Euphol arrests breast cancer cells at the G1 phase through the modulation of cyclin D1, p21 and p27 expression

  • Authors:
    • Lin Wang
    • Guiying Wang
    • Dandan Yang
    • Xudong Guo
    • Yanxin Xu
    • Bo Feng
    • Jiuhong Kang
  • View Affiliations

  • Published online on: August 22, 2013     https://doi.org/10.3892/mmr.2013.1650
  • Pages: 1279-1285
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Euphorbia tirucalli is a long‑established treatment for a wide variety of cancers. However, the mechanism of its anticancer effect is yet to be elucidated. In the present study, we examined the anticancer effect of euphol, a tetracyclic triterpene alcohol isolated from the sap of Euphorbia tirucalli, in T47D human breast cancer cells. Following the treatment of cells with different doses of euphol for 24, 48 and 72 h, the cell proliferation, cell cycle, and mRNA and protein levels of cell cycle regulatory molecules were analyzed, respectively. Treatment of the cells with euphol resulted in decreased cell viability, which was accompanied by an accumulation of cells in the G1 phase. Further studies demonstrated that euphol treatment downregulated cyclin D1 expression and the hypophosphorylation of Rb. Furthermore, this effect was correlated with the downregulation of cyclin‑dependent kinase 2 (CDK2) expression and the upregulation of the CDK inhibitors p21 and p27. Reduced expression levels of cyclin A and B1 were also observed, corresponding to the decreased distribution of cells in the S and G2/M phases, respectively. These findings indicated that euphol is an active agent in Euphorbia tirucalli that exerts anticancer activity by arresting the cell cycle of cancer cells.

Introduction

Breast cancer is one of the most common types of cancer with >1,300,000 cases and 450,000 mortalities annually worldwide (1). Although fatalities due to breast cancer are decreasing, breast cancer remains the second leading cause of cancer-related mortality among females (2,3). Regardless of surgical removal of the primary tumor, relapse may occur within a few months to >40 years following the presentation of the initial symptoms, and ≥15% of all patients ultimately develop an incurable form of the disease (3). This highlights the requirement for therapies that are able to treat the advanced stages of the disease. Traditional cytotoxic therapy kills neoplastic cells by multiple mechanisms, which also effect normal healthy cells. The non-specificity of these agents produces undesirable side effects, including short term (myelosuppression) and long term (cardiomyopathy and acute leukemia) toxicities (4).

Improvement in the understanding of the molecular mechanisms involved in cancer has led to the identification of novel targets and the development of specific therapies, which are referred to as targeted therapies. Targeted therapies have a high specificity for the molecules involved in the key molecular events responsible for the cancer phenotype (5). Among which, the cell cycle is a promising target involved in cancer growth, as a key characteristic of human breast cancer and other types of cancer is enhanced and deregulated cell cycle activity leading to unrestricted cell growth (6,7).

Medicinal plants have been used worldwide and have been demonstrated to be a source of effective anticancer agents (8). Euphorbia tirucalli, belonging to the family Euphorbiaceae, is a subtropical and tropical ornamental plant. It has a long history of traditional use as a remedy for a variety of conditions, including rheumatism, neuralgia, asthma, catarrh, earache, sarcoma and cancer (911). The tetracyclic triterpene alcohol, euphol, is the main constituent in the sap of Euphorbia tirucalli and the biological profiles have evoked investigation to elucidate its potential properties.

Previous studies have demonstrated that euphol exerts antiviral effects by inhibiting reverse transcriptase in purified human immunodeficiency virus type 1 (12) and inhibiting the Epstein-Barr virus early antigen activation induced by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) (13). The anti-inflammatory effects of euphol have been demonstrated to be associated with the inhibition of the activation of nuclear factor-κB (14), downregulation of tumor necrosis factor-α and cyclooxygenase-2 (15), inhibition of the T cell-mediated immune response (15), and the reduction of protein kinase C/extracellular signal-regulated protein kinase signaling activation (16). In addition to the antiviral and anti-inflammatory effects, the antitumor effects of euphol have also been observed. Topical application of euphol was demonstrated to suppress tumor promotion by TPA in mouse skin initiated with 7,12-dimethylbenz(a)anthracene (17). However, the underlying mechanisms involved in the antitumor effect remain to be elucidated.

In the present study, euphol was observed to inhibit the expression of cyclin D1, cyclin A, cyclin B1 and cyclin-dependent kinase 2 (CDK2), decrease the phosphorylation of retinoblastoma (Rb), induce the expression of cyclin-dependent kinase inhibitors (CKI) p21 and p27, and lead to the G1 arrest and proliferation inhibition of T47D cells. These data provide an insight into the anticancer effects of euphol in breast cancer cells.

Materials and methods

Drugs and antibodies

Euphol was provided by Dr HB Wang (School of Life Science and Technology, Tongji University, Shanghai, China) and was stored at 4°C. Stock solutions of euphol were prepared at a concentration of 100 mM in dimethyl sulfoxide (DMSO). Further dilutions were immediately prepared prior to each experiment and not exceeding 0.3% DMSO (v/v) in the culture media. Control cells were treated with the same quantity of DMSO as used in the corresponding treatment. The following primary antibodies were used for western blot analysis: Human cyclin A, CDK2, Rb, phosphorylated (p)-Rb (Bioworld Technology Co., Ltd., St. Louis Park, MN, USA); cyclin B1, cyclin D1, cyclin E, p27 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA); p21 (Abcam, Cambridge, MA, USA) and glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnology, Inc.).

Cell lines and culture

The T47D breast cancer cell line was purchased from Cell Bank Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI-1640 culture medium (Thermo Fisher Scientific, Shanghai, China) supplemented with 10% fetal bovine serum (Biochrom, AG, Berlin, Germany), 100 U/ml penicillin (Gibco-BRL, Grand Island, NY, USA) and 100 μg/ml streptomycin (Gibco-BRL) in an incubator at 37°C in a 5% CO2 humidified atmosphere.

Cell proliferation assay

Cell proliferation was determined by a methyl-thiazol tetrazolium (MTT) assay. Cells were seeded at a density of 5×103 cells/well in 96-well plates and treated with euphol at the indicated concentrations. Following 24, 48 and 72 h incubation, 20 μl sterile MTT (5 mg/ml, Sigma-Aldrich, St. Louis, MO, USA) were added to each well. Subsequent to incubation at 37°C for 4 h, 150 μl DMSO was added to solubilize the MTT-formazan product and mixed thoroughly. The spectrometric absorbance at 490 nm was measured with an enzyme immunoassay analyzer (FlexStation 3TM; Molecular Devices, Sunnyvale, CA, USA). Percentage cell survival was calculated using the optical density as follows: % cell survival = (absorbance of treated cells/absorbance of cells with vehicle solvent) × 100. The half inhibitory concentration (IC50) values, defined as the concentration of drug that caused 50% inhibition of absorbance compared with the control cells, were calculated from the dose-response curve obtained by plotting percentage of cell survival versus the concentration of euphol.

Flow cytometry analysis for cell cycle distribution

To determine the effect of euphol on the cell cycle, fluorescence-activated cell sorting (FACS) analysis was conducted. Cells (3.5×105, 4.5×105 and 6×105/well) were seeded in 6-well plates and treated with the indicated euphol concentrations for 24, 48 and 72 h, respectively. Attached cells were harvested at the indicated time points, washed in phosphate-buffered saline, fixed in ice-cold ethanol (75%) and stored at −20°C. For analysis, fixed cells were stained with propidium iodide (0.05 mg/ml) containing RNase (0.2 mg/ml) for 1 h at room temperature in the dark. FACS analysis was performed using the Guava EasyCyte™ 8HT (Millipore, Billerica, MA, USA) and data were analyzed using the FlowJo software program (Treestar Inc., Ashland, OR, USA). Percentages of cell populations distributed in the various phases of the cell cycle (sub-G1, G0/G1, S and G2/M) were calculated.

qPCR

Total RNA was isolated using the RNAiso Plus (Takara Bio Inc., Shiga, Japan), and the first strand of cDNA synthesis was performed using the TianScript RT kit (Tiangen Biotech, Co., Ltd., Beijing, China) and the Oligo(dT)15 primer from 2 μg total RNA, according to the manufacturer’s instructions. The mRNA levels were observed by quantitative PCR with SYBR® Premix Ex Taq™ II (Takara Biotechnology Co., Ltd., Dalian, China) and primers, as listed in Table I, using the Mx3000P qPCR System (Agilent Technologies, Inc., Santa Clara, CA, USA). The relative expression level of each candidate gene was calculated by the 2−ΔΔCt method (18), using β-actin as the internal normalized control with the same calibrator. Each experiment was performed independently and in triplicate.

Table I

Primer sequences of target genes for qPCR analysis.

Table I

Primer sequences of target genes for qPCR analysis.

GeneForward primerReverse primer
cyclin A2 AGACCTACCTCAAAGCACCACAG GGTTGAGGAGAGAAACACCATGA
cyclin B1 TGGATAATGGTGAATGGACACCAA GCCAGGTGCTGCATAACTGGA
cyclin D1 CTGTGCATCTACACCGACAACTC AGGTTCCACTTGAGCTTGTTCAC
cyclin E1 GCCAGCCTTGGGACAATAATG CTTGCACGTTGAGTTTGGGT
CDK1 TACATTTCCCAAATGGAAACCAG AATTCGTTTGGCTGGATCATAGA
CDK2 TGAAGATGGACGGAGCTTGTTAT CTTGGTCACATCCTGGAAGAAAG
CDC25 ACAGCTCCTCTCGTCATGAGAAC GGTCTCTTCAACACTGACCGAGT
p21 CGATGGAACTTCGACTTTGTCA GCACAAGGGTACAAGACAGTG
p27 GGTTAGCGGAGCAATGCG TCCACAGAACCGGCATTTG
β-actin GACCTGTACGCCAACACAG CTCAGGAGGAGCAATGATC

[i] CDK, cyclin dependent kinase.

Western blot analysis

Cells were homogenized with radio immunoprecipitation assay (RIPA) lysis buffer (Beyotime Biotech, Jiangsu, China), followed by sonication on Sonicators (Qsonica, Newton, CT, USA) at a frequency of 20 kHz and centrifugation at 13,800 × g for 10 min at 4°C. Subsequent to this the supernatant was harvested and the protein concentration measured using the Pierce BCA protein assay reagent (Pierce, Rockford, IL, USA). Following this, 20 μg protein was separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrotransferred to a nitrocellulose membrane (Whatman International Ltd., Germany). The membrane was blocked by incubation in 3% bovine serum albumin, fraction V (Life Sciences, Carlsbad, CA, USA) in TBST buffer (10 mM Tris-HCl, pH 7.6, 150 mM NaCl and 0.1% Tween 20) and incubated with the primary antibodies at 4°C overnight. The blot was washed with TBST buffer, incubated with the corresponding horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature and visualized by ImageQuant LAS 4000mini (GE Healthcare Life Sciences, Piscataway, NJ, USA).

Statistical analysis

Data were analyzed by a two-tailed Student’s t-test. Final values are presented as the mean ± standard error. P<0.05 was considered to indicate a statistically significant difference. P<0.05, P<0.01 and P<0.001 are denoted as *, ** or ***, respectively.

Results

Euphol inhibits cell proliferation

To evaluate the effect of euphol on breast cancer cell proliferation, the MTT assay was performed in T47D cells, an aggressive triple-positive breast cancer cell line. Briefly, exponentially growing T47D cells were treated with 0.01, 0.03, 0.1 and 0.3 mM euphol for 24, 48 and 72 h. With an increased concentration of euphol, the percentage of viable cells was significantly decreased, particularly following treatment with 0.03 mM euphol (Fig. 1A and B). The IC50 values of euphol treatment for 24, 48 and 72 h were 0.26, 0.22 and 0.13 mM, respectively (Fig. 1C). These data suggested that euphol markedly inhibited breast cancer cell proliferation.

Euphol induces cell cycle arrest

To investigate the functional mechanism of euphol in inhibiting cell growth, the effect of euphol on the regulation of the cell cycle in T47D cells was determined. Cells treated with euphol were stained with PI and analyzed by flow cytometry. Following 24 h of treatment, stability was observed in all cell cycle subpopulations, with a slight increase in the G0/G1 and a decrease in the S and G2/M populations treated with 0.3 mM euphol (Fig. 2A and D). Following 48 h incubation, euphol (0.3 mM) caused a redistribution of the cell cycle resulting in a significant increase of the G0/G1 sub-population from 59.63 to 71.41%, and a concomitant decrease in the G2/M subpopulation from 26.39 to 18.76% (Fig. 2B and D). At 72 h, a significant increase remained in the G0/G1 population to the detriment of the S and G2/M subpopulations in 0.3 mM euphol treatment (G0/G1: Control, 58.91%, 0.3 mM euphol, 71.44%; S: Control, 6.81%, 0.3 mM euphol, 2.57%; G2/M: Control, 31.08%, 0.3 mM euphol, 21.90%) (Fig. 2C and D). Notably, no significant changes were observed in the sub-G1 subpopulation at any indicated concentration or time point. The level remained low at 3.21, 4.68, and 3.24% for 24, 48 and 72 h at 0.3 mM euphol, respectively (Fig. 2A, 2B and 2C). These results indicated that euphol may inhibit cell proliferation by arresting the cells at the G0/G1 phase and preventing them from entering the S phase.

Euphol regulates transcription levels of cell cycle-associated genes

To elucidate whether the genes involved in the cell cycle redistribution were induced by euphol, the mRNA levels of cell cycle-associated genes were observed following treatment with euphol. Genes selected for analysis included cyclin A2, B1, D1 and E, cyclin-dependent kinase 1 (CDK1), CDK2, cell division cycle 25 and p21 and p27 (CKIs) The results of the qPCR analysis showed that incubation with euphol (0.3 mM), for 24, 48 and 72 h, significantly downregulated the mRNA levels of cyclin A2 and B1 (Fig. 3A). Furthermore, the mRNA levels of CDK1 and CDK2 were significantly reduced following treatment with euphol (0.03 mM) for 48 h (Fig. 3B). The mRNA levels of p21 were also significantly increased following treatment with euphol (0.03 mM) for 48 h (Fig. 3C).

Euphol regulates expression of cell cycle-associated proteins

To identify the proteins involved in euphol-induced cell cycle arrest, the effect of euphol on the protein levels involved in the cell cycle redistribution were determined. Whole-cell lysates were prepared following treatment with euphol for 48 or 72 h, and the expression levels of cyclin A, B1, D1 and E, as well as CDK2, p21, p27, Rb and p-Rb, were detected by western blot analysis (Fig. 4). Incubation with euphol (0.03 mM) for 48 h or 72 h reduced the expression of cyclin A, B1 and D; however, it increased the expression of p21 and p27. The expression of CDK2 decreased following treatment with euphol (0.03 mM) for 48 h. Furthermore, the level of p-Rb was decreased in response to euphol (0.03 mM) compared with that of the control cells despite the fact that the expression level of Rb was not significantly different between the two. These results suggested that the transcriptional downregulation of certain cyclins and the upregulation of p21 and p27 by euphol may have led to cell cycle arrest, and ultimately resulted in growth inhibition.

Discussion

Euphol is a tetracyclic triterpene alcohol isolated from the sap of Euphorbia tirucalli. It has been demonstrated to possess a wide variety of biological properties, including antimicrobial, anti-inflammatory and immunosuppressive actions. Yasukawa et al also demonstrated the involvement of euphol in the suppression of skin tumor formation (17). However, the exact mechanisms underlying the antitumor effects of euphol have not been fully elucidated. This study investigated the cytostatic effects of euphol on T47D breast cancer cells. According to the results, euphol induced cell cycle arrest at the G0/G1 phase, which resulted in growth inhibition. The arrest may have been mediated by the reduction of cyclin D1 and CDK2, as well as the induction of the CDK inhibitors p21 and p27, followed by the hypophosphorylation of Rb. Decreased cyclin A and B1 levels correlated with the lower cell counts in the S and G2/M phases.

Cyclin D1 is a member of a family of three closely associated D-type cyclins, D1, D2 and D3, which phosphorylate and inactivate Rb protein and promote progression through the G1-S phase of the cell cycle (19). High levels of cyclin D1 have been detected in numerous breast cancer cell lines through DNA amplification and/or cyclin D1 overexpression (20). This abnormality has been demonstrated to be important in tumorigenesis and to confer a poor prognosis in breast cancer (21,22). In contrast to cyclin D1, cyclin D2 and D3 are not associated with breast tumor formation (4). Activation of the cyclin E-CDK2 complex is another essential requirement for the G1/S transition (23). As observed in this study, euphol exerted proliferation inhibitory effects on T47D cells by leading to their arrest at the G0/G1 phase. When the cell cycle phase distributions are compared with alterations in the cell cycle regulatory molecules, a decrease in Cyclin D1 levels may be attributed as a cause of euphol-induced G0/G1 arrest as well as the inhibition of CDK2. Although the cyclin E level was unchanged, decreased CDK2 may also imply an inhibition of cyclin E and cyclin E-CDK2, as the decrease of cyclins or CDKs constrains the formation of active cyclin-CDK complexes. Consistent with the decreased level of cyclin D1 and CDK2 expression induced by euphol, the p-Rb level also decreased, which is probably due to the deficiency of cyclin-CDK complexes in the euphol treated T47D cells. However, the possibility that the two reductions are attributed to the euphol-induced upregulation of CKIs was not excluded.

The predominant CKIs include p21 and p27 of the Cip/Kip family, which inactivate CDK-cyclin complexes (4,23). The increased expression of p21 and p27 by euphol is noteworthy as the development of breast cancer has been associated with a decrease in these CKIs (4). The abundance of p27 is regulated primarily at the post-translational level as demonstrated in the growth factor-mediated reduction in p27 protein levels, primarily through enhanced ubiquitin-mediated degradation (24). Consistent with this study, the transcriptional level of p27 was relatively unchanged based on the qPCR analysis; however, a significant increase was observed in its expression level following euphol treatment. The mechanism of this post-transcriptional regulation of p27 may involve reduced ubiquitination, but this requires further validation. Euphol marginally increased p21 at the transcriptional and post-transcriptional levels compared with that of the untreated control cells. This upregulation may involve a p53-independent pathway, as point mutations in the core DNA binding region and transactivation deficient p53 in the T47D cell line have been demonstrated (25).

Cyclin A is required for the onset of DNA replication in mammalian cells (26) and is rate limiting for the G1/S transition (27). Cylin B is a mitotic cyclin that accumulates at the G2/M transition and acts synergistically with cyclin A during the initiation of mitosis (28). In correlation with the lower abundance of cells in the S and G2/M subpopulations, mRNA and protein levels of cyclin A and B1 were downregulated by euphol treatment. This is similar to a study demonstrating that decreased levels of cyclin A and B correlated with the decreased levels of cells in the S and G2 phases, and increased levels of cells in the G1 phase, in non-small cell lung cancer (29).

The sub-G1 peak observed by FACS analysis was due to the deficient DNA content in apoptotic cells. Identification of the sub-G1 subpopulation may be used as an index of apoptotic cells in the cell cycle analysis (30), although the lack of changes in the sub-G1 population may also be due to the loss of severely damaged cells during the washing process. In this study, the sub-G1 subpopulation remained at a low level, indicating almost negligible apoptosis in T47D cells treated with euphol. This is concordant with a study demonstrating that T47D cells among 8 human breast cancer cell lines of the National Cancer Institute anticancer drug screen were resistant to apoptosis, and in which no apoptosis was observed with 7-hydroxystaurosporine (UCN-01) and minimal apoptosis was identified with camptothecin. This resistance to apoptosis was considered to be determined by the MDM-2/p53 ratio and to be p53-independent (31). The detected minimal apoptosis induced by euphol in T47D cells may be explained by this mechanism. In addition, the extent to which the MDM2/p53 ratio contributed to apoptosis resistance requires further elucidation.

The current study indicated important features of euphol concerning its capacity to target the cell cycle, thus, euphol may be a potential cancer chemotherapy agent. The underlying mechanism of action involved the reduction of cyclin D1, A and B1 levels, downregulation of CDK2, hypophosphorylation of Rb and the induction of CKIs p21 and p27. Although this study has demonstrated the euphol-induced regulation of the cell cycle molecules in T47D cells, further investigation regarding combination therapy leading to lower doses of therapeutic agents and observations of other cancer cell lines are required.

Acknowledgements

This study was supported by funding from the Ministry of Science and Technology (grant nos. 2011CB965100, 2011CBA01100, 2011DFA30480, 2010CB944900, 2010CB945000 and 2012CB966603); the National Natural Science Foundation of China (grant nos. 91219305, 31101061, 31210103905, 31071306, 31000378, 31171432 and 81170499); the Science and Technology Commission of Shanghai Municipality (grant nos. 11ZR1438500 and 11XD1405300); and the Ministry of Education (grant nos. IRT1168 and 20110072110039). The study was also supported by the Chen Guang project supported by Shanghai Municipal Education Commission, Shanghai Education Development Foundation (grant no. 12CG19) and the Fundamental Research Funds for the Central Universities.

References

1 

Cancer Genome Atlas Network. Comprehensive molecular portraits of human breast tumours. Nature. 490:61–70. 2012. View Article : Google Scholar : PubMed/NCBI

2 

DeSantis C, Siegel R, Bandi P and Jemal A: Breast cancer statistics, 2011. CA Cancer J Clin. 61:409–418. 2011. View Article : Google Scholar

3 

de Bono JS, Tolcher AW and Rowinsky EK: The future of cytotoxic therapy: selective cytotoxicity based on biology is the key. Breast Cancer Res. 5:154–159. 2003.PubMed/NCBI

4 

Zafonte BT, Hulit J, Amanatullah DF, Albanese C, Wang C, Rosen E, Reutens A, Sparano JA, Lisanti MP and Pestell RG: Cell-cycle dysregulation in breast cancer: breast cancer therapies targeting the cell cycle. Front Biosci. 5:D938–D961. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Munagala R, Aqil F and Gupta RC: Promising molecular targeted therapies in breast cancer. Indian J Pharmacol. 43:236–245. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Malumbres M and Barbacid M: Cell cycle, CDKs and cancer: a changing paradigm. Nat Rev Cancer. 9:153–166. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Schwartz GK and Shah MA: Targeting the cell cycle: a new approach to cancer therapy. J Clin Oncol. 23:9408–9421. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Chin YW, Balunas MJ, Chai HB and Kinghorn AD: Drug discovery from natural sources. AAPS J. 8:E239–E253. 2006.PubMed/NCBI

9 

Rizk AM, Hammouda FM, El-Missiry MM, Radwan HM and Evans FJ: Biologically active diterpene esters from euphorbia peplus. Phytochemistry. 24:1605–1606. 1985. View Article : Google Scholar

10 

Rasool N, Khan AQ and Malik A: A taraxerane type triterpene from Euphorbia tirucalli. Phytochemistry. 28:1193–1195. 1989. View Article : Google Scholar

11 

de Melo JG, Santos AG, de Amorim EL, do Nascimento SC and de Albuquerque UP: Medicinal plants used as antitumor agents in Brazil: an ethnobotanical approach. Evid Based Complement Alternat Med. 2011:3653592011.PubMed/NCBI

12 

Akihisa T, Ogihara J, Kato J, Yasukawa K, Ukiya M, Yamanouchi S and Oishi K: Inhibitory effects of triterpenoids and sterols on human immunodeficiency virus-1 reverse transcriptase. Lipids. 36:507–512. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Akihisa T, Kithsiri Wijeratne EM, Tokuda H, Enjo F, Toriumi M, Kimura Y, Koike K, Nikaido T, Tezuka Y and Nishino H: Eupha-7,9(11),24-trien-3beta-ol (‘antiquol C’) and other triterpenes from Euphorbia antiquorum latex and their inhibitory effects on Epstein-Barr virus activation. J Nat Prod. 65:158–162. 2002.PubMed/NCBI

14 

Dutra RC, Claudino RF, Bento AF, Marcon R, Schmidt EC, Bouzon ZL, Pianowski LF and Calixto JB: Preventive and therapeutic euphol treatment attenuates experimental colitis in mice. PLoS One. 6:e271222011. View Article : Google Scholar : PubMed/NCBI

15 

Dutra RC, de Souza PR, Bento AF, Marcon R, Bicca MA, Pianowski LF and Calixto JB: Euphol prevents experimental autoimmune encephalomyelitis in mice: evidence for the underlying mechanisms. Biochem Pharmacol. 83:531–542. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Passos GF, Medeiros R, Marcon R, Nascimento AF, Calixto JB and Pianowski LF: The role of PKC/ERK1/2 signaling in the anti-inflammatory effect of tetracyclic triterpene euphol on TPA-induced skin inflammation in mice. Eur J Pharmacol. 698:413–420. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Yasukawa K, Akihisa T, Yoshida ZY and Takido M: Inhibitory effect of euphol, a triterpene alcohol from the roots of Euphorbia kansui, on tumour promotion by 12-O-tetradecanoylphorbol-13-acetate in two-stage carcinogenesis in mouse skin. J Pharm Pharmacol. 52:119–124. 2000. View Article : Google Scholar

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001.

19 

O’Connor PM, Jackman J, Bae I, Myers TG, Fan S, Mutoh M, Scudiero DA, Monks A, Sausville EA, Weinstein JN, et al: Characterization of the p53 tumor suppressor pathway in cell lines of the National Cancer Institute anticancer drug screen and correlations with the growth-inhibitory potency of 123 anticancer agents. Cancer Res. 57:4285–4300. 1997.

20 

Gillett C, Fantl V, Smith R, Fisher C, Bartek J, Dickson C, Barnes D and Peters G: Amplification and overexpression of cyclin D1 in breast cancer detected by immunohistochemical staining. Cancer Res. 54:1812–1817. 1994.PubMed/NCBI

21 

Zukerberg LR, Yang WI, Gadd M, Thor AD, Koerner FC, Schmidt EV and Arnold A: Cyclin D1 (PRAD1) protein expression in breast cancer: approximately one-third of infiltrating mammary carcinomas show overexpression of the cyclin D1 oncogene. Mod Pathol. 8:560–567. 1995.

22 

Lin SY, Xia W, Wang JC, Kwong KY, Spohn B, Wen Y, Pestell RG and Hung MC: Beta-catenin, a novel prognostic marker for breast cancer: its roles in cyclin D1 expression and cancer progression. Proc Natl Acad Sci USA. 97:4262–4266. 2000. View Article : Google Scholar : PubMed/NCBI

23 

Vermeulen K, Van Bockstaele DR and Berneman ZN: The cell cycle: a review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif. 36:131–149. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Pagano M, Tam SW, Theodoras AM, Beer-Romero P, Del Sal G, Chau V, Yew PR, Draetta GF and Rolfe M: Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science. 269:682–685. 1995. View Article : Google Scholar : PubMed/NCBI

25 

Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P, et al: Mutations in the p53 gene occur in diverse human tumour types. Nature. 342:705–708. 1989. View Article : Google Scholar : PubMed/NCBI

26 

Girard F, Strausfeld U, Fernandez A and Lamb NJ: Cyclin A is required for the onset of DNA replication in mammalian fibroblasts. Cell. 67:1169–1179. 1991. View Article : Google Scholar : PubMed/NCBI

27 

Resnitzky D, Hengst L and Reed SI: Cyclin A-associated kinase activity is rate limiting for entrance into S phase and is negatively regulated in G1 by p27Kip1. Mol Cell Biol. 15:4347–4352. 1995.PubMed/NCBI

28 

Knoblich JA and Lehner CF: Synergistic action of Drosophila cyclins A and B during the G2-M transition. EMBO J. 12:65–74. 1993.PubMed/NCBI

29 

Li H, Sun L, Tang Z, Fu L, Xu Y, Li Z, Luo W, Qiu X and Wang E: Overexpression of TRIM24 correlates with tumor progression in non-small cell lung cancer. PLoS One. 7:e376572012. View Article : Google Scholar : PubMed/NCBI

30 

Darzynkiewicz Z, Bruno S, Del Bino G, Gorczyca W, Hotz MA, Lassota P and Traganos F: Features of apoptotic cells measured by flow cytometry. Cytometry. 13:795–808. 1992. View Article : Google Scholar : PubMed/NCBI

31 

Nieves-Neira W and Pommier Y: Apoptotic response to camptothecin and 7-hydroxystaurosporine (UCN-01) in the 8 human breast cancer cell lines of the NCI Anticancer Drug Screen: multifactorial relationships with topoisomerase I, protein kinase C, Bcl-2, p53, MDM-2 and caspase pathways. Int J Cancer. 82:396–404. 1999. View Article : Google Scholar

Related Articles

Journal Cover

October 2013
Volume 8 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Wang L, Wang G, Yang D, Guo X, Xu Y, Feng B and Kang J: Euphol arrests breast cancer cells at the G1 phase through the modulation of cyclin D1, p21 and p27 expression. Mol Med Rep 8: 1279-1285, 2013.
APA
Wang, L., Wang, G., Yang, D., Guo, X., Xu, Y., Feng, B., & Kang, J. (2013). Euphol arrests breast cancer cells at the G1 phase through the modulation of cyclin D1, p21 and p27 expression. Molecular Medicine Reports, 8, 1279-1285. https://doi.org/10.3892/mmr.2013.1650
MLA
Wang, L., Wang, G., Yang, D., Guo, X., Xu, Y., Feng, B., Kang, J."Euphol arrests breast cancer cells at the G1 phase through the modulation of cyclin D1, p21 and p27 expression". Molecular Medicine Reports 8.4 (2013): 1279-1285.
Chicago
Wang, L., Wang, G., Yang, D., Guo, X., Xu, Y., Feng, B., Kang, J."Euphol arrests breast cancer cells at the G1 phase through the modulation of cyclin D1, p21 and p27 expression". Molecular Medicine Reports 8, no. 4 (2013): 1279-1285. https://doi.org/10.3892/mmr.2013.1650