Induction of estrogen receptor α-36 expression by bone morphogenetic protein 2 in breast cancer cell lines

  • Authors:
    • Dingding Wang
    • Peide Huang
    • Baowei Zhu
    • Li Sun
    • Qing Huang
    • Ju Wang
  • View Affiliations

  • Published online on: June 12, 2012     https://doi.org/10.3892/mmr.2012.945
  • Pages: 591-596
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The expression of estrogen receptor-α (ERα) is one of the most important diagnostic and prognostic factors of breast cancer. Recently, ERα-36 has been identified as a novel variant of ER-α. ERα-36 lacks intrinsic transcription activity and mainly mediates non-genomic estrogen signaling. Bone morphogenetic proteins (BMPs) are recognized as key factors during the control of cell fate and cancer development. However, the correlation between BMP and the ER signaling pathway remains unclear. In this study, we show that BMP2, a member of the BMP family, is a novel inducer of ERα-36 expression in breast cancer cells. As shown by western blot assays, the upregulation of ERα-36 by BMP2 was significant. In MDA-MB-231 cells which are ERα-66-negative, BMP2 was able to induce the expression of ERα-36 in a dose-dependent manner, and the RNA interference assay indicated a correlation between BMP2 and ERα-36 expression. BMP2 inhibited the growth of MCF-7 and MDA-MB-231 cells; however, the inhibitory effect was antagonized by tamoxifen, suggesting that the ER signal was involved. The growth of MDA-MB‑231 cells was stimulated by 17-β-estradiol (E2) after BMP2 induction, even though the cells were previously insensitive to E2. These results suggest that BMP2 induces ERα-36 expression and alters tumor resistance to endocrine therapy by changing the expression profile of ERs.

Introduction

Members of the transforming growth factor (TGF)-β family, including TGF-β, activin, nodal and bone morphogenetic proteins (BMPs), are multifunctional cytokines that regulate a wide range of cellular responses, such as cellular proliferation, adhesion and differentiation, haematopoiesis, inflammation, wound repair and skeletal development (1). BMPs were identified based on their ability to promote ectopic cartilage and bone formation (2). BMPs function through conserved type I and type II transmembrane receptors and Smad-dependent and -independent pathways, to regulate a range of biological processes in a highly context-dependent manner (1,35). Disruption of these pathways can lead to various diseases including cancer (6).

Estrogenic hormones regulate multiple activities, including cell proliferation and differentiation, in different types of cells. It is widely accepted that the hormone-occupied estrogen receptor (ER) functions as a versatile transcription factor to either activate or repress gene expressions (7). These effects of estrogen on transcriptional regulation involve both the direct interaction of ER with DNA encoded estrogen response elements (EREs) and the indirect tethering of ER to DNA through protein-protein interactions (8,9). In addition to these nuclear events, estrogen is capable of evoking rapid, membrane-initiated signaling events, such as the release of calcium, secretion of prolactin, generation of nitric oxide, regulation of PI3K/Akt and the activation of the MAPK pathway (1012). Estrogen can influence these effects in a variety of cell types (13), with the exact response dependent on the nature of the target cell.

The ER signaling pathway plays a pivotal role in the development of different types of breast cancer (14). Two types of ERs have been identified, ERα and ERβ, both of which have many mRNA splice variants (15). For example, there are 3 types of ERα isoforms identified: 66-KD, 46-KD and 36-KD (16). Usually, if a cell line expresses ERα-66 (e.g., MCF-7 cells) it is considered ERα-positive; if a cell line does not express ERα-66 (e.g., MDA-MB-231 cells) it is termed ERα-negative.

Endocrine therapy is effective in approximately one-third of all breast cancers, although up to 80% of these express both estrogen and progesterone receptors (17). Unfortunately, most breast cancer cells acquire resistance due to the use of steroid hormones in the process of endocrine treatment for controlling the growth of cancer cells (18). In order to understand the effects of ERs on the development of breast cancer, we wished to explore the correlation between the ER signaling pathway and other pathways, such as the Wnt/wingless, receptor tyrosine kinase, JAK/STAT and the BMP signaling pathways, which are included among the conserved pathways that control the fate of cells (19,20).

In this study, we report for the first time that BMP2 induces the expression of ERα-36, but not ERα-66, in MDA-MB-231 and MCF-7 breast cancer cell lines. The results from our study indicate that BMP2 alters the expression profile of ERα and thus, has the potential to alter the response of breast cancer cells to endocrine therapy.

Materials and methods

Cell lines and antibodies

The human breast cancer cell lines, MDA-MB-231 (ER-negative) and MCF-7 (ER-positive), were obtained from the American Type Culture Collection (ATCC). All cells were passaged for a period of <6 months subsequent to resuscitation, and cultured using the protocol provided by ATCC. The sera and media were purchased from Invitrogen and ATCC, whereas anti-β-actin, anti-ERα-66 and anti-ERβ antibodies were from Cell Signaling Technology. HRP-goat anti-rabbit conjugate and HRP-goat anti-mouse conjugate were purchased from Santa Cruz Biotechnology,.

Quantitative RT-PCR

MCF-7 and MDA-MB-231 breast cancer cells were plated in 10-cm dishes, and subsequently treated with BMP2 (20 ng/ml) for 0, 24 and 48 h. Total RNA was extracted using TRIzol reagent, and cDNA was prepared using SuperScript II Reverse Transcriptase (Invitrogen). Quantitative RT-PCR was performed using the IQ SYBR-Green Mix in an iCycler PCR machine (Bio-Rad), using 1 μl of cDNA in triplicate. Primers used are included in Table I.

Table I

Primers used for real-time PCR.

Table I

Primers used for real-time PCR.

GenesPrimer sequences (F, forward; R, reverse)
ERαF: AAGTATTCAAGGACATAACGR: TATCCCACCTTTCATCAT
ERα-66F: GGTGCCCTACTACCTGGAGAR: TCTGAATTTGGCCTGTAGAATG
ERα-36F: GACAGGAACCAGGGAAAAR: TCTACATGTGAGATACCAGA
ERβF: TCATGAATTACAGCATTCCCR: ATGAAGTGAGCATCCCTCTT
BMPR1bF: AATGCCACCATTGTCCAR: CTAGGCAACCAGAAGTGACCACAG
BMPR1aF: AGTGTCTCCAGTCAAGCTCTGGGTAR: CCATCTCTGCTGCTGCGCTCATTTA
BMPR2F: TGCAGATGGACGCATGGAAR: CGGCAAGAGCTTACCCAGTCA
p21F: TGAGCCGCGACTGTGATGR: GTCTCGGTGACAAAGTCGAAGTT

[i] ER, estrogen receptor; BMP, bone morphogenetic protein receptor.

Specific antibody for ERα-36

The antigenicity of the specific C-terminal amino acid sequence of ERα-36 was analyzed using the Onastar software. The IFGNKWFPRV sequence was selected and named IV10. This amino acid sequence was made using solid phase chemical synthesis and coupled by KLH. The specific antibody against IV10 was obtained from the antiserum of rabbits and purified by Protein A affinity chromatography.

Western blot analysis

MCF-7 and MDA-MB-231 breast cancer cells were incubated with 20 ng/ml BMP2 for 24 and 48 h. For western blot analyses, cells were disrupted by incubation at 4°C for 15 min in cell lysis solution (UpState) containing protease inhibitor cocktail (Roche). The protein concentration was quantified using a BCA™ Protein Assay kit (Pierce). Equal amounts of protein (20 μg) were subjected to 12% SDS-PAGE and western blot analysis, as described previously (21). Immunoreactive bands were visualised by an enhanced chemiluminescence reaction kit (Thermo Fisher Scientific).

RNA interference

The sense strands of BMPR1a-siRNA and BMPR1b-siRNA were purchased from Dharmacon, Inc. MDA-MB-231 cells were seeded into 6-well plates, grown to 40–60% confluence and then transfected with siRNAs for 4 h using Lipofectamine 2000 (Invitrogen). The cells were allocated to 3 groups: control group, BMP2 group and si-BMPR1a + si-BMPR1b + BMP2 group. The dosage of BMP2 was 20 ng/ml. The protein levels were analyzed by western blot analysis.

Cell proliferation assay

For the proliferation assay with recombinant human BMP2 (R&D Systems, Minneapolis, MN, USA), MCF-7 and MDA-MB-231 cells were cultured in 96-well plates (approximately 5,000 cells per well) for 24 h, respectively. Cells were then serum-starved for 24 h in DMEM with 1% FBS. The experiment included a control group and a BMP2 group (2.5, 5, 10, 20 or 30 ng/ml). After 48 h of induction by BMP2, cell growth was measured by an MTT assay.

Tamoxifen citrate (Sigma) was used to identify the correlation between BMP2 and 17-β-estradiol (E2) (Sigma). Cells were plated in 96-well plates (approximately 5,000 cells/well) for 24 h in phenol red-free DMEM containing 2% FBS that had been incubated with dextran-coated charcoal to remove endogenous steroids (dialyzed fetal bovine serum, PAA Laboratories). Cells were then incubated with BMP2 (20 ng/ml), E2 (0.01 μM) and tamoxifen citrate (Tam, 0.01 μM) for 48 h. The experiment included a control group, a BMP2 group (20 ng/ml), an E2 group, a Tam group, a E2 + BMP2 group and a Tam + BMP2 group. The MTT assay was used to determine the relative cell number. Absorbance was recorded at 570 nm in a spectrophotometer (Spectronic 1001, Bausch & Lomb). The mean value of 5 wells was calculated and each experiment was repeated 3 times.

Statistical analysis

Statistical analysis was carried out using the Statistical Package for Social Sciences 13.0 (SPSS). Data are presented as the means ± SEM. Statistical significance was determined by a one-way analysis of variance or the t-test. P-values <0.05 were considered to indicate statistically significant differences.

Results

BMP2 alters the expression of genes in MCF-7 and MDA-MB-231 cells

To understand the effect of BMP2 on the BMP and ER signaling pathway in MCF-7 and MDA-MB-231 cells, the changes in the expression of key genes, such as BMPR1a, BMPR1b, BMPR2, ERα and ERβ, were examined using quantitative RT-PCR following the addition of 20 ng/ml BMP2. Interestingly, we found that treatment with BMP2 upregulated the expression of ERα almost 7-fold in MCF-7 and 4-fold in MDA-MB-231 cells. Since ERα had at least 3 types of identified splicing variants (ERα-66, ERα-46 and ERα-36), we designed specific primers for ERα-66 and ERα-36 and examined their specific expression. Genomic organization of the human ERα-66/36 gene and the positions of the primer pairs were shown in Fig. 1. The results shown in Fig. 2 indicated that the upregulation of ERα-36 by BMP2 was sustained from 24 to 48 h in MCF-7 cells and was the highest at 48 h in MDA-MB-231 cells. ERα-66 expressed in MCF-7 cells was slightly higher at 24 h. By contrast, the expression of ERβ was not changed after the addition of BMP2 (Fig. 2) in either of the cell lines.

BMP2 induces the expression of ERα-36 in MCF-7 and MDA-MB-231 cells

Western blot analysis was used to evaluate the protein levels of ERα in BMP2-treated breast cancer cells. Since the C-terminal of ERα-36 was unique, we raised antibodies against a synthetic peptide antigen (IV10) corresponding to the C-terminal 10 aa of hERα-36. Its specificity was determined in MDA-MB-231 cells (Fig. 3A). We observed that ERα-36 was significantly upregulated by BMP2 in MDA-MB-231 cells, which were ERα-66-negative (Fig. 3B). We also found that BMP2 induced the expression of ERα-36, but not ERα-66 in MCF-7 cells (Fig. 3C). The expression of ERβ did not change in either of the cell lines.

BMP2 regulates the expression of the ERα-36 protein

To assess the correlation between BMP2 and ERα-36, an additional investigation was carried out on MDA-MB-231 cells (ERα-66-negative). BMP2 induced the expression of ERα-36 in a dose-dependent manner, which was inhibited by the BMP2 antagonist, noggin (Fig. 4A). In addition, the RNA interference assay indicated that BMP2 was associated with ERα-36 expression. When the BMP2 signaling pathway was silenced by si-BMPR1a and si-BMPR1b, the ERα-36 induction was eradicated (Fig. 4B). Hence, it is possible that crosstalk exists between BMP2 and ERα-36.

BMP2 inhibits the growth of MCF-7 and MDA-MB-231 cells

MTT assays revealed that the proliferation of MCF-7 and MDA-MB-231 cells was significantly inhibited by BMP2 (2.5, 5, 20 or 30 ng/ml) for 2 days. BMP-2 was effective in inhibiting the growth of the MCF-7 cells when its dose was 5–30 ng/ml, but the most effective dose was 20 ng/ml. A similar effect of BMP-2 was observed in the MDA-MB-231 cells; however, its inhibitory effect on cell proliferation was more prominent in MCF-7 than in MDA-MB-231 cells (Fig. 5A).

MDA-MB-231 cells were not sensitive to E2 and tamoxifen treatment as shown in Fig. 2B. However, the BMP2 inhibition of MDA-MB-231 cells was antagonised when E2 or tamoxifen were added. E2 promoted the multiplication of MCF-7 cells, while tamoxifen restrained their growth (Fig. 5B). The inhibitory effect of BMP2 was, however, counteracted by tamoxifen. We also observed that MCF-7 cells treated with BMP2 were insensitive to tamoxifen treatment (Fig. 5C). The results from our study were consistent with those from previous reports stating that tamoxifen strongly inhibits cell proliferation in the MCF-7 cells. The constitutive overexpression of recombinant ERα-36, however, demonstrated insensitivity to tamoxifen treatment (22). Since the MDA-MB-231 cells were ERα-66-negative and ERα-36-positive following BMP2 treatment, we hypothesized that the breast cancer cells became sensitive to E2 and resistant to tamoxifen following the induction of ERα-36 by BMP2.

Discussion

In the present study, we identified that BMP2 induced the expression of ERα-36 in MDA-MB-231 and MCF-7 breast cancer cells. A previous study on the induction of ERα and ERβ in granulosa cells by activin also showed that BMP-2 increased ERα mRNA levels by approximately 50% (23), consistent with our results.

Wang et al (21) reported that ERα-36 lacks both transcriptional activation domains of ERα-66, retains portions of the DNA-binding domain, the partial dimerization and ligand-binding domains, and possesses a unique 27 amino acid domain that replaces the last 138 amino acid of ERα-66. Moreover, ERα-36 can inhibit the transactivation of both ERα-66 and ERβ, stimulate the MAPK signaling pathway and induce cell growth in breast cancer cell lines. Considering all the above information, the effect of ERα-36 on the growth inhibition induced by BMP2 is complicated, thus additional investigation is required to clarify it.

An issue that scientists and clinical physicians should address is why endocrine therapy is effective on some kinds of breast cancers, but not on others. Recent studies have indicated that the efficacy of endocrine therapy cannot be simply explained by the expression levels of ERα, but may be determined by the expression profiles of both ERα and ERβ, as well as their various splice variants (14,21,24,25). Furthermore, to understand the meaning of the demonstrated change in ERα-36 expression induced by BMP2 in breast cancer cells, additional research should be carried out to determine whether the ERα-36 reported in the present study is the same as that reported by Wang et al (21).

Anti-estrogen compounds are widely used for the treatment of osteoporosis, breast cancer and other diseases. Smad4, a common signal transducer in the BMP/TGF-β signaling pathway, functions as a transcriptional co-repressor for human ERα (26). Estrogen and glucocorticoid interact in osteoblastic differentiation regulated by BMP and TNF-α in mouse myoblastic C2C12 cells. The expression of ERs, ERα and ERβ, as well as the glucocorticoid receptor (GCR) has been shown to be significantly increased by BMP-2 treatment, regardless of the presence of estradiol and dexamethasone (27). ERα, BMP-2 and BMP-4 expressions have been found to correlate temporarily, during the development of the osteoblast phenotype in early fibroblastic stem cells (28). These observations indicate that the ER pathway is closely associated with the BMP pathway during bone development and remodeling. In previous studies, BMP-6 expression was determined to be activated by estrogen in the MCF-7 breast cancer cell line (29). It was also reported that BMP-2-induced the activation of Smad activity and that BMP-2-mediated gene expression was suppressed by E2 in breast cancer cells via direct physical interactions between Smads and ER (30). Therefore, the crosstalk between the BMP and ER pathways may play a role in tumor differentiation and metastasis. It is reported in this study, for the first time, that BMP2 can induce the expression of ERα-36 in MCF-7 and MDA-MB-231 cells. This study provides new insights into the BMP2 function in breast cancer cells. Understanding the crosstalk of BMP2 and ER signaling pathways will increase our understanding of the mechanisms of many diseases, in addition to cancer, that are important to human health.

Acknowledgements

The authors would like to thank Miss Li Yueqin for the technical support and Drs Li Hongjian and Cai Dongqing for having discussed the key issues in this study. The present study was supported by grants from the Guangzhou Scientific and Technical Project (33107005) and by the Foundation for Distinguished Young Talents in Higher Education of Guangdong, China (LYM11080).

References

1 

Miyazono K, Kamiya Y and Morikawa M: Bone morphogenetic protein receptors and signal transduction. J Biochem. 147:35–51. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Wozney JM, Rosen V, Celeste AJ, Mitsock LM, Whitters MJ, Kriz RW, Hewick RM and Wang EA: Novel regulators of bone formation: molecular clones and activities. Science. 242:1528–1534. 1988. View Article : Google Scholar : PubMed/NCBI

3 

Attisano L and Wrana JL: Signal transduction by the TGF-beta superfamily. Science. 296:1646–1647. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Lee J, Son MJ, Woolard K, Donin NM, Li A, Cheng CH, Kotliarova S, Kotliarov Y, Walling J, Ahn S, et al: Epigenetic-mediated dysfunction of the bone morphogenetic protein pathway inhibits differentiation of glioblastoma-initiating cells. Cancer Cell. 13:69–80. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Varga AC and Wrana JL: The disparate role of BMP in stem cell biology. Oncogene. 24:5713–5721. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Farnsworth RH, Karnezis T, Shayan R, Matsumoto M, Nowell CJ, Achen MG and Stacker SA: A role for bone morphogenetic protein-4 in lymph node vascular remodeling and primary tumor growth. Cancer Res. 71:6547–6557. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Katzenellenbogen BS and Katzenellenbogen JA: Estrogen receptor transcription and transactivation: Estrogen receptor alpha and estrogen receptor beta: regulation by selective estrogen receptor modulators and importance in breast cancer. Breast Cancer Res. 2:335–344. 2000. View Article : Google Scholar

8 

Glidewell-Kenney C, Weiss J, Lee EJ, Pillai S, Ishikawa T, Ariazi EA and Jameson JL: ERE-independent ERalpha target genes differentially expressed in human breast tumors. Mol Cell Endocrinol. 245:53–59. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Holmes KA, Hurtado A, Brown GD, Launchbury R, Ross-Innes CS, Hadfield J, Odom DT and Carroll JS: Transducin-like enhancer protein 1 mediates estrogen receptor binding and transcriptional activity in breast cancer cells. Proc Natl Acad Sci USA. 109:2748–2753. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Vasudevan N, Kow LM and Pfaff DW: Early membrane estrogenic effects required for full expression of slower genomic actions in a nerve cell line. Proc Natl Acad Sci USA. 98:12267–12271. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Baselga J, Semiglazov V, van Dam P, Manikhas A, Bellet M, Mayordomo J, Campone M, Kubista E, Greil R, Bianchi G, et al: Phase II randomized study of neoadjuvant everolimus plus letrozole compared with placebo plus letrozole in patients with estrogen receptor-positive breast cancer. J Clin Oncol. 27:2630–2637. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Edwards DP: Regulation of signal transduction pathways by estrogen and progesterone. Annu Rev Physiol. 67:335–376. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Liu H, Qiu J, Li N, Chen T and Cao X: Human phosphatidylethanolamine-binding protein 4 promotes transactivation of estrogen receptor alpha (ERalpha) in human cancer cells by inhibiting proteasome-dependent ERalpha degradation via association with Src. J Biol Chem. 285:21934–21942. 2010. View Article : Google Scholar

14 

Thomas C and Gustafsson JÅ: The different roles of ER subtypes in cancer biology and therapy. Nat Rev Cancer. 11:597–608. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Herynk MH and Fuqua SA: Estrogen receptor mutations in human disease. Endocr Rev. 25:869–898. 2004. View Article : Google Scholar : PubMed/NCBI

16 

Wang Z, Zhang X, Shen P, Loggie BW, Chang Y and Deuel TF: Identification, cloning, and expression of human estrogen receptor-alpha36, a novel variant of human estrogen receptor-alpha66. Biochem Biophys Res Commun. 336:1023–1027. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Osborne CK: Tamoxifen in the treatment of breast cancer. N Engl J Med. 339:1609–1618. 1998. View Article : Google Scholar : PubMed/NCBI

18 

Miller TW, Balko JM and Arteaga CL: Phosphatidylinositol 3-kinase and antiestrogen resistance in breast cancer. J Clin Oncol. 29:4452–4461. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Ho CC and Bernard DJ: Bone morphogenetic protein 2 acts via inhibitor of DNA binding proteins to synergistically regulate follicle-stimulating hormone β transcription with activin A. Endocrinology. 151:3445–3453. 2010.PubMed/NCBI

20 

ten Dijke P, Korchynskyi O, Valdimarsdottir G and Goumans MJ: Controlling cell fate by bone morphogenetic protein receptors. Mol Cell Endocrinol. 211:105–113. 2003.PubMed/NCBI

21 

Wang Z, Zhang X, Shen P, Loggie BW, Chang Y and Deuel TF: A variant of estrogen receptor-{alpha}, hER-{alpha}36: transduction of estrogen- and antiestrogen-dependent membrane-initiated mitogenic signaling. Proc Natl Acad Sci USA. 103:9063–9068. 2006.

22 

Lin SL, Yan LY, Zhang XT, et al: ERalpha-36, a variant of ER-alpha, promotes tamoxifen agonist action in endometrial cancer cells via the MAPK/ERK and PI3K/Akt pathways. PLoS One. 5:e90132010. View Article : Google Scholar : PubMed/NCBI

23 

Kipp JL, Kilen SM, Woodruff TK and Mayo KE: Activin regulates estrogen receptor gene expression in the mouse ovary. J Biol Chem. 282:36755–36765. 2007. View Article : Google Scholar : PubMed/NCBI

24 

Shi L, Dong B, Li Z, Lu Y, Ouyang T, Li J, Wang T, Fan Z, Fan T, Lin B, Wang Z and Xie Y: Expression of ER-{alpha}36, a novel variant of estrogen receptor {alpha}, and resistance to tamoxifen treatment in breast cancer. J Clin Oncol. 27:3423–3429. 2009.

25 

Lee LM, Cao J, Deng H, Chen P, Gatalica Z and Wang ZY: ER-alpha36, a novel variant of ER-alpha, is expressed in ER-positive and -negative human breast carcinomas. Anticancer Res. 28:479–483. 2008.PubMed/NCBI

26 

Wu L, Wu Y, Gathings B, Wan M, Li X, Grizzle W, Liu Z, Lu C, Mao Z and Cao X: Smad4 as a transcription corepressor for estrogen receptor alpha. J Biol Chem. 278:15192–15200. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Matsumoto Y, Otsuka F, Takano M, Mukai T, Yamanaka R, Takeda M, Miyoshi T, Inagaki K, Sada KE and Makino H: Estrogen and glucocorticoid regulate osteoblast differentiation through the interaction of bone morphogenetic protein-2 and tumor necrosis factor-alpha in C2C12 cells. Mol Cell Endocrinol. 325:118–127. 2010. View Article : Google Scholar

28 

Oreffo RO, Kusec V, Romberg S and Triffitt JT: Human bone marrow osteoprogenitors express estrogen receptor-alpha and bone morphogenetic proteins 2 and 4 mRNA during osteoblastic differentiation. J Cell Biochem. 75:382–392. 1999. View Article : Google Scholar

29 

Zhang M, Wang Q, Yuan W, Yang S, Wang X, Yan JD, Du J, Yin J, Gao SY, Sun BC and Zhu TH: Epigenetic regulation of bone morphogenetic protein-6 gene expression in breast cancer cells. J Steroid Biochem Mol Biol. 105:91–97. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Yamamoto T, Saatcioglu F and Matsuda T: Cross-talk between bone morphogenic proteins and estrogen receptor signaling. Endocrinology. 143:2635–2642. 2002. View Article : Google Scholar

Related Articles

Journal Cover

September 2012
Volume 6 Issue 3

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Wang D, Huang P, Zhu B, Sun L, Huang Q and Wang J: Induction of estrogen receptor α-36 expression by bone morphogenetic protein 2 in breast cancer cell lines. Mol Med Rep 6: 591-596, 2012.
APA
Wang, D., Huang, P., Zhu, B., Sun, L., Huang, Q., & Wang, J. (2012). Induction of estrogen receptor α-36 expression by bone morphogenetic protein 2 in breast cancer cell lines. Molecular Medicine Reports, 6, 591-596. https://doi.org/10.3892/mmr.2012.945
MLA
Wang, D., Huang, P., Zhu, B., Sun, L., Huang, Q., Wang, J."Induction of estrogen receptor α-36 expression by bone morphogenetic protein 2 in breast cancer cell lines". Molecular Medicine Reports 6.3 (2012): 591-596.
Chicago
Wang, D., Huang, P., Zhu, B., Sun, L., Huang, Q., Wang, J."Induction of estrogen receptor α-36 expression by bone morphogenetic protein 2 in breast cancer cell lines". Molecular Medicine Reports 6, no. 3 (2012): 591-596. https://doi.org/10.3892/mmr.2012.945