), ‘defense response’ (10 genes, ES=1.3) and ‘transport’ (25 genes, ES=1.11). The gene lists of each group are shown in Table IV.

Table IV List of the Database for Annotation, Visualization and Integrated Discovery (DAVID) gene functional classification groups.

Table IV

List of the Database for Annotation, Visualization and Integrated Discovery (DAVID) gene functional classification groups.

Classification	Enrichment score	UniGene	Annotation
Cellular biosynthetic process	2.04	Rn.9954	Transforming growth factor, β receptor ii
		Rn.1997	Cathepsin h
		Rn.2589	Cysteine dioxygenase 1, cytosolic
		Rn.98380	Pyroglutamyl-peptidase i
		Rn.29258	Similar to atp synthase, h+ transporting, mitochondrial f0 complex, subunit c (subunit 9), isoform 2
		Rn.108039	Ribosomal protein l14
		Rn.17145	Connective tissue growth factor
		Rn.84435	Glucose phosphate isomerase
		Rn.36797	Similar to hect domain containing 1
		Rn.82672	Vesicle-associated membrane protein 8
		Rn.13589	Polymerase i and transcript release factor
		Rn.37427	Transcription elongation factor b (siii), polypeptide 3
		Rn.98846	Fibrinogen, α polypeptide
		Rn.17321	Pantothenate kinase 4
		Rn.3510	Similar to bb128963 protein
		Rn.2722	Ribosomal protein l27a
		Rn.103276	Eukaryotic translation initiation factor 4γ, 2
		Rn.17033	Rna binding motif protein 5
		Rn.61687	Phosphatidic acid phosphatase 2a
		Rn.11763	Structural maintenance of chromosomes 1 like 1 (S. cerevisiae)
		Rn.47	Hypoxanthine guanine phosphoribosyl transferase
		Rn.13322	Brf2, subunit of rna polymerase iii transcription initiation factor, brf1-like
		Rn.19267	Peroxisomal trans-2-enoyl-CoA reductase
		Rn.94935	Ribosomal protein s3a
		Rn.2759	C-src tyrosine kinase
		Rn.92643	KH-type splicing regulatory protein
		Rn.3285	Diazepam binding inhibitor
		Rn.25771	Heterogeneous nuclear ribonucleoprotein a1
		Rn.98667	Heat shock 90 kda protein 1, β
		Rn.9406	Necdin-like 2
		Rn.8400	Ribosomal protein s12
		Rn.33807	Chaperonin subunit 6a (ζ)
		Rn.106034	Ribosomal protein s27a
		Rn.98783	Gm2 ganglioside activator protein
		Rn.29782	Fumarate hydratase 1
		Rn.4223	Dyskeratosis congenita 1, dyskerin
		Rn.71377	Eukaryotic translation initiation factor 4γ, 3
		Rn.5106	3-Hydroxy-3-methylglutaryl-coenzyme a synthase 1
		Rn.3910	Eukaryotic translation elongation factor 1, β2
		Rn.2989	Homeobox only domain
		Rn.11540	Similar to calcyclin binding protein
		Rn.94978	Actin, β
		Rn.41063	Sterol regulatory element binding factor 2
		Rn.104649	Aspartylglucosaminidase
		Rn.6606	Tissue specific transplantation antigen p35b
		Rn.1439	Ribosomal protein l36
		Rn.98685	Thymine-dna glycosylase
		Rn.107334	Hemoglobin α, adult chain 1
		Rn.109735	Ribosomal protein s9
		Rn.2262	Ribosomal protein l10a
		Rn.108127	Phosphoglycerate kinase 1
Cellular metabolic process	1.78	Rn.9954	Transforming growth factor, β receptor ii
		Rn.1997	Cathepsin h
		Rn.2589	Cysteine dioxygenase 1, cytosolic
		Rn.29258	Similar to atp synthase, h+ transporting, mitochondrial f0 complex, subunit c (subunit 9), isoform 2
		Rn.98380	Pyroglutamyl-peptidase i
		Rn.55036	Ciliary neurotrophic factor receptor
		Rn.108039	Ribosomal protein l14
		Rn.17145	Connective tissue growth factor
		Rn.3793	Similar to tensin
		Rn.84435	Glucose phosphate isomerase
		Rn.8509	Transmembrane trafficking protein 21
		Rn.36797	Similar to hect domain containing 1
		Rn.82672	Vesicle-associated membrane protein 8
		Rn.13589	Polymerase i and transcript release factor
		Rn.37427	Transcription elongation factor b (siii), polypeptide 3
		Rn.98846	Fibrinogen, α polypeptide
		Rn.108012	Lysosomal-associated protein transmembrane 4a
		Rn.17321	Pantothenate kinase 4
		Rn.3510	Similar to bb128963 protein
		Rn.103276	Eukaryotic translation initiation factor 4γ, 2
		Rn.2722	Ribosomal protein l27a
		Rn.17033	Rna binding motif protein 5
		Rn.3264	Signal sequence receptor, γ
		Rn.11763	Structural maintenance of chromosomes 1 like 1 (S. cerevisiae)
		Rn.61687	Phosphatidic acid phosphatase 2a
		Rn.47	Hypoxanthine guanine phosphoribosyl transferase
		Rn.13322	Brf2, subunit of rna polymerase iii transcription initiation factor, brf1-like
		Rn.19267	Peroxisomal trans-2-enoyl-CoA reductase
		Rn.2759	C-src tyrosine kinase
		Rn.94935	Ribosomal protein s3a
		Rn.105953	Tensin like c1 domain containing phosphatase
		Rn.101762	Perp, tp53 apoptosis effector
		Rn.92643	KH-type splicing regulatory protein
		Rn.3285	Diazepam binding inhibitor
		Rn.3036	Guanine nucleotide binding protein, α inhibiting 2
		Rn.32080	Allograft inflammatory factor 1
		Rn.44465	Chemokine-like receptor 1
		Rn.1677	G protein-coupled receptor 56
		Rn.25771	Heterogeneous nuclear ribonucleoprotein a1
		Rn.98667	Heat shock 90 kda protein 1, β
		Rn.9406	Necdin-like 2
		Rn.8400	Ribosomal protein s12
		Rn.36610	Tumor protein, translationally-controlled 1
		Rn.22087	Interferon induced transmembrane protein 1
		Rn.9829	Advanced glycosylation end product-specific receptor
		Rn.2776	Beclin 1 (coiled-coil, myosin-like bcl2-interacting protein)
		Rn.33807	Chaperonin subunit 6a (ζ)
		Rn.106034	Ribosomal protein s27a
		Rn.98783	Gm2 ganglioside activator protein
		Rn.29782	Fumarate hydratase 1
		Rn.1952	Surfactant associated protein b
		Rn.4223	Dyskeratosis congenita 1, dyskerin
		Rn.71377	Eukaryotic translation initiation factor 4γ, 3
		Rn.80835	Dodecenoyl-coenzyme a δ isomerase
		Rn.5106	3-Hydroxy-3-methylglutaryl-coenzyme a synthase 1
		Rn.3910	Eukaryotic translation elongation factor 1 β2
		Rn.2989	Homeobox only domain
		Rn.11540	Similar to calcyclin binding protein
		Rn.94978	Actin, β
		Rn.55487	Guanine nucleotide binding protein (g protein)
		Rn.2283	Lysozyme
		Rn.41063	Sterol regulatory element binding factor 2
		Rn.104649	Aspartylglucosaminidase
		Rn.12550	Nuclear factor of κ light chain gene enhancer in b-cells inhibitor, α
		Rn.6606	Tissue specific transplantation antigen p35b
		Rn.1439	Ribosomal protein l36
		Rn.11330	Urate oxidase
		Rn.98685	Thymine-dna glycosylase
		Rn.107334	Hemoglobin α, adult chain 1
		Rn.10696	Phosphatidylserine-specific phospholipase a1
		Rn.2694	Melanoma cell adhesion molecule
		Rn.109735	Ribosomal protein s9
		Rn.15842	Rho, gdp dissociation inhibitor (gdi) β
		Rn.2262	Ribosomal protein l10a
		Rn.108127	Phosphoglycerate kinase 1
		Rn.5782	Syntaxin 5a
		Rn.3658	G protein-coupled receptor, family c, group 5, member c
		Rn.33218	Syntaxin 4a (placental)
Cell proliferation	1.58	Rn.22087	Interferon induced transmembrane protein 1
		Rn.9829	Advanced glycosylation end product-specific receptor
		Rn.9954	Transforming growth factor, β receptor ii
		Rn.2776	Beclin 1 (coiled-coil, myosin-like bcl2-interacting protein)
		Rn.59630	Similar to riken cdna b230339h12
		Rn.106034	Ribosomal protein s27a
		Rn.55036	Ciliary neurotrophic factor receptor
		Rn.98783	Gm2 ganglioside activator protein
		Rn.1952	Surfactant associated protein b
		Rn.17145	Connective tissue growth factor
		Rn.4223	Dyskeratosis congenita 1, dyskerin
		Rn.84435	Glucose phosphate isomerase
		Rn.71377	Eukaryotic translation initiation factor 4γ, 3
		Rn.11343	Surfactant, pulmonary-associated protein a1
		Rn.13589	Polymerase i and transcript release factor
		Rn.2989	Homeobox only domain
		Rn.37427	Transcription elongation factor b (siii), polypeptide 3
		Rn.98846	Fibrinogen, α polypeptide
		Rn.55487	Guanine nucleotide binding protein (g protein)
		Rn.41063	Sterol regulatory element binding factor 2
		Rn.11763	Structural maintenance of chromosomes 1 like 1 (S. cerevisiae)
		Rn.61687	Phosphatidic acid phosphatase 2a
		Rn.47	Hypoxanthine guanine phosphoribosyl transferase
		Rn.13322	Brf2, subunit of rna polymerase iii transcription initiation factor, brf1-like
		Rn.12550	Nuclear factor of κ light chain gene enhancer in b-cells inhibitor, α
		Rn.94935	Ribosomal protein s3a
		Rn.2759	C-src tyrosine kinase
		Rn.92643	KH-type splicing regulatory protein
		Rn.101762	Perp, tp53 apoptosis effector
		Rn.98685	Thymine-dna glycosylase
		Rn.107334	Hemoglobin α, adult chain 1
		Rn.3036	Guanine nucleotide binding protein, α inhibiting 2
		Rn.32080	Allograft inflammatory factor 1
		Rn.15842	Rho, gdp dissociation inhibitor (gdi) β
		Rn.9406	Necdin-like 2
		Rn.33218	Syntaxin 4a (placental)
		Rn.36610	Tumor protein, translationally-controlled 1
Cellular lipid metabolic process	1.34	Rn.3285	Diazepam binding inhibitor
		Rn.10696	Phosphatidylserine-specific phospholipase a1
		Rn.1952	Surfactant associated protein b
		Rn.3510	Similar to bb128963 protein
		Rn.41063	Sterol regulatory element binding factor 2
		Rn.61687	Phosphatidic acid phosphatase 2a
		Rn.5106	3-Hydroxy-3-methylglutaryl-coenzyme a synthase 1
		Rn.80835	Dodecenoyl-coenzyme a δ isomerase
		Rn.19267	Peroxisomal trans-2-enoyl-CoA reductase
		Rn.98783	Gm2 ganglioside activator protein
Defense response	1.3	Rn.9829	Advanced glycosylation end product-specific receptor
		Rn.22087	Interferon induced transmembrane protein 1
		Rn.9954	Transforming growth factor, β receptor ii
		Rn.32080	Allograft inflammatory factor 1
		Rn.2589	Cysteine dioxygenase 1, cytosolic
		Rn.2283	Lysozyme
		Rn.98667	Heat shock 90 kda protein 1, β
		Rn.2776	Beclin 1 (coiled-coil, myosin-like bcl2-interacting protein)
		Rn.12550	Nuclear factor of κ light chain gene enhancer in b-cells inhibitor, α
		Rn.2267	Defensin β3
Transport	1.11	Rn.9829	Advanced glycosylation end product-specific receptor
		Rn.9954	Transforming growth factor, β receptor ii
		Rn.54541	Sodium channel, voltage-gated, type 6, α polypeptide
		Rn.29258	Similar to atp synthase, h+ transporting, mitochondrial f0 complex, subunit c (subunit 9), isoform 2
		Rn.25717	Butyrophilin-like 2 (mhc class ii associated)
		Rn.98783	Gm2 ganglioside activator protein
		Rn.17145	Connective tissue growth factor
		Rn.3793	Similar to tensin
		Rn.8509	Transmembrane trafficking protein 21
		Rn.1838	Chloride intracellular channel 5
		Rn.82672	Vesicle-associated membrane protein 8
		Rn.11343	Surfactant, pulmonary-associated protein a1
		Rn.108012	Lysosomal-associated protein transmembrane 4a
		Rn.3264	Signal sequence receptor, γ
		Rn.12550	Nuclear factor of κ light chain gene enhancer in b-cells inhibitor, α
		Rn.92643	KH-type splicing regulatory protein
		Rn.3285	Diazepam binding inhibitor
		Rn.3036	Guanine nucleotide binding protein, α inhibiting 2
		Rn.32080	Allograft inflammatory factor 1
		Rn.107334	Hemoglobin α, adult chain 1
		Rn.25771	Heterogeneous nuclear ribonucleoprotein a1
		Rn.15842	Rho, gdp dissociation inhibitor (gdi) β
		Rn.5782	Syntaxin 5a
		Rn.33218	Syntaxin 4a (placental)
		Rn.36610	Tumor protein, translationally-controlled 1

Analysis of gene categories by GO Tree Machine

In total, 10 GO categories were enriched after acupuncture, and these categories included ‘biosynthesis’ (16 genes), ‘cellular biosynthesis’ (14 genes), ‘macromolecule biosynthesis’ (11 genes), ‘protein biosynthesis’ (11 genes), ‘protein kinase C activation’ (2 genes), ‘cytolysis’ (2 genes), ‘vesicle targeting’ (2 genes), ‘regulation of liquid surface tension’ (2 genes), ‘mRNA transport’ (2 genes) and ‘mRNA export from the nucleus’ (2 genes). The gene lists of each category are shown in the Table V.

Table V Gene lists of categories by the Gene Ontology (GO) Tree Machine.

Table V

Gene lists of categories by the Gene Ontology (GO) Tree Machine.

Enriched GO categories	Gene nos.	UniGene	Annotation
Biosynthesis	16	Rn.92643	KH-type splicing regulatory protein
		Rn.47	Hypoxanthine guanine phosphoribosyl transferase
		Rn.3285	Diazepam binding inhibitor
		Rn.2722	Ribosomal protein L27a
		Rn.40171	Ribosomal protein S4, X-linked
		Rn.5106	3-Hydroxy-3-methylglutaryl-Coenzyme A synthase 1
		Rn.71377	Eukaryotic translation initiation factor 4γ, 3
		Rn.6606	Tissue specific transplantation antigen P35B
		Rn.103276	Eukaryotic translation initiation factor 4, γ2
		Rn.3910	Eukaryotic translation elongation factor 1 β2
		Rn.61687	Phosphatidic acid phosphatase 2a
		Rn.108039	Ribosomal protein L14
		Rn.8400	Ribosomal protein S12
		Rn.2589	Cysteine dioxygenase 1, cytosolic
		Rn.109735	Ribosomal protein S9
		Rn.106034	Ribosomal protein S27a
Cellular biosynthesis	14	Rn.92643	KH-type splicing regulatory protein
		Rn.47	Hypoxanthine guanine phosphoribosyl transferase
		Rn.2722	Ribosomal protein L27a
		Rn.40171	Ribosomal protein S4, X-linked
		Rn.71377	Eukaryotic translation initiation factor 4 gamma, 3
		Rn.6606	Tissue specific transplantation antigen P35B
		Rn.103276	Eukaryotic translation initiation factor 4, γ2
		Rn.3910	Eukaryotic translation elongation factor 1 β2
		Rn.61687	Phosphatidic acid phosphatase 2a
		Rn.108039	Ribosomal protein L14
		Rn.8400	Ribosomal protein S12
		Rn.2589	Cysteine dioxygenase 1, cytosolic
		Rn.109735	Ribosomal protein S9
		Rn.106034	Ribosomal protein S27a
Macromolecule biosynthesis	11	Rn.106034	KH-type splicing regulatory protein
		Rn.2722	Ribosomal protein L27a
		Rn.40171	Ribosomal protein S4, X-linked
		Rn.71377	Eukaryotic translation initiation factor 4γ, 3
		Rn.6606	Tissue specific transplantation antigen P35B
		Rn.103276	Eukaryotic translation initiation factor 4, γ2
		Rn.3910	Eukaryotic translation elongation factor 1 β2
		Rn.108039	Ribosomal protein L14
		Rn.8400	Ribosomal protein S12
		Rn.109735	Ribosomal protein S9
		Rn.106034	Ribosomal protein S27a
Protein biosynthesis	11	Rn.92643	KH-type splicing regulatory protein
		Rn.2722	Ribosomal protein L27a
		Rn.40171	Ribosomal protein S4, X-linked
		Rn.71377	Eukaryotic translation initiation factor 4γ, 3
		Rn.6606	Tissue specific transplantation antigen P35B
		Rn.103276	Eukaryotic translation initiation factor 4, γ2
		Rn.3910	Eukaryotic translation elongation factor 1 β2
		Rn.108039	Ribosomal protein L14
		Rn.8400	Ribosomal protein S12
		Rn.109735	Ribosomal protein S9
		Rn.106034	Ribosomal protein S27a
Protein kinase C activation	2	Rn.61687	Phosphatidic acid phosphatase 2a
		Rn.55487	Guanine nucleotide binding protein (G protein, β polypeptide 2 like 1)
Cytolysis	2	Rn.47	Hypoxanthine guanine phosphoribosyl transferase
		Rn.2283	Lysozyme
Vesicle targeting	2	Rn.5782	Syntaxin 5a
		Rn.8509	Transmembrane emp24-like trafficking protein 10 (yeast)
Regulation of liquid surface tension	2	Rn.1952	Surfactant associated protein B
		Rn.11343	Surfactant, pulmonary-associated protein A1
mRNA transport	2	Rn.92643	KH-type splicing regulatory protein
		Rn.25771	Heterogeneous nuclear ribonucleoprotein A1
mRNA export from nucleus	2	Rn.92643	KH-type splicing regulatory protein
		Rn.25771	Heterogeneous nuclear ribonucleoprotein A1

Finding KEGG pathways

To understand the functional roles of the differentially expressed genes, KEGG pathway analysis was assigned by applying the DAVID annotation tool. Fifteen KEGG pathways matched the differentially expressed tags of the 2 libraries (Table VI). Two of these pathways, ‘soluble (N-ethylmaleimide-sensitive fusion) NSF attachment protein receptor (SNARE) interactions in vesicular transport’ and ‘tight junction’ pathways, were matched to 3 UniGenes. SNAREs are small, abundant, plasma membrane-bound proteins; the cyclic assembly and disassembly of the SNARE complex is required for regulated secretory vesicle fusion with the plasma membrane. Tight junctions are the closely associated areas between 2 cells whose membranes join to form a virtually impermeable barrier to fluid.

Table VI Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways of differentially expressed tags.

Table VI

Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways of differentially expressed tags.

Pathway name	Gene nos.	UniGene	Annotation
SNARE interactions in vesicular transport	3	Rn.82672	Vesicle-associated membrane protein 8
		Rn.5782	Syntaxin 5a
		Rn.33218	Syntaxin 4a
Tight junction	3	Rn.3036	Guanine nucleotide binding protein, α inhibiting 2
		Rn.94978	Actin, β
		Rn.4108	Protein phosphatase 2 (formerly 2a), regulatory subunit a (pr 65), α isoform
ECM-receptor interaction	2	Rn.53801	Procollagen, type iv, α1
		Rn.100627	Fibronectin type iii domain containing 3
Adherens junction	2	Rn.9954	Transforming growth factor, β receptor ii
		Rn.94978	Actin, β
Long-term depression	2	Rn.3036	Guanine nucleotide binding protein, α inhibiting 2
		Rn.4108	Protein phosphatase 2 (formerly 2a), regulatory subunit a (pr 65), α isoform
Small cell lung cancer	2	Rn.53801	Procollagen, type iv, α1
		Rn.12550	Nuclear factor of κ light chain gene enhancer in b-cells inhibitor, α
TGF-β signaling pathway	2	Rn.9954	Transforming growth factor, β receptor ii
		Rn.4108	Protein phosphatase 2 (formerly 2a), regulatory subunit a (pr 65), α isoform
Chronic myeloid leukemia	2	Rn.9954	Transforming growth factor, β receptor ii
		Rn.12550	Nuclear factor of κ light chain gene enhancer in b-cells inhibitor, α
Antigen processing and presentation	2	Rn.98667	Heat shock 90 kda protein 1, β
		Rn.25717	Butyrophilin-like 2 (mhc class ii associated)
Purine metabolism	2	Rn.11330	Urate oxidase
		Rn.47	Hypoxanthine guanine phosphoribosyl transferase
Leukocyte transendothelial migration	2	Rn.3036	Guanine nucleotide binding protein, α inhibiting 2
		Rn.94978	Actin, β
Cell communication	2	Rn.94978	Actin, β
		Rn.53801	Procollagen, type iv, α1
Cytokine-cytokine receptor interaction	2	Rn.9954	Transforming growth factor, β receptor ii
		Rn.55036	Ciliary neurotrophic factor receptor
Focal adhesion	2	Rn.94978	Actin, β
		Rn.53801	Procollagen, type iv, α1
Regulation of actin cytoskeleton	2	Rn.94978	Actin, β
		Rn.2759	C-src tyrosine kinase

[i] SNARE, soluble (N-ethylmaleimide-sensitive fusion) NSF attachment protein receptor; ECM, extracellular matrix; TGF, transforming growth factor.

Discussion

A number of experiments and theories have been used to explain the possible mechanisms of acupuncture, which are believed to have a strong biological basis (4). In contrast to target-specific and one-way adjustment chemical reagents, acupuncture upregulates various organ systems that are hypofunctional, or downregulates hyperfunctional systems. Acupuncture is considered as a mechanical activation and signaling process (25). The observation and identification of the global alterations in gene expression in response to acupuncture that are involved in specific physiological processes will help to integrate the knowledge of the underlying signaling and metabolic pathways, biosynthetic processes and the functional interactions of cells, tissues and organs (26). The present study provides abundant experimental data and reveals the background gene expression profile in rats before and after acupuncture treatment. This information highlights the active gene alterations in a particular disease.

DAVID functional classification suggested that the genes involved in metabolism were regulated after acupuncture intervention. These genes included those with roles in ‘cellular biosynthetic processes’, ‘cellular lipid metabolic processes’ and ‘transport’. The corresponding regulated genes included the following: glucose phosphate isomerase, β-actin and lysozyme. Glucose phosphate isomerase is an enzyme that catalyzes the conversion of glucose-6-phosphate into fructose-6-phosphate in the second step of glycolysis. β-actin is one of 6 different actin isoforms that have been identified in humans and is one of most important non-muscle, cytoskeletal actins that have highly conserved roles in cell motility, structure and integrity. Lysozyme is an enzyme that damages the cell walls of bacteria, which are abundant in a number of secretions, such as tears, saliva, human milk and mucus. Finding these genes in our study indicates that dynamic changes occur involving various biological processes and that protein, lipid and sugar synthesis are adjusted separately after acupuncture. In this way, acupuncture completes the regulation of nerve and body fluids.

The GO Tree Machine analysis of the gene categories suggested that acupuncture influences the processes of RNA transcription and protein translation. In the SAGE libraries, genes known as ‘KH-type splicing regulatory protein (KHSRP)’ and ‘heterogeneous nuclear ribonucleoprotein A1’ belong to the gene categories of ‘mRNA transport’ and ‘mRNA export from the nucleus’. This finding indicates that acupuncture may influence the expression of these 2 genes to regulate the movement of mRNA from the nucleus to the cytoplasm. By doing so, acupuncture controls mRNA expression and protein translation at its source. The category termed ‘regulation of liquid surface tension’ included 2 genes, ‘Sftpa1’ and ‘surfactant associated protein C’. After inserting the needle into the point of feishu (BL13), the expression of these proteins was increased. This indicated that the change in expression may be a specific effect of the selected acupuncture point.

Fifteen pathways were identified as regulated by acupuncture treatment using KEGG pathway analysis. One of these pathways was ‘SNARE interactions in vesicular transport’. SNARE proteins are a large superfamily of proteins that consists of more than 60 members in yeast and mammalian cells, and play an integral part in membrane fusion events in the secretory and endocytic pathways (27). Syntaxin 5a was found in our analysis to be regulated in response to acupuncture. This protein is a member of the integrated SNARE proteins that participate in exocytosis, which mediates endoplasmic reticulum to Golgi transport. These results suggest that acupuncture may activate the processes of membrane fusion and intercellular signal transduction, which regulate the transport of substances into or out of cells.

KEGG pathway selection provides a platform for integrating and elucidating useful data. The matching of pathways, such as ‘tight junction’, ‘adherens junction’, ‘focal adhesion’, ‘cell communication’, ‘cytokine-cytokine receptor interaction’ and ‘regulation of actin cytoskeleton’, in our research suggests that the process of acupuncture activates intercellular signal transduction. Tight and adherens junctions are 2 types of intercellular junctions in vertebrates (28). The local electrical activity of the cell membrane, interactions with the cytoskeleton or the activation of certain receptors may play a part in activating these signaling pathways. Based on our data, we suggest that interactions between cells and re-arrangement of the cytoskeleton occur after acupuncture, and signals are transferred from one cell to another. The process of cell communication may last for a certain time, and then cells relay the message and certain processes commence, such as new mRNA transcription, synthesizing macromolecular proteins and enzymes, and conducting purine metabolism. β-actin and the c-src tyrosine kinase were 2 genes that were regulated by acupuncture. β-actin is an important component of the cytoskeleton, and it participates in the local signal exchange between cells, their surroundings or with other cells. c-src tyrosine kinase plays a role in phosphorylation and acidification in cell-cell interactions (29), which also controls the dynamic actin cytoskeleton (30). The results from our study suggest that acupuncture may regulate intercellular signal transduction in normal rat lung tissue through specific genes, such as β-actin and c-src tyrosine kinase.

We found that the gene expression profile in response to acupuncture under normal conditions shares similar DAVID gene functional classifications and GO categories with the gene expression profiles of asthmatic rats in response to acupuncture (20). In the DAVID gene functional classifications, the categories entitled ‘cellular biosynthetic process’, ‘cellular lipid metabolic process’ and ‘cellular process’ were found to change in response to acupuncture in normal and asthmatic rats. Furthermore, in the GO Tree Machine analysis, the gene categories entitled ‘regulation of liquid surface tension’ and ‘biosynthesis’ were found to be regulated by acupuncture in both types of rats. However, the genes were different under the same functional classification and enriched GO category of biological process. Therefore, this suggests that acupuncture initiates different branches of the same biological processes under normal and morbid conditions. This comparison demonstrates that the cellular biosynthesis and cellular lipid metabolism are the common regulations of biological processes in response to acupuncture in normal and asthmatic rats.

In this study, we present the gene expression profiles of lung tissues derived from normal and acupuncture-treated, normal rats by SAGE analysis. A series of physiological alterations occurs after acupuncture treatment, and the essential effects of acupuncture include the regulation of biosynthesis, transportation and metabolism. Acupuncture orchestrates the activity of an organism by regulating the expression of specific genes. Cellular biosynthesis and cellular lipid metabolism are the common regulations of biological processes in response to acupuncture under normal and morbid conditions, which may be the general physiological effects of acupuncture.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (no. 30873299, 90409014, 81001548, 81173341, 81173332), the ‘Chen Guang’ Project supported by the Shanghai Municipal Education Commission and Shanghai Education Development Foundation (10CG45), the Shanghai Leading Academic Discipline Project (S30304), and the Key Program of the State Administration of Traditional Chinese Medicine of China.

Abbreviations:

References