This article is mentioned in:

Introduction

Liver fibrosis is a wound-healing process involving the activation of hepatic stellate cells (HSCs) and an increased deposition of extracellular matrix (ECM) components, including type I/III collagen, metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) (1,2). HSCs play pivotal roles in fibrogenesis in the liver (3,4). Following injury, HSCs are activated and undergo complex transdifferentiation, leading to increased proliferation, migration and contraction and a shift towards synthesis and deposition of ECM materials, contributing to scar formation and eventually cirrhosis (5–7). A characteristic feature of activated HSCs is the activation of several cytokine mediators, including transforming growth factor-β (TGF-β), platelet derived growth factor (PDGF) and angiotensin (8–10). Therefore, investigation of signaling pathways and identification of the potential therapeutic targets is extremely important.

Previous studies have demonstrated the ability of natural drugs to prevent the development of liver fibrosis (11,12). Gan-fu-kang (GFK) is a traditional Chinese prescription herb complex that contains Salvia miltiorrhiza (Labiatae), milkvetch root (Leguminosae) and Angelica (Umbelliferae). Salvia miltiorrhiza plays an integral role in liver fibrosis by activating the circulation to remove blood stasis. In traditional Chinese medicine, milkvetch root is considered to supplement qi and provide body fluids, while Angelica replenishes blood. GFK is commonly used to treat human liver fibrosis induced by alcohol abuse and hepatitis, and has been demonstrated to induce protective and therapeutic effects to reverse liver fibrosis (13,14).

The Wnt genes comprise a highly conserved family of secreted, hydrophobic glycoproteins that play a crucial role in regulating embryonic development, cellular differentiation and proliferation and polarity (15–17). Abnormal regulation of Wnt/β-catenin signaling has been implicated in tumorigenesis and in the pathogenesis of a number of human diseases of diverse tissues (18–20). Once activated, it may activate downstream target genes, including c-jun, cyclinD1 and PPAR-γ, which in turn may promote the deposition of ECM and proliferation of HSC (21–23).

It has previously been reported that Wnt signaling may serve as the common downstream mediator of fibrogenic effects rendered by TGF-β, PDGF and other factors (24). Previous observations have indicated that GFK inhibits TGF-β and MAPK/AP-1 pathways, thus providing a hepatoprotective effect (13,14,25). Therefore, it was hypothesized that GFK exerts an antifibrotic effect by mediating the Wnt/β-catenin signaling pathway. The present study aimed to investigate the effects of GFK treatment on the Wnt/β-catenin signaling pathway.

Materials and methods

Herbal medicine

GFK is a traditional Chinese herbal formula containing Salvia miltiorrhiza, milkvetch root and Angelica. The crude drug was purchased from Dalian Medical University (Dalian, China) and extracted by the Department of Pathophysiology. The herbal decoction was stored at −20°C.

Animals

Adult Sprague-Dawley (SD) rats (1:1, male:female; 180–200 g) were purchased from the Experimental Animal Center of Dalian Medical University, [confirmation no., SCXK (Liao) 2004-0017]. All rats were fed with a standard pellet diet and tap water was available ad libitum during the experimental trial. The animals were maintained in an air-conditioned room at 20°C under a 12-h light/dark cycle. All experiments were in strict accordance with the principle and guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals (26). The study was approved by the Ethics Committee of Dalian Medical University, Dalian, Liaoning, China

Animal model and drug treatment

Following a one-week acclimation period, rats were randomly divided into 5 groups: control (n=12), carbon tetrachloride 4 (CCl4) model (n=8) and three GFK groups (n=11). Each group, with the exception of control, received CCl4 subcutaneously (0.5 mg/kg in a vehicle of olive oil, twice/week) for 8 weeks. Following CCl4 treatment, rats randomly received GFK per os (31.25, 312.5 and 3,125 mg/kg/day) or vehicle between weeks 9 and 20. The control group received saline between weeks 1 and 20. All rats were sacrificed at the end of week 20. Blood and liver samples were obtained for further examination.

Plasma assay for liver enzymes and fibrotic markers in serum

Plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured using commercial test reagents (Nanjing Jiancheng Bio, Nanjing, China). The concentrations of serum hyaluronic acid (HA), laminin (LN), procollagen type III (PCIII) and collagen type IV (CIV) were measured by radioimmunoassay kits provided by the General Hospital of People’s Liberation Army (Beijing, China). The tests were performed according to the manufacturer’s instructions (Purevalley Biotech, Beijing, China).

Histopathological evaluation

Tissue samples were fixed in 10% formalin, embedded in paraffin and processed by routine histological procedures. Following this, 4–5-μm-thick sections were stained with hematoxylin and eosin (H&E) and picrosirius red staining. Sections were observed by light and polarizing microscopy, respectively. Fibrosis of H&E staining was graded as described previously (27): 0, normal liver without hyperplasia of collagenous fibers; I, slight extension of collagenous fibers from portal area or central veins; II, marked extension of collagenous fibers, without connecting each other and encysting the whole hepatic lobules; III, marked extension of collagenous fibers, connecting each other and encysting the whole hepatic lobules; IV, hepatic lobules are encysted and separated by collagenous fibers. The normal structure of hepatic lobules is destroyed. The pseudolobules are formed and it is dominated by large square pseudolobuli; V, structure of hepatic lobules is fully destroyed and large square and small round pseudolobules occupy 50%; VI, small round hepatic lobuli occupy almost the whole liver and the hyperplatic thick collagenous fibers are visible. All histological analysis was assigned by independent certified pathologists in a blind manner. Each sample was observed at magnifications of ×400 and ×200 and at least 10 fields of view were scored per liver slice to obtain the mean value.

Immunohistochemistry

Liver tissue sections were deparaffinized and hydrated in a graded alcohol series and washed in water. Antigens were retrieved in a pressure cooker in citrate buffer (pH 6.0) for 5 min at 1.0 kPa and non-specific binding was blocked in 5% BSA. Sections were sequentially incubated with one of the following primary antibodies overnight at 4°C: rat polyclonal anti-Tcf-4 (1:150), anti-α-smooth muscle actin (α-SMA; 1:200; both BIOS, Beijing Biosynthesis Biotechnology Co. Ltd., Beijing, China)and anti-β-catenin (1:150; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). The Vectastain ABC kit was used to obtain the final stain and diaminobenzidine (DAB) was used as the chromogen. The slides were counterstained with hematoxylin. Negative controls were obtained by omitting the primary antibody. A minimum of five random fields per liver section was detected at magnification ×400 and the semi-quantitative evaluations were assigned by the Image-pro-plus (Media Cybernetics Inc., Rockville, MD, USA).

Western blotting

Total and nuclear proteins were prepared according to standard instructions (28) and the concentration was estimated by a Bradford assay with BSA as standard. The primary antibodies, β-catenin (1:200), β-actin (1:1,000) and Histone H1 (1:200; all Santa Cruz Biotechnology, Inc.), α-SMA (1:400), TIMP-1 (1:300) and collagen I (1:200; all BIOS) were used. Equal amounts of protein (50 μg/lane) were separated by electrophoresis on a 10–12% SDS-polyacrylamide gel, transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA) and blocked with 5% skimmed milk. The first antibodies were incubated overnight at 4°C and then appropriate secondary antibodies were added. Proteins were visualized by enhanced chemiluminescence detection (Santa Cruz Biotechnology, Inc.) as reported. Densitometric scanning was performed using the UVP Bioimaging Systems with Labwork 4.6 (UVP, LLC, Upland, CA, USA) to determine the band intensities. All experiments were repeated five times.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted from rat liver samples using TRIzol reagent according to the manufacturer’s instructions (Invitrogen Life Technologies, Carlsbad, CA, USA). cDNA templates were prepared using oligo(dT) random primers, and Quant reverse transcriptase and the Taq DNA polymerase kit were used for PCR (Tiangen Biotech, Beijing, China) with β-actin as a control. Primer set sequences are presented in Table I. To evaluate the amplification, electrophoresis of PCR products was performed using 2% agarose gels containing ethidium bromide and then quantified using the UVP Bioimaging Systems.

Table I Primer sequences and amplicon sizes.

Table I

Primer sequences and amplicon sizes.

Gene	Sequence (5′-3′)	Amplicon length, bp
Wnt1	Forward: GAAACCGCCGCTGGAACT Reverse: CCCTGCCTCGTTATTGTGAAG	326
Wnt3a	Forward: GCAGTTGCGAAGTGAAGACC Reverse: TGTGGGCACCTTGAAGTATGT	173
Wnt10b	Forward: TCTCCTGTTCTTGGCTTTGTT Reverse: TCTAGTGCCGAGCAGTTCC	246
Frizzled-1	Forward: AAGTTCTTCCTGTGCTCCATGT Reverse: CTCCCCCAGAAAGTGATAGTTG	384
Frizzled-2	Forward: CCTGGAGGTGCATCAATTCTAC Reverse: CGCTCACCCAGAAACTTATAGC	447
GSK-3β	Forward: TACCTTAACCTGGTGCTGGACT Reverse: TGTTGGTGTTCCTAGGACCTTT	453
β-catenin	Forward: GATTAACTATCAGGATGACGCG Reverse: TCCATCCCTTCCTGCTTAGTC	780
Tcf-4	Forward: GCACTTACCAGCTGACGTAGAC Reverse: GGGCTAGCTCGTAGTACTTTGC	557
PPAR-γ	Forward: TGTGGACCTCTCTGTGATGG Reverse: CATTGGGTCAGCTCTTGTGA	127
Cyclin D1	Forward: TGTTCGTGGCCTCTAAGATG Reverse: ACTCCAGAAGGGCTTCAATC	450
α-SMA	Forward: TGTGCTGGACTCTGGAGATG Reverse: GATCACCTGCCCATCAGG	291
Collagen I	Forward: TGCCGTGACCTCAAGATGTG Reverse: CACAAGCGTGCT	461
Collagen III	Forward: AGATCATGTCTTGACTCAAGTC Reverse: TTTACATTGCCATTGGCCTGA	463
MMP-2	Forward: GTGGACAAACTGAGCGAA Reverse: AGGTAGGGTACATCACAGAA	541
TIMP-1	Forward: GCCATGGAGAGCCTCTGTGG Reverse: GCAGGCAGGCAAAGTGATCG	356
β-actin	Forward: GGTATGGGTCAGAAGGACTCC Reverse: TGATCTTCATGGTGCTAGGAGCC	847

[i] MMP, matrix metalloproteinase; TIMP-1, tissue inhibitor of metalloproteinase-1; α-SMA, α-smooth muscle actin.

Statistical analysis

Statistical analysis was performed using SPSS 11.5 software (SPSS, Inc., Chicago, IL, USA). All numerical data represent at least three independent experiments and are expressed as the mean ± SD. Comparison between groups was performed using a two-tailed Student’s t-test. Pearson was employed for correlation analysis of parameters. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of GFK on plasma hepatic enzyme and fibrotic markers in serum

Plasma ALT and AST increased significantly in CCl4 rats compared with the controls (P<0.01). Administration of GFK (3,125 and 312.5 mg/kg/day) significantly decreased ALT and AST levels (P<0.01; Fig. 1). Similarly, in the CCl4 group, serum markers of HA, LN, PCIII and CIV were increased (P<0.05) and GFK (312.5 and 3,125 mg/kg/day) treatment significantly blocked CCl4-induced elevation of these markers (Table II).

Figure 1 Serum levels of ALT and AST activities. Results are expressed as the mean ± SD. **P<0.01, vs control; ##P<0.01, vs model. ALT, alanine aminotransferase; AST, aspartate aminotransferase.

Table II Levels of HA, LN, PCIII and CIV.

Table II

Levels of HA, LN, PCIII and CIV.

Group	Dose (mg/kg)	HA	LN	PCIII	CIV
Control		58.96±4.51	10.36±2.56	16.63±3.54	77.83±11.44
Model		151.99±8.23a	32.33±3.28a	43.83±8.33a	155.85±25.09a
GFK	3125.00	84.23±4.91a,b	17.05±2.92a,b	26.41±3.21a,b	94.99±9.010a,b
GFK	312.50	60.01±5.78b	11.18±2.15b	17.13±4.06b	78.21±6.820b
GFK	31.25	88.71±4.47a,b	18.56±2.30a,b	25.27±5.15a,b	100.23±11.67a,b

a P<0.05, vs. control;

b P<0.05, vs. CCl4 model.

{ label (or @symbol) needed for fn[@id='tfn4-mmr-08-03-0954'] } GFK, Gan-fu-kang; HA, hyaluranic acid; LN, lamin; PCIII, procollagen type III, CIV collagen type IV; CCl₄, carbon tetrachloride 4.

Histopathological changes

Liver histopathological examination of the control group revealed a normal lobular architecture with central veins and radiating hepatic cords (Fig. 2A and B). In the CCl4-treated group, marked changes were observed in liver morphology, including steatosis, ballooning, necrosis and inflammatory infiltration (Fig. 2C). Picrosirius red staining revealed severe collagen deposition (Fig. 2D). By contrast, GFK treatment significantly alleviated the degree of liver fibrosis and ductular proliferation (Fig. 2E–H). The antifibrotic effect was less marked in GFK (31.25 mg/kg/day; Fig. 2I and J). The average scores for the degree of liver damage are presented in Table III.

Figure 2 Photomicrographs of rat liver tissues. (A,C,E,G and I) Sections were stained with H&E (magnification, ×400). (B,D,F,H and J) Sections were stained by picrosirius red and observed under polarizing microscope to assess the presence of collagen. Collagen I was red and III was green (magnification, ×200). (A and B) Control, no histological abnormalities; (C and D) CCl4 model, fatty degeneration, necrosis, infiltration of inflammatory cells, formation of fibrotic septa and increased collagen deposition; (E,F,G and H) GFK (3,125 and 312.5 mg/kg/day), the degree of liver damage and fibrosis was markedly reduced and revealed less collagen deposition, particularly collagen type I; (I and J) GFK (31.25mg/kg/day), less statosis and inflammatory cells compared with the model group. HE, hematoxylin-eosin; GFK, Gan-fu-kang.

Table III Effect of GFK on the pathological grading of liver fibrosis induced by CCl4.

Table III

Effect of GFK on the pathological grading of liver fibrosis induced by CCl4.

Group	Dose (mg/kg)	n	Degree of liver fibrosis							P-value
			0	I	II	III	IV	V	VI
Control		12	12	0	0	0	0	0	0
Model		7	0	0	1	1	2	3	0	a
GFK	3125.00	11	0	3	4	3	1	0	0	b
GFK	312.50	11	0	4	7	0	0	0	0	b
GFK	31.25	11	0	1	5	2	3	0	0	b

a P<0.01, vs. control;

b P<0.05, vs. CCl₄ model.

{ label (or @symbol) needed for fn[@id='tfn7-mmr-08-03-0954'] } GFK, Gan-fu-kang; CCl₄, carbon tetrachloride 4.

Effect of GFK on α-SMA, collagen I, collagen III, MMP-2 and TIMP-1

To identify HSCs in the liver, immunohistochemistry was used to detect the expression of α-SMA, a marker of activated hepatic stellate cells. In the control group, α-SMA was predominantly located in the blood vessel wall, while in the model group, markedly higher expression of α-SMA was found in the portal area, fibrous septum and space of Disse (P<0.01). α-SMA-positive cells were reduced markedly in rats receiving GFK treatment (Fig. 3).

Figure 3 Immunohistochemistry against α-SMA in rat liver tissues. Representative micrographs demonstrate α-SMA protein localization in different groups as indicated (magnification, ×400). α-SMA, α-smooth muscle actin.

RT-PCR results revealed that α-SMA, collagen I, collagen III, MMP-2 and TIMP-1 mRNA levels increased significantly in CCl4-treated rats and was inhibited by GFK, with similar levels compared with control animals. Treatment with GFK at 312.5 mg/kg/day was more effective than treatment with GFK at 3,125 and 31.25 mg/kg/day (Fig. 4A). Western blot analysis revealed a significant increase in α-SMA, TIMP-1 and collagen I levels in the model group. These effects were markedly reduced by GFK. Response to GFK at 312.5 mg/kg/day was markedly higher compared with GFK at 3,125 and 31.25 mg/kg/day (Fig. 4B).

Figure 4 Effect of GFK on the expression of α-SMA, collagen I, collagen III, MMP-2 and TIMP-1 in liver fibrosis. (A) Representative RT-PCR analysis and quantification demonstrate that GFKa treatment suppressed the expression of α-SMA, collagen I, collagen III, MMP-2 and TIMP-1 mRNA in liver fibrosis induced by CCl4. (B) Representative western blot analysis and quantitative data indicate that treatment with GFK suppressed the expression of α-SMA, TIMP-1 and collagen protein I in liver fibrosis induced by CCl4. Lane 1, control; 2, model; 3, GFK (3,125 mg/kg); 4, GFK (312.5 mg/kg); and 5, GFK (31.25 mg/kg). *P<0.01, vs control; #P<0.01, vs model. α-SMA, α-smooth muscle actin; MMP-2, matrix metalloproteinase-2; TIMP-1, tissue inhibitor of metalloproteinase-1; RT-PCR, reverse transcription-polymerase chain reaction; GFK, Gan-fu-kang.

Effect of GFK on expression of genes involved in the Wnt/β-catenin signaling pathway

RT-PCR analysis was used to assess the expression of canonical Wnt genes (Wnt1, Wnt3a and Wnt10b), receptors (Fzd1 and 2), downstream target (GSK3β), substrate (β-catenin) and transcriptional regulator (Tcf-4) in the different groups. In the CCl4 treatment group, with the exception of GSK3β, mRNA levels of Wnt1, Wnt3a, Wnt10b, Fzd1, Fzd2 and β-catenin were higher, while in the GFK groups, expression was lower (Fig. 5A).

Figure 5 Effect of GFK on Wnt/β-catenin signaling pathway genes. (A) Effect of GFK on the mRNA expression of genes in the Wnt/β-catenin signaling pathway. Left, expression of associated genes in the Wnt/β-catenin signaling pathway and right, densitometric analysis of the results. (B) Effect of GFK on nuclear translocation of β-catenin in rat livers. GFK treatment interferes with the localization of β-catenin protein. Densitometric analysis of each band.(C) Immunohistochemistry against β-catenin and Tcf-4 proteins in rat liver sections (magnification, ×400). Brown indicates specific Ab reactivity. In the CCl4 group, β-catenin and Tcf-4 were markedly upregulated revealing positive staining at the fibrotic septa and downregulated in the GFK (312.5 mg/kg) group. Lane 1, control; 2, model; 3, GFK (3,125 mg/kg); 4, GFK (312.5 mg/kg); and 5, GFK (31.25 mg/kg). *P<0.01, vs. control; #P<0.05, vs. model. GFK, Gan-fu-kang; CCl4,carbon tetrachloride 4.

Activation of canonical Wnt signaling results in constitutive stabilization of the free pool of β-catenin, which travels to the nucleus and binds to Tcf/LEF. The complex modulates transcription of target genes. Therefore, levels of total β-catenin and nuclear accumulation of β-catenin in extracts of liver tissue were examined. Western blot analysis revealed increased accumulation of total β-catenin protein and translocation of β-catenin into the cell nucleus in the CCl4-treated group (Fig. 5B). Downregulation of β-catenin in the nucleus and whole cell lysates was observed following treatment with GFK (Fig. 5B).

In the model group, immunohistochemistry revealed enhanced β-catenin expression in the cytoplasm and clear nuclear staining was observed in single cells. β-catenin expression was attenuated by GFK prevention treatment (Fig. 5C). A significant increase in positive staining of Tcf-4 cells was observed in rats following CCl4 treatment. These changes were attenuated following administration of GFK (Fig. 5C).

Effect of GFK on Wnt/β-catenin target gene expression

mRNA levels of the putative target gene, cyclin D1, were significantly elevated in rats with liver fibrosis and were reduced by GFK treatment. By contrast, expression of PPAR-γ mRNA had an adverse result. The effects induced by GFK (312.5 mg/kg/day) were significantly increased when compared with GFK-treated animals (3,125 and 31.25 mg/kg/day; Fig. 6).

Figure 6 Effect of GFK on the expression of cyclinD1 and PPAR-γ on CCl4-injured liver fibrosis. RT-PCR analysis and quantification indicate induction of cyclin D1 in the fibrotic liver and reveals that GFK administration significantly decreased expression of cyclin D1; PPAR-γ mRNA had an adverse result. Lane 1, control; 2, model; 3, GFK (3,125 mg/kg); 4, GFK (312.5 mg/kg); and 5, GFK (31.25 mg/kg). *P<0.01, vs. control; #P<0.01, vs. model. GFK, Gan-fu-kang; RT-PCR, reverse transcription-polymerase chain reaction; CCl4,carbon tetrachloride 4.

Correlation analysis among Wnt3a, Wnt10b, β-catenin, Tcf-4, α-SMA, TIMP-1, collagen I and collagen III levels

Correlation analysis demonstrated that Wnt3a, Wnt10b, β-catenin and Tcf-4 significantly correlated with the following measures: α-SMA, TIMP-1, collagen I and collagen III (P<0.05 or P<0.01; Table IV).

Table IV Correlation analysis in the model and GFK (312.5 mg/kg) groups.

Table IV

Correlation analysis in the model and GFK (312.5 mg/kg) groups.

	α-SMA		TIMP-1		Collagen I		Collagen III
	r	P-value	r	P-value	r	P-value	r	P-value
Wnt3a	0.958	<0.05	0.889	<0.05	0.980	<0.01	0.993	<0.01
Wnt10b	0.993	<0.01	0.896	<0.05	0.976	<0.01	0.962	<0.01
β-catenin	0.963	<0.05	0.921	<0.01	0.980	<0.01	0.980	<0.01
Tcf-4	0.880	<0.05	-	-	0.815	<0.05	0.892	<0.05

[i] Values are presented as correlation coefficients (r) and significant levels (P). GFK, Gan-fu-kang; TIMP-1, tissue inhibitors of metalloproteinase 1.

Discussion

Chronic injuries to the liver lead to liver fibrosis and subsequent cirrhosis and even hepatocellular carcinoma, and are associated with elevated mortality rates worldwide (29–31). Liver fibrosis is a dynamic process involving increased deposition of ECM components, particularly collagens (32,33). Since there is not an effective treatment approach for irreversible cirrhosis, new potent agents for the treatment of liver fibrosis are required. Medicinally, traditional Chinese herbs have made a significant contribution to the treatment of liver fibrosis (34). The present study revealed that GFK, a traditional Chinese medicine formula, induces a protective effect against CCl4-induced liver fibrosis in rats.

Activities of serum ALT and AST are conventionally used as biochemical makers to assess liver injury (35,36) and in the present study, CCl4 injection resulted in a significant elevation of serum ALT and AST. Administration of GFK (312.5 and 3,125 mg/kg/day) markedly attenuated the increased activities of serum ALT and AST, which indicated that GFK has potent hepatoprotective effects. HA, LN, PCIII and CIV, which are used as indices for the extent of liver fibrosis, were also investigated (37). Observations revealed a significant reduction in these biomarker levels following treatment with GFK. Therefore, we hypothesized that GFK exerts a therapeutic effect on liver fibrotic rats induced by CCl4, and the repressive effect of GFK at 312.5 mg/kg/day is superior to that of GFK at 3,125 and 31.25 mg/kg/day.

Activation and proliferation of HSCs plays a pivotal role in liver fibrogenesis. When activated, HSCs undergo phenotypic transformation between a quiescent cell and myofibrolast-like cell and drive fibrogenesis by synthesizing and releasing α-SMA filaments and ECM, including type I and III collagens (38,39). α-SMA, a characteristic cytoskeletal protein, is considered a marker of activated HSCs. Collagens are the main components of the ECM, primarily composed of collagen I and III, which account for 95% of the total collagen in fibrotic liver. The present study revealed an antifibrogenesis effect caused by GFK decreasing the expression of α-SMA, collagen I and III in CCl4-treated animals. This observation was further supported by histological observations. Results of α-SMA immunostaining confirmed that the activity of HSCs in GFK therapeutic rats was markedly less than in CCl4-treated rats.

The outcome of fibrogenesis is the accumulation and degradation of ECM, which is regulated by a family of zinc-dependent enzymes, MMPs, and their inhibitors, TIMPs (40). MMP-2 is produced by activated HSCs and is considered to be important for remodeling of the basement membrane during tissue repair (41). TIMP-1 is an inhibiting factor of MMPs and previous studies have revealed that TIMP-1 not only inhibits collagenase activity, but also inhibits MMPs and stromelysin activity (42,43). The present study revealed that rats receiving CCl4 exhibited elevated MMP-2 and TIMP-1 expression, while this effect was abrogated by GFK treatment. These results indicate that GFK may regulate the balance between MMPs and TIMPs.

Wnt signaling via β-catenin is implicated in embryonic development and tissue homeostasis (22). Consequently, mutations in the Wnt signaling pathway are often associated with a number of genetic defects, cancer and other diseases (44). Previous studies have demonstrated that the activation of the Wnt pathway results in fibrogenic conversion of numerous tissues, including lung, kidney and muscle (45–49). Previously, HSCs were reported to exhibit upregulation of the Wnt signaling pathway in vitro and several inhibitors were found to antagonize or modulate this pathway in these cells (50,51). In addition, the Wnt/β-catenin pathway has been reported to maintain the inactivity stage of HSCs (52). The present study was designed to determine whether the Wnt/β-catenin signaling pathway is involved in fibrosis and to investigate the antifibrotic effect of GFK in vivo using CCl4-induced liver fibrosis in SD rats. The observations revealed that expression of Wnt and their corresponding Fzd receptor genes increased in the fibrotic liver, indicating that the response of canonical Wnt proteins and receptors is consistent with the damage of CCl4. In the present study, it was demonstrated that expression of GSK3β was downregulated and its effector, β-catenin, was upregulated. These changes indicated that the Wnt signaling was in an active state. In agreement, mRNA and protein levels increased and were mainly distributed in the cell plasma and nuclei, revealing that the Wnt/β-catenin pathway was activated. Following this, Tcf-4 was found to be a key partner for β-catenin at the protein level via western blot analysis and immunohistochemistry. This observation revealed a correlation between upregulation and increasing mRNA levels, localized predominantly at the nuclei of hepatic cells. These observations are consistent with a previous study in which the formation of β-catenin/Tcf-4 complex was reported to be essential for the Wnt signaling cascade (53). The changes were reversed following GFK treatment.

The ultimate effect of the Wnt/β-catenin pathway is the regulation of downstream target genes. Therefore, two putative target genes, cyclin D1 and PPAR-γ, in fibrotic liver were investigated. Cyclin D1 is a pivotal member of the cyclin family and is widely considered to control cell proliferation and differentiation via induction of cell entry into the S-phase and G2/M-phase (54). Overexpression of cyclin D1 is involved in HSC proliferation in rat liver (55). The upregulation of cyclinD1 in fibrotic liver and its downregulation following treatment with GFK was observed, indicating that its activation may be essential for the evolution of liver fibrosis. The Wnt/β-catenin pathway is known to expand in liver fibrosis, mainly due to an additional target, PPAR-γ. PPAR-γ is a member of the nuclear receptor family and is capable of stimulating adipocyte differentiation, regulating lipid metabolism, activating insulin, inhibiting cell proliferation and inducing apoptosis (56). A previous study revealed that treatment with PPAR-γ ligands blocks liver fibrosis in animal models (57). The present study demonstrated that the Wnt/β-catenin signaling may suppress PPAR-γ activity and GFK treatment may upregulate the amplification of PPAR-γ. This is consistent with the observation that PPAR-γ may conversely inhibit Wnt/β-catenin signaling by promoting the degradation of β-catenin (58,59). A number of other transcription factors may be involved in the modulation of Wnt target genes, thus this area requires further investigation.

Correlation analysis revealed that the expression of α-SMA, TIMP-1, collagen I and collagen III closely correlate with the abundance of the associated factors, Wnt3a, Wnt10b, β-catenin and Tcf-4, in the Wnt/β-catenin signaling pathway.

In summary, the present study indicates that the herbal medicine GFK prevents CCl4-induced rat liver fibrosis and that this action may be caused, in part, by its depressing effect on the canonical Wnt/β-catenin pathway. Therefore, GFK represents a potential therapeutic strategy for improving liver fibrosis. Further investigation is required to specify how/which components of GFK exert antifibrotic functions and its exact role in various liver cell types.

Acknowledgements

The authors thank Dr Joel Tatenda Mafemba for valuable proofreading of the manuscript. This study was financially supported by the Natural Science Foundation of Liaoning Province, China (201102055).

References