Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September 2013 Volume 8 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September 2013 Volume 8 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Protective effect of the herbal medicine Gan‑fu‑kang against carbon tetrachloride‑induced liver fibrosis in rats

  • Authors:
    • Caihua Zhang
    • Yanfu Wang
    • Hong Chen
    • Guang Yang
    • Shaopeng Wang
    • Miaona Jiang
    • Li Cong
    • Lijun Yuan
    • Hanshu Li
    • Yujie Jia
  • View Affiliations / Copyright

    Affiliations: Department of Pathophysiology, Dalian Medical University, Dalian, Liaoning 116044, P.R. China, The First Affiliated Hospital, Dalian Medical University, Dalian, Liaoning 116011, P.R. China
  • Pages: 954-962
    |
    Published online on: July 12, 2013
       https://doi.org/10.3892/mmr.2013.1587
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to investigate the effect of a herbal medicine formula, Gan‑fu‑kang (GFK), on the treatment of liver fibrosis in rats and the mechanisms via which it exerts its effect. Liver fibrosis was induced in rats by subcutaneous injection of carbon tetrachloride (CCl4) at 0.5 mg/kg body weight, twice a week for 8 weeks. The rats were randomly selected to receive saline or GFK at 31.25, 312.5 or 3,125 mg/kg body weight/day between weeks 9 and 20. An additional group of rats without CCl4 injection was used as the baseline. In the liver fibrosis model rats, an increase in plasma liver enzymes, fibrotic markers in serum and liver fibrosis, production of α‑smooth muscle actin, matrix metalloproteinase‑2 and tissue inhibitor of metalloproteinase‑1, synthesis of collagen and activation of the Wnt/β‑catenin signaling pathway were observed. GFK administration was found to significantly reduce these changes. Results of this study demonstrate that GFK has a protective and therapeutic effect on liver fibrosis induced by CCl4, which may be associated with its inhibitory activity on HSC proliferation and collagen synthesis, effectively downregulating Wnt/β‑catenin signaling.

Introduction

Liver fibrosis is a wound-healing process involving the activation of hepatic stellate cells (HSCs) and an increased deposition of extracellular matrix (ECM) components, including type I/III collagen, metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) (1,2). HSCs play pivotal roles in fibrogenesis in the liver (3,4). Following injury, HSCs are activated and undergo complex transdifferentiation, leading to increased proliferation, migration and contraction and a shift towards synthesis and deposition of ECM materials, contributing to scar formation and eventually cirrhosis (5–7). A characteristic feature of activated HSCs is the activation of several cytokine mediators, including transforming growth factor-β (TGF-β), platelet derived growth factor (PDGF) and angiotensin (8–10). Therefore, investigation of signaling pathways and identification of the potential therapeutic targets is extremely important.

Previous studies have demonstrated the ability of natural drugs to prevent the development of liver fibrosis (11,12). Gan-fu-kang (GFK) is a traditional Chinese prescription herb complex that contains Salvia miltiorrhiza (Labiatae), milkvetch root (Leguminosae) and Angelica (Umbelliferae). Salvia miltiorrhiza plays an integral role in liver fibrosis by activating the circulation to remove blood stasis. In traditional Chinese medicine, milkvetch root is considered to supplement qi and provide body fluids, while Angelica replenishes blood. GFK is commonly used to treat human liver fibrosis induced by alcohol abuse and hepatitis, and has been demonstrated to induce protective and therapeutic effects to reverse liver fibrosis (13,14).

The Wnt genes comprise a highly conserved family of secreted, hydrophobic glycoproteins that play a crucial role in regulating embryonic development, cellular differentiation and proliferation and polarity (15–17). Abnormal regulation of Wnt/β-catenin signaling has been implicated in tumorigenesis and in the pathogenesis of a number of human diseases of diverse tissues (18–20). Once activated, it may activate downstream target genes, including c-jun, cyclinD1 and PPAR-γ, which in turn may promote the deposition of ECM and proliferation of HSC (21–23).

It has previously been reported that Wnt signaling may serve as the common downstream mediator of fibrogenic effects rendered by TGF-β, PDGF and other factors (24). Previous observations have indicated that GFK inhibits TGF-β and MAPK/AP-1 pathways, thus providing a hepatoprotective effect (13,14,25). Therefore, it was hypothesized that GFK exerts an antifibrotic effect by mediating the Wnt/β-catenin signaling pathway. The present study aimed to investigate the effects of GFK treatment on the Wnt/β-catenin signaling pathway.

Materials and methods

Herbal medicine

GFK is a traditional Chinese herbal formula containing Salvia miltiorrhiza, milkvetch root and Angelica. The crude drug was purchased from Dalian Medical University (Dalian, China) and extracted by the Department of Pathophysiology. The herbal decoction was stored at −20°C.

Animals

Adult Sprague-Dawley (SD) rats (1:1, male:female; 180–200 g) were purchased from the Experimental Animal Center of Dalian Medical University, [confirmation no., SCXK (Liao) 2004-0017]. All rats were fed with a standard pellet diet and tap water was available ad libitum during the experimental trial. The animals were maintained in an air-conditioned room at 20°C under a 12-h light/dark cycle. All experiments were in strict accordance with the principle and guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals (26). The study was approved by the Ethics Committee of Dalian Medical University, Dalian, Liaoning, China

Animal model and drug treatment

Following a one-week acclimation period, rats were randomly divided into 5 groups: control (n=12), carbon tetrachloride 4 (CCl4) model (n=8) and three GFK groups (n=11). Each group, with the exception of control, received CCl4 subcutaneously (0.5 mg/kg in a vehicle of olive oil, twice/week) for 8 weeks. Following CCl4 treatment, rats randomly received GFK per os (31.25, 312.5 and 3,125 mg/kg/day) or vehicle between weeks 9 and 20. The control group received saline between weeks 1 and 20. All rats were sacrificed at the end of week 20. Blood and liver samples were obtained for further examination.

Plasma assay for liver enzymes and fibrotic markers in serum

Plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured using commercial test reagents (Nanjing Jiancheng Bio, Nanjing, China). The concentrations of serum hyaluronic acid (HA), laminin (LN), procollagen type III (PCIII) and collagen type IV (CIV) were measured by radioimmunoassay kits provided by the General Hospital of People’s Liberation Army (Beijing, China). The tests were performed according to the manufacturer’s instructions (Purevalley Biotech, Beijing, China).

Histopathological evaluation

Tissue samples were fixed in 10% formalin, embedded in paraffin and processed by routine histological procedures. Following this, 4–5-μm-thick sections were stained with hematoxylin and eosin (H&E) and picrosirius red staining. Sections were observed by light and polarizing microscopy, respectively. Fibrosis of H&E staining was graded as described previously (27): 0, normal liver without hyperplasia of collagenous fibers; I, slight extension of collagenous fibers from portal area or central veins; II, marked extension of collagenous fibers, without connecting each other and encysting the whole hepatic lobules; III, marked extension of collagenous fibers, connecting each other and encysting the whole hepatic lobules; IV, hepatic lobules are encysted and separated by collagenous fibers. The normal structure of hepatic lobules is destroyed. The pseudolobules are formed and it is dominated by large square pseudolobuli; V, structure of hepatic lobules is fully destroyed and large square and small round pseudolobules occupy 50%; VI, small round hepatic lobuli occupy almost the whole liver and the hyperplatic thick collagenous fibers are visible. All histological analysis was assigned by independent certified pathologists in a blind manner. Each sample was observed at magnifications of ×400 and ×200 and at least 10 fields of view were scored per liver slice to obtain the mean value.

Immunohistochemistry

Liver tissue sections were deparaffinized and hydrated in a graded alcohol series and washed in water. Antigens were retrieved in a pressure cooker in citrate buffer (pH 6.0) for 5 min at 1.0 kPa and non-specific binding was blocked in 5% BSA. Sections were sequentially incubated with one of the following primary antibodies overnight at 4°C: rat polyclonal anti-Tcf-4 (1:150), anti-α-smooth muscle actin (α-SMA; 1:200; both BIOS, Beijing Biosynthesis Biotechnology Co. Ltd., Beijing, China)and anti-β-catenin (1:150; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). The Vectastain ABC kit was used to obtain the final stain and diaminobenzidine (DAB) was used as the chromogen. The slides were counterstained with hematoxylin. Negative controls were obtained by omitting the primary antibody. A minimum of five random fields per liver section was detected at magnification ×400 and the semi-quantitative evaluations were assigned by the Image-pro-plus (Media Cybernetics Inc., Rockville, MD, USA).

Western blotting

Total and nuclear proteins were prepared according to standard instructions (28) and the concentration was estimated by a Bradford assay with BSA as standard. The primary antibodies, β-catenin (1:200), β-actin (1:1,000) and Histone H1 (1:200; all Santa Cruz Biotechnology, Inc.), α-SMA (1:400), TIMP-1 (1:300) and collagen I (1:200; all BIOS) were used. Equal amounts of protein (50 μg/lane) were separated by electrophoresis on a 10–12% SDS-polyacrylamide gel, transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA) and blocked with 5% skimmed milk. The first antibodies were incubated overnight at 4°C and then appropriate secondary antibodies were added. Proteins were visualized by enhanced chemiluminescence detection (Santa Cruz Biotechnology, Inc.) as reported. Densitometric scanning was performed using the UVP Bioimaging Systems with Labwork 4.6 (UVP, LLC, Upland, CA, USA) to determine the band intensities. All experiments were repeated five times.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted from rat liver samples using TRIzol reagent according to the manufacturer’s instructions (Invitrogen Life Technologies, Carlsbad, CA, USA). cDNA templates were prepared using oligo(dT) random primers, and Quant reverse transcriptase and the Taq DNA polymerase kit were used for PCR (Tiangen Biotech, Beijing, China) with β-actin as a control. Primer set sequences are presented in Table I. To evaluate the amplification, electrophoresis of PCR products was performed using 2% agarose gels containing ethidium bromide and then quantified using the UVP Bioimaging Systems.

Table I

Primer sequences and amplicon sizes.

Table I

Primer sequences and amplicon sizes.

GeneSequence (5′-3′)Amplicon length, bp
Wnt1Forward: GAAACCGCCGCTGGAACT
Reverse: CCCTGCCTCGTTATTGTGAAG
326
Wnt3aForward: GCAGTTGCGAAGTGAAGACC
Reverse: TGTGGGCACCTTGAAGTATGT
173
Wnt10bForward: TCTCCTGTTCTTGGCTTTGTT
Reverse: TCTAGTGCCGAGCAGTTCC
246
Frizzled-1Forward: AAGTTCTTCCTGTGCTCCATGT
Reverse: CTCCCCCAGAAAGTGATAGTTG
384
Frizzled-2Forward: CCTGGAGGTGCATCAATTCTAC
Reverse: CGCTCACCCAGAAACTTATAGC
447
GSK-3βForward: TACCTTAACCTGGTGCTGGACT
Reverse: TGTTGGTGTTCCTAGGACCTTT
453
β-cateninForward: GATTAACTATCAGGATGACGCG
Reverse: TCCATCCCTTCCTGCTTAGTC
780
Tcf-4Forward: GCACTTACCAGCTGACGTAGAC
Reverse: GGGCTAGCTCGTAGTACTTTGC
557
PPAR-γForward: TGTGGACCTCTCTGTGATGG
Reverse: CATTGGGTCAGCTCTTGTGA
127
Cyclin D1Forward: TGTTCGTGGCCTCTAAGATG
Reverse: ACTCCAGAAGGGCTTCAATC
450
α-SMAForward: TGTGCTGGACTCTGGAGATG
Reverse: GATCACCTGCCCATCAGG
291
Collagen IForward: TGCCGTGACCTCAAGATGTG
Reverse: CACAAGCGTGCT
461
Collagen IIIForward: AGATCATGTCTTGACTCAAGTC
Reverse: TTTACATTGCCATTGGCCTGA
463
MMP-2Forward: GTGGACAAACTGAGCGAA
Reverse: AGGTAGGGTACATCACAGAA
541
TIMP-1Forward: GCCATGGAGAGCCTCTGTGG
Reverse: GCAGGCAGGCAAAGTGATCG
356
β-actinForward: GGTATGGGTCAGAAGGACTCC
Reverse: TGATCTTCATGGTGCTAGGAGCC
847

[i] MMP, matrix metalloproteinase; TIMP-1, tissue inhibitor of metalloproteinase-1; α-SMA, α-smooth muscle actin.

Statistical analysis

Statistical analysis was performed using SPSS 11.5 software (SPSS, Inc., Chicago, IL, USA). All numerical data represent at least three independent experiments and are expressed as the mean ± SD. Comparison between groups was performed using a two-tailed Student’s t-test. Pearson was employed for correlation analysis of parameters. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of GFK on plasma hepatic enzyme and fibrotic markers in serum

Plasma ALT and AST increased significantly in CCl4 rats compared with the controls (P<0.01). Administration of GFK (3,125 and 312.5 mg/kg/day) significantly decreased ALT and AST levels (P<0.01; Fig. 1). Similarly, in the CCl4 group, serum markers of HA, LN, PCIII and CIV were increased (P<0.05) and GFK (312.5 and 3,125 mg/kg/day) treatment significantly blocked CCl4-induced elevation of these markers (Table II).

Figure 1

Serum levels of ALT and AST activities. Results are expressed as the mean ± SD. **P<0.01, vs control; ##P<0.01, vs model. ALT, alanine aminotransferase; AST, aspartate aminotransferase.

Table II

Levels of HA, LN, PCIII and CIV.

Table II

Levels of HA, LN, PCIII and CIV.

GroupDose (mg/kg)HALNPCIIICIV
Control58.96±4.5110.36±2.5616.63±3.5477.83±11.44
Model151.99±8.23a32.33±3.28a43.83±8.33a 155.85±25.09a
GFK3125.0084.23±4.91a,b17.05±2.92a,b26.41±3.21a,b94.99±9.010a,b
GFK312.5060.01±5.78b11.18±2.15b17.13±4.06b78.21±6.820b
GFK31.2588.71±4.47a,b18.56±2.30a,b25.27±5.15a,b 100.23±11.67a,b

a P<0.05, vs. control;

b P<0.05, vs. CCl4 model.

{ label (or @symbol) needed for fn[@id='tfn4-mmr-08-03-0954'] } GFK, Gan-fu-kang; HA, hyaluranic acid; LN, lamin; PCIII, procollagen type III, CIV collagen type IV; CCl4, carbon tetrachloride 4.

Histopathological changes

Liver histopathological examination of the control group revealed a normal lobular architecture with central veins and radiating hepatic cords (Fig. 2A and B). In the CCl4-treated group, marked changes were observed in liver morphology, including steatosis, ballooning, necrosis and inflammatory infiltration (Fig. 2C). Picrosirius red staining revealed severe collagen deposition (Fig. 2D). By contrast, GFK treatment significantly alleviated the degree of liver fibrosis and ductular proliferation (Fig. 2E–H). The antifibrotic effect was less marked in GFK (31.25 mg/kg/day; Fig. 2I and J). The average scores for the degree of liver damage are presented in Table III.

Figure 2

Photomicrographs of rat liver tissues. (A,C,E,G and I) Sections were stained with H&E (magnification, ×400). (B,D,F,H and J) Sections were stained by picrosirius red and observed under polarizing microscope to assess the presence of collagen. Collagen I was red and III was green (magnification, ×200). (A and B) Control, no histological abnormalities; (C and D) CCl4 model, fatty degeneration, necrosis, infiltration of inflammatory cells, formation of fibrotic septa and increased collagen deposition; (E,F,G and H) GFK (3,125 and 312.5 mg/kg/day), the degree of liver damage and fibrosis was markedly reduced and revealed less collagen deposition, particularly collagen type I; (I and J) GFK (31.25mg/kg/day), less statosis and inflammatory cells compared with the model group. HE, hematoxylin-eosin; GFK, Gan-fu-kang.

Table III

Effect of GFK on the pathological grading of liver fibrosis induced by CCl4.

Table III

Effect of GFK on the pathological grading of liver fibrosis induced by CCl4.

GroupDose (mg/kg)nDegree of liver fibrosisP-value

0IIIIIIIVVVI
Control1212000000
Model70011230a
GFK3125.00110343100b
GFK312.50110470000b
GFK31.25110152300b

a P<0.01, vs. control;

b P<0.05, vs. CCl4 model.

{ label (or @symbol) needed for fn[@id='tfn7-mmr-08-03-0954'] } GFK, Gan-fu-kang; CCl4, carbon tetrachloride 4.

Effect of GFK on α-SMA, collagen I, collagen III, MMP-2 and TIMP-1

To identify HSCs in the liver, immunohistochemistry was used to detect the expression of α-SMA, a marker of activated hepatic stellate cells. In the control group, α-SMA was predominantly located in the blood vessel wall, while in the model group, markedly higher expression of α-SMA was found in the portal area, fibrous septum and space of Disse (P<0.01). α-SMA-positive cells were reduced markedly in rats receiving GFK treatment (Fig. 3).

Figure 3

Immunohistochemistry against α-SMA in rat liver tissues. Representative micrographs demonstrate α-SMA protein localization in different groups as indicated (magnification, ×400). α-SMA, α-smooth muscle actin.

RT-PCR results revealed that α-SMA, collagen I, collagen III, MMP-2 and TIMP-1 mRNA levels increased significantly in CCl4-treated rats and was inhibited by GFK, with similar levels compared with control animals. Treatment with GFK at 312.5 mg/kg/day was more effective than treatment with GFK at 3,125 and 31.25 mg/kg/day (Fig. 4A). Western blot analysis revealed a significant increase in α-SMA, TIMP-1 and collagen I levels in the model group. These effects were markedly reduced by GFK. Response to GFK at 312.5 mg/kg/day was markedly higher compared with GFK at 3,125 and 31.25 mg/kg/day (Fig. 4B).

Figure 4

Effect of GFK on the expression of α-SMA, collagen I, collagen III, MMP-2 and TIMP-1 in liver fibrosis. (A) Representative RT-PCR analysis and quantification demonstrate that GFKa treatment suppressed the expression of α-SMA, collagen I, collagen III, MMP-2 and TIMP-1 mRNA in liver fibrosis induced by CCl4. (B) Representative western blot analysis and quantitative data indicate that treatment with GFK suppressed the expression of α-SMA, TIMP-1 and collagen protein I in liver fibrosis induced by CCl4. Lane 1, control; 2, model; 3, GFK (3,125 mg/kg); 4, GFK (312.5 mg/kg); and 5, GFK (31.25 mg/kg). *P<0.01, vs control; #P<0.01, vs model. α-SMA, α-smooth muscle actin; MMP-2, matrix metalloproteinase-2; TIMP-1, tissue inhibitor of metalloproteinase-1; RT-PCR, reverse transcription-polymerase chain reaction; GFK, Gan-fu-kang.

Effect of GFK on expression of genes involved in the Wnt/β-catenin signaling pathway

RT-PCR analysis was used to assess the expression of canonical Wnt genes (Wnt1, Wnt3a and Wnt10b), receptors (Fzd1 and 2), downstream target (GSK3β), substrate (β-catenin) and transcriptional regulator (Tcf-4) in the different groups. In the CCl4 treatment group, with the exception of GSK3β, mRNA levels of Wnt1, Wnt3a, Wnt10b, Fzd1, Fzd2 and β-catenin were higher, while in the GFK groups, expression was lower (Fig. 5A).

Figure 5

Effect of GFK on Wnt/β-catenin signaling pathway genes. (A) Effect of GFK on the mRNA expression of genes in the Wnt/β-catenin signaling pathway. Left, expression of associated genes in the Wnt/β-catenin signaling pathway and right, densitometric analysis of the results. (B) Effect of GFK on nuclear translocation of β-catenin in rat livers. GFK treatment interferes with the localization of β-catenin protein. Densitometric analysis of each band.(C) Immunohistochemistry against β-catenin and Tcf-4 proteins in rat liver sections (magnification, ×400). Brown indicates specific Ab reactivity. In the CCl4 group, β-catenin and Tcf-4 were markedly upregulated revealing positive staining at the fibrotic septa and downregulated in the GFK (312.5 mg/kg) group. Lane 1, control; 2, model; 3, GFK (3,125 mg/kg); 4, GFK (312.5 mg/kg); and 5, GFK (31.25 mg/kg). *P<0.01, vs. control; #P<0.05, vs. model. GFK, Gan-fu-kang; CCl4,carbon tetrachloride 4.

Activation of canonical Wnt signaling results in constitutive stabilization of the free pool of β-catenin, which travels to the nucleus and binds to Tcf/LEF. The complex modulates transcription of target genes. Therefore, levels of total β-catenin and nuclear accumulation of β-catenin in extracts of liver tissue were examined. Western blot analysis revealed increased accumulation of total β-catenin protein and translocation of β-catenin into the cell nucleus in the CCl4-treated group (Fig. 5B). Downregulation of β-catenin in the nucleus and whole cell lysates was observed following treatment with GFK (Fig. 5B).

In the model group, immunohistochemistry revealed enhanced β-catenin expression in the cytoplasm and clear nuclear staining was observed in single cells. β-catenin expression was attenuated by GFK prevention treatment (Fig. 5C). A significant increase in positive staining of Tcf-4 cells was observed in rats following CCl4 treatment. These changes were attenuated following administration of GFK (Fig. 5C).

Effect of GFK on Wnt/β-catenin target gene expression

mRNA levels of the putative target gene, cyclin D1, were significantly elevated in rats with liver fibrosis and were reduced by GFK treatment. By contrast, expression of PPAR-γ mRNA had an adverse result. The effects induced by GFK (312.5 mg/kg/day) were significantly increased when compared with GFK-treated animals (3,125 and 31.25 mg/kg/day; Fig. 6).

Figure 6

Effect of GFK on the expression of cyclinD1 and PPAR-γ on CCl4-injured liver fibrosis. RT-PCR analysis and quantification indicate induction of cyclin D1 in the fibrotic liver and reveals that GFK administration significantly decreased expression of cyclin D1; PPAR-γ mRNA had an adverse result. Lane 1, control; 2, model; 3, GFK (3,125 mg/kg); 4, GFK (312.5 mg/kg); and 5, GFK (31.25 mg/kg). *P<0.01, vs. control; #P<0.01, vs. model. GFK, Gan-fu-kang; RT-PCR, reverse transcription-polymerase chain reaction; CCl4,carbon tetrachloride 4.

Correlation analysis among Wnt3a, Wnt10b, β-catenin, Tcf-4, α-SMA, TIMP-1, collagen I and collagen III levels

Correlation analysis demonstrated that Wnt3a, Wnt10b, β-catenin and Tcf-4 significantly correlated with the following measures: α-SMA, TIMP-1, collagen I and collagen III (P<0.05 or P<0.01; Table IV).

Table IV

Correlation analysis in the model and GFK (312.5 mg/kg) groups.

Table IV

Correlation analysis in the model and GFK (312.5 mg/kg) groups.

α-SMATIMP-1Collagen ICollagen III




rP-valuerP-valuerP-valuerP-value
Wnt3a0.958<0.050.889<0.050.980<0.010.993<0.01
Wnt10b0.993<0.010.896<0.050.976<0.010.962<0.01
β-catenin0.963<0.050.921<0.010.980<0.010.980<0.01
Tcf-40.880<0.05--0.815<0.050.892<0.05

[i] Values are presented as correlation coefficients (r) and significant levels (P). GFK, Gan-fu-kang; TIMP-1, tissue inhibitors of metalloproteinase 1.

Discussion

Chronic injuries to the liver lead to liver fibrosis and subsequent cirrhosis and even hepatocellular carcinoma, and are associated with elevated mortality rates worldwide (29–31). Liver fibrosis is a dynamic process involving increased deposition of ECM components, particularly collagens (32,33). Since there is not an effective treatment approach for irreversible cirrhosis, new potent agents for the treatment of liver fibrosis are required. Medicinally, traditional Chinese herbs have made a significant contribution to the treatment of liver fibrosis (34). The present study revealed that GFK, a traditional Chinese medicine formula, induces a protective effect against CCl4-induced liver fibrosis in rats.

Activities of serum ALT and AST are conventionally used as biochemical makers to assess liver injury (35,36) and in the present study, CCl4 injection resulted in a significant elevation of serum ALT and AST. Administration of GFK (312.5 and 3,125 mg/kg/day) markedly attenuated the increased activities of serum ALT and AST, which indicated that GFK has potent hepatoprotective effects. HA, LN, PCIII and CIV, which are used as indices for the extent of liver fibrosis, were also investigated (37). Observations revealed a significant reduction in these biomarker levels following treatment with GFK. Therefore, we hypothesized that GFK exerts a therapeutic effect on liver fibrotic rats induced by CCl4, and the repressive effect of GFK at 312.5 mg/kg/day is superior to that of GFK at 3,125 and 31.25 mg/kg/day.

Activation and proliferation of HSCs plays a pivotal role in liver fibrogenesis. When activated, HSCs undergo phenotypic transformation between a quiescent cell and myofibrolast-like cell and drive fibrogenesis by synthesizing and releasing α-SMA filaments and ECM, including type I and III collagens (38,39). α-SMA, a characteristic cytoskeletal protein, is considered a marker of activated HSCs. Collagens are the main components of the ECM, primarily composed of collagen I and III, which account for 95% of the total collagen in fibrotic liver. The present study revealed an antifibrogenesis effect caused by GFK decreasing the expression of α-SMA, collagen I and III in CCl4-treated animals. This observation was further supported by histological observations. Results of α-SMA immunostaining confirmed that the activity of HSCs in GFK therapeutic rats was markedly less than in CCl4-treated rats.

The outcome of fibrogenesis is the accumulation and degradation of ECM, which is regulated by a family of zinc-dependent enzymes, MMPs, and their inhibitors, TIMPs (40). MMP-2 is produced by activated HSCs and is considered to be important for remodeling of the basement membrane during tissue repair (41). TIMP-1 is an inhibiting factor of MMPs and previous studies have revealed that TIMP-1 not only inhibits collagenase activity, but also inhibits MMPs and stromelysin activity (42,43). The present study revealed that rats receiving CCl4 exhibited elevated MMP-2 and TIMP-1 expression, while this effect was abrogated by GFK treatment. These results indicate that GFK may regulate the balance between MMPs and TIMPs.

Wnt signaling via β-catenin is implicated in embryonic development and tissue homeostasis (22). Consequently, mutations in the Wnt signaling pathway are often associated with a number of genetic defects, cancer and other diseases (44). Previous studies have demonstrated that the activation of the Wnt pathway results in fibrogenic conversion of numerous tissues, including lung, kidney and muscle (45–49). Previously, HSCs were reported to exhibit upregulation of the Wnt signaling pathway in vitro and several inhibitors were found to antagonize or modulate this pathway in these cells (50,51). In addition, the Wnt/β-catenin pathway has been reported to maintain the inactivity stage of HSCs (52). The present study was designed to determine whether the Wnt/β-catenin signaling pathway is involved in fibrosis and to investigate the antifibrotic effect of GFK in vivo using CCl4-induced liver fibrosis in SD rats. The observations revealed that expression of Wnt and their corresponding Fzd receptor genes increased in the fibrotic liver, indicating that the response of canonical Wnt proteins and receptors is consistent with the damage of CCl4. In the present study, it was demonstrated that expression of GSK3β was downregulated and its effector, β-catenin, was upregulated. These changes indicated that the Wnt signaling was in an active state. In agreement, mRNA and protein levels increased and were mainly distributed in the cell plasma and nuclei, revealing that the Wnt/β-catenin pathway was activated. Following this, Tcf-4 was found to be a key partner for β-catenin at the protein level via western blot analysis and immunohistochemistry. This observation revealed a correlation between upregulation and increasing mRNA levels, localized predominantly at the nuclei of hepatic cells. These observations are consistent with a previous study in which the formation of β-catenin/Tcf-4 complex was reported to be essential for the Wnt signaling cascade (53). The changes were reversed following GFK treatment.

The ultimate effect of the Wnt/β-catenin pathway is the regulation of downstream target genes. Therefore, two putative target genes, cyclin D1 and PPAR-γ, in fibrotic liver were investigated. Cyclin D1 is a pivotal member of the cyclin family and is widely considered to control cell proliferation and differentiation via induction of cell entry into the S-phase and G2/M-phase (54). Overexpression of cyclin D1 is involved in HSC proliferation in rat liver (55). The upregulation of cyclinD1 in fibrotic liver and its downregulation following treatment with GFK was observed, indicating that its activation may be essential for the evolution of liver fibrosis. The Wnt/β-catenin pathway is known to expand in liver fibrosis, mainly due to an additional target, PPAR-γ. PPAR-γ is a member of the nuclear receptor family and is capable of stimulating adipocyte differentiation, regulating lipid metabolism, activating insulin, inhibiting cell proliferation and inducing apoptosis (56). A previous study revealed that treatment with PPAR-γ ligands blocks liver fibrosis in animal models (57). The present study demonstrated that the Wnt/β-catenin signaling may suppress PPAR-γ activity and GFK treatment may upregulate the amplification of PPAR-γ. This is consistent with the observation that PPAR-γ may conversely inhibit Wnt/β-catenin signaling by promoting the degradation of β-catenin (58,59). A number of other transcription factors may be involved in the modulation of Wnt target genes, thus this area requires further investigation.

Correlation analysis revealed that the expression of α-SMA, TIMP-1, collagen I and collagen III closely correlate with the abundance of the associated factors, Wnt3a, Wnt10b, β-catenin and Tcf-4, in the Wnt/β-catenin signaling pathway.

In summary, the present study indicates that the herbal medicine GFK prevents CCl4-induced rat liver fibrosis and that this action may be caused, in part, by its depressing effect on the canonical Wnt/β-catenin pathway. Therefore, GFK represents a potential therapeutic strategy for improving liver fibrosis. Further investigation is required to specify how/which components of GFK exert antifibrotic functions and its exact role in various liver cell types.

Acknowledgements

The authors thank Dr Joel Tatenda Mafemba for valuable proofreading of the manuscript. This study was financially supported by the Natural Science Foundation of Liaoning Province, China (201102055).

References

1 

Friedman SL: Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem. 275:2247–2250. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Cheng M and Yang C: The Basic Study and Clinical Research on Hepatic Fibrosis. First edition. First Jumbo Publishing Co; California, USA: 2002

3 

Moreira RK: Hepatic stellate cells and liver fibrosis. Arch Pathol Lab Med. 131:1728–1734. 2007.PubMed/NCBI

4 

Wu J and Zern MA: Hepatic stellate cells: a target for the treatment of liver fibrosis. J Gastroenterol. 35:665–672. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Mann J and Mann DA: Transcriptional regulation of hepatic stellate cells. Adv Drug Deliv Rev. 61:497–512. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Gäbele E, Brenner DA and Rippe RA: Liver fibrosis: signals leading to the amplification of the fibrogenic hepatic stellate cell. Front Biosci. 8:d69–d77. 2003.PubMed/NCBI

7 

Zou YH, Yang Y, Li J, et al: Potential therapeutic effects of a traditional Chinese formulation, BJ-JN, on liver fibrosis induced by carbon tetrachloride in rats. J Ethnopharmacol. 120:452–457. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Purps O, Lahme B, Gressner AM, Meindl-Beinker NM and Dooley S: Loss of TGF-beta dependent growth control during HSC transdifferentiation. Biochem Biophys Res Commun. 353:841–847. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Borkham-Kamphorst E, van Roeyen CR, Ostendorf T, Floege J, Gressner AM and Weiskirchen R: Pro-fibrogenic potential of PDGF-D in liver fibrosis. J Hepatol. 46:1064–1074. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Brewster UC, Setaro JF and Perazella MA: The renin-angiotensin-aldosterone system: cardiorenal effects and implications for renal and cardiovascular disease states. Am J Med Sci. 326:15–24. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Cadigan KM and Nusse R: Wnt signaling: a common theme in animal development. Genes Dev. 11:3286–3305. 1997. View Article : Google Scholar : PubMed/NCBI

12 

Lin X, Zhang S, Huang Q, et al: Protective effect of Fufang-Liu-Yue-Qing, a traditional Chinese herbal formula, on CCl4 induced liver fibrosis in rats. J Ethnopharmacol. 142:548–556. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Xu TT, Jiang MN, Li C, Che Y and Jia YJ: Effect of Chinese traditional compound, Gan-fu-kang, on CCl(4)-induced liver fibrosis in rats and its probable molecular mechanisms. Hepatol Res. 37:221–229. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Gao Y, Song LX, Jiang MN, Ge GY and Jia YJ: Effects of traditional chinese medicine on endotoxin and its receptors in rats with non-alcoholic steatohepatitis. Inflammation. 31:121–132. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Lee PN, Pang K, Matus DQ and Martindale MQ: A WNT of things to come: evolution of Wnt signaling and polarity in cnidarians. Semin Cell Dev Biol. 17:157–167. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Zhao J, Kim KA and Abo A: Tipping the balance: modulating the Wnt pathway for tissue repair. Trends Biotechnol. 27:131–136. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Lustig B and Behrens J: The Wnt signaling pathway and its role in tumor development. J Cancer Res Clin Oncol. 129:199–221. 2003.PubMed/NCBI

18 

Kikuchi A and Yamamoto H: Tumor formation due to abnormalities in the β-catenin-independent pathway of Wnt signaling. Cancer Sci. 99:202–208. 2008.

19 

Zhang B, Zhou KK and Ma JX: Inhibition of connective tissue growth factor overexpression in diabetic retinopathy by SERPINA3K via blocking the WNT/beta-catenin pathway. Diabetes. 59:1809–1816. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Morrisey EE: Wnt signaling and pulmonary fibrosis. Am J Pathol. 162:1393–1397. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Habas R and Dawid IB: Dishevelled and Wnt signaling: is the nucleus the final frontier? J Biol. 4:22005. View Article : Google Scholar : PubMed/NCBI

22 

Logan CY and Nusse R: The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 20:781–810. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Ross SE, Hemati N, Longo KA, Bennett CN, Lucas PC, Erickson RL and MacDougald OA: Inhibition of adipogenesis by Wnt signaling. Science. 289:950–953. 2000. View Article : Google Scholar : PubMed/NCBI

24 

Cheng JH, She H, Han YP, et al: Wnt antagonism inhibits hepatic stellate cell activation and liver fibrosis. Am J Physiol Gastrointest Liver Physiol. 294:G39–G49. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Lou JL, Jiang MN, Li C, et al: Herb medicine Gan-fu-kang attenuates liver injury in a rat fibrotic model. J Ethnopharmacol. 128:131–138. 2010. View Article : Google Scholar : PubMed/NCBI

26 

National Institutes of Health. Guide for the Care and Use of Laboratory Animals. Sixth edition. National Acadamies Press; Washington, D.C: 1985

27 

Nie QH, Cheng YQ, Xie YM, Zhou YX and Cao YZ: Inhibiting effect of antisense oligonucleotides phosphorthioate on gene expression of TIMP-1 in rat liver fibrosis. World J Gastroenterol. 7:363–369. 2001.PubMed/NCBI

28 

Dignani JD, Lebovitz RM and Roeder RG: Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475–1489. 1983. View Article : Google Scholar : PubMed/NCBI

29 

Castera L: Assessing liver fibrosis. Expert Rev Gastroenterol Hepatol. 2:541–552. 2008. View Article : Google Scholar

30 

Faria SC, Ganesan K, Mwangi I, et al: MR imaging of liver fibrosis: current state of the art. Radiographics. 29:1615–1635. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Watson MR, Wallace K, Gieling RG, et al: NF-kappaB is a critical regulator of the survival of rodent and human hepatic myofibroblasts. J Hepatol. 48:589–597. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Tsukada S, Parsons CJ and Rippe RA: Mechanisms of liver fibrosis. Clin Chim Acta. 364:33–60. 2006. View Article : Google Scholar

33 

Friedman SL: Liver fibrosis-from bench to bedside. J Hepatol. 38:S38–S53. 2003. View Article : Google Scholar

34 

Fowell AJ and Iredale JP: Emerging therapies for liver fibrosis. Dig Dis. 24:174–183. 2006. View Article : Google Scholar : PubMed/NCBI

35 

Sturgill MG and Lambert GH: Xenobiotic-induced hepatotoxicity: mechanisms of liver injury and methods of monitoring hepatic function. Clin Chem. 43:1512–1526. 1997.PubMed/NCBI

36 

Achliya GS, Wadodkar SG and Dorle AK: Evaluation of hepatoprotective effect of Amalkadi Ghrita against carbon tetrachloride-induced hepatic damage in rats. J Ethnopharmacol. 90:229–232. 2004. View Article : Google Scholar : PubMed/NCBI

37 

Leroy V: Other non-invasive markers of liver fibrosis. Gastroenterol Clin Biol. 32(6 Suppl 1): 52–57. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Bataller R and Brenner DA: Liver fibrosis. J Clin Invest. 115:209–218. 2005. View Article : Google Scholar

39 

Lotersztajn S, Julien B, Teixeira-Clerc F, Grenard P and Mallat A: Hepatic fibrosis: molecular mechanisms and drug targets. Annu Rev Pharmacol Toxicol. 45:605–628. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Li D and Friedman SL: Liver fibrogenesis and the role of hepatic stellate cells: new insights and prospects for therapy. J Gastroenterol Hepatol. 14:618–633. 1999. View Article : Google Scholar : PubMed/NCBI

41 

Han YP: Matrix metalloproteinases, the pros and cons, in liver fibrosis. J Gastroenterol Hepatol. 21(Suppl 3): S88–S91. 2006. View Article : Google Scholar : PubMed/NCBI

42 

Lichtinghagen R, Michels D, Haberkorn CI, et al: Matrix metalloproteinase (MMP)-2, MMP-7 and tissue inhibitor of metalloproteinase-1 are closely related to the fibroproliferative process in the liver during chronic hepatitis C. J Hepatol. 34:239–247. 2001. View Article : Google Scholar : PubMed/NCBI

43 

Arthur MJ, Mann DA and Iredale JP: Tissue inhibitors of metalloproteinases, hepatic stellate cells and liver fibrosis. J Gastroenterol Hepatol. 13:S33–S38. 1998.PubMed/NCBI

44 

Clevers H: Wnt/beta-catenin signaling in development and disease. Cell. 127:469–480. 2006. View Article : Google Scholar : PubMed/NCBI

45 

Chilosi M, Poletti V, Zamò A, et al: Aberrant Wnt/beta-catenin pathway activation in idiopathic pulmonary fibrosis. Am J Pathol. 162:1495–1502. 2003. View Article : Google Scholar : PubMed/NCBI

46 

Königshoff M, Balsara N, Pfaff EM, et al: Functional Wnt signaling is increased in idiopathic pulmonary fibrosis. PLoS One. 3:e21422008.PubMed/NCBI

47 

Luk JM, Wang X, Liu P, et al: Traditional Chinese herbal medicines for treatment of liver fibrosis and cancer: from laboratory discovery to clinical evaluation. Liver Int. 27:879–890. 2007. View Article : Google Scholar : PubMed/NCBI

48 

He W, Dai C, Li Y, Zeng G, Monga SP and Liu Y: Wnt/beta-catenin signaling promotes renal interstitial fibrosis. J Am Soc Nephrol. 20:765–776. 2009. View Article : Google Scholar : PubMed/NCBI

49 

Brack AS, Conboy MJ, Roy S, et al: Increased Wnt signaling during aging alters muscle stem cell fate and increases fibrosis. Science. 317:807–810. 2007. View Article : Google Scholar : PubMed/NCBI

50 

Jiang F, Parsons CJ and Stefanovic B: Gene expression profile of quiescent and activated rat hepatic stellate cells implicates Wnt signaling pathway in activation. J Hepatol. 45:401–409. 2006. View Article : Google Scholar : PubMed/NCBI

51 

Myung SJ, Yoon JH, Gwak GY, et al: Wnt signaling enhances the activation and survival of human hepatic stellate cells. FEBS Lett. 581:2954–2958. 2007. View Article : Google Scholar : PubMed/NCBI

52 

Kordes C, Sawitza I and Häussinger D: Canonical Wnt signaling maintains the quiescent stage of hepatic stellate cells. Biochem Biophys Res Commun. 367:116–123. 2008. View Article : Google Scholar : PubMed/NCBI

53 

MacDonald BT, Tamai K and He X: Wnt/beta-catenin signaling: components, mechanisms and diseases. Dev Cell. 17:9–26. 2009. View Article : Google Scholar : PubMed/NCBI

54 

Ying J, Li H, Yu J, et al: WNT5A exhibits tumor-suppressive activity through antagonizing the Wnt/beta-catenin signaling, and is frequently methylated in colorectal cancer. Clin Cancer Res. 14:55–61. 2008. View Article : Google Scholar : PubMed/NCBI

55 

Albrecht JH and Hansen LK: Cyclin D1 promotes mitogen-independent cell cycle progression in hepatocytes. Cell Growth Differ. 10:397–404. 1999.PubMed/NCBI

56 

Houseknecht KL, Cole BM and Steele PJ: Peroxisome proliferator-activated receptor gamma (PPARgamma) and its ligands: a review. Domest Anim Endocrinol. 22:1–23. 2002. View Article : Google Scholar : PubMed/NCBI

57 

Galli A, Crabb DW, Ceni E, et al: Antidiabetic thiazolidinediones inhibit collagen synthesis and hepatic stellate cell activation in vivo and in vitro. Gastroenterology. 122:1924–1940. 2002. View Article : Google Scholar : PubMed/NCBI

58 

Liu J and Farmer SR: Regulating the balance between peroxisome proliferator-activated receptor gamma and beta-catenin signaling during adipogenesis. A glycogen synthase kinase 3beta phosphorylation-defective mutant of beta-catenin inhibits expression of a subset of adipogenic genes. J Biol Chem. 279:45020–45027. 2004.

59 

Moldes M, Zuo Y, Morrison RF, et al: Peroxisome-proliferator-activated receptor gamma suppresses Wnt/betacatenin signalling during adipogenesis. Biochem J. 376:607–613. 2003. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang C, Wang Y, Chen H, Yang G, Wang S, Jiang M, Cong L, Yuan L, Li H, Jia Y, Jia Y, et al: Protective effect of the herbal medicine Gan‑fu‑kang against carbon tetrachloride‑induced liver fibrosis in rats. Mol Med Rep 8: 954-962, 2013.
APA
Zhang, C., Wang, Y., Chen, H., Yang, G., Wang, S., Jiang, M. ... Jia, Y. (2013). Protective effect of the herbal medicine Gan‑fu‑kang against carbon tetrachloride‑induced liver fibrosis in rats. Molecular Medicine Reports, 8, 954-962. https://doi.org/10.3892/mmr.2013.1587
MLA
Zhang, C., Wang, Y., Chen, H., Yang, G., Wang, S., Jiang, M., Cong, L., Yuan, L., Li, H., Jia, Y."Protective effect of the herbal medicine Gan‑fu‑kang against carbon tetrachloride‑induced liver fibrosis in rats". Molecular Medicine Reports 8.3 (2013): 954-962.
Chicago
Zhang, C., Wang, Y., Chen, H., Yang, G., Wang, S., Jiang, M., Cong, L., Yuan, L., Li, H., Jia, Y."Protective effect of the herbal medicine Gan‑fu‑kang against carbon tetrachloride‑induced liver fibrosis in rats". Molecular Medicine Reports 8, no. 3 (2013): 954-962. https://doi.org/10.3892/mmr.2013.1587
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang C, Wang Y, Chen H, Yang G, Wang S, Jiang M, Cong L, Yuan L, Li H, Jia Y, Jia Y, et al: Protective effect of the herbal medicine Gan‑fu‑kang against carbon tetrachloride‑induced liver fibrosis in rats. Mol Med Rep 8: 954-962, 2013.
APA
Zhang, C., Wang, Y., Chen, H., Yang, G., Wang, S., Jiang, M. ... Jia, Y. (2013). Protective effect of the herbal medicine Gan‑fu‑kang against carbon tetrachloride‑induced liver fibrosis in rats. Molecular Medicine Reports, 8, 954-962. https://doi.org/10.3892/mmr.2013.1587
MLA
Zhang, C., Wang, Y., Chen, H., Yang, G., Wang, S., Jiang, M., Cong, L., Yuan, L., Li, H., Jia, Y."Protective effect of the herbal medicine Gan‑fu‑kang against carbon tetrachloride‑induced liver fibrosis in rats". Molecular Medicine Reports 8.3 (2013): 954-962.
Chicago
Zhang, C., Wang, Y., Chen, H., Yang, G., Wang, S., Jiang, M., Cong, L., Yuan, L., Li, H., Jia, Y."Protective effect of the herbal medicine Gan‑fu‑kang against carbon tetrachloride‑induced liver fibrosis in rats". Molecular Medicine Reports 8, no. 3 (2013): 954-962. https://doi.org/10.3892/mmr.2013.1587
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team